Actividad primer periodo super

4,074 views
3,886 views

Published on

Published in: Education
2 Comments
1 Like
Statistics
Notes
  • profe este trabajo se entrega cuando y en que se hace hojas de block cuadriculas o como (9-1 quimbay)
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
  • sip
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
No Downloads
Views
Total views
4,074
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
63
Comments
2
Likes
1
Embeds 0
No embeds

No notes for slide

Actividad primer periodo super

  1. 1. Actividades de superación de Noveno Primer PeriodoResolver y estudiarPresentar en la primera clase después de semana de recesoLogros del primer periodo  Comprende la composición química del ADN y ARN como macromoléculas básicas del proceso reproductivo y de la conservación genética en las especies.  Diferencie el A.D.N. del A.R.N. por su estructura y composición química  Analiza los trabajos de Mendel y realiza ejercicios y problemas donde se evidencia el cumplimiento de las leyes de la herencia  Elabora y analiza cruces monohíbridos y dihíbridos utilizando los cuadros de Punnett.CuestionarioI- Escriba falso (F) o verdadero (V) según corresponda1. De los siguientes principios del ADN y ARN, señale lo verdadero y lo falso: a- ____La diferencia entre el ADN y ARN es que el 1º tiene 2 hélices y el 2º tiene tres b- ____La principal enzima responsable en la síntesis del ADN es la ARN polimerasa c- ____La principal enzima implicada en la síntesis del ARN es la ADN polimerasa d-____ La estructura de la molécula del ADN, está compuesta por moléculasalternantes de azúcar y fosfato e-____ Los codones son combinaciones de bases de nucleótidos en tercias sobre elARNmf- ____Los dos filamentos de la molécula de ADN se separan fácilmente durante lareplicación cuando se rompen sus enlaces de hidrógeno2 - De los siguientes principios del ADN y ARN, señale lo verdadero y lo falso:a- ____ La diferencia entre el ADN y ARN es que el 1º tiene 2 hélices y el 2º tiene 1b-____ La estructura de la molécula del ADN, está compuesta por moléculas Alternantes de azúcar y fosfato y puentes de hidrógenoc-____ Los codones son combinaciones de bases de nucleótidos en tripletas sobre el ARNmd- ____La principal enzima responsable en la síntesis del ADN es la ARN polimerasae- ____La principal enzima implicada en la síntesis del ARN es la ADN polimerasaf- ____Los dos filamentos de la molécula de ADN se separan difícilmente durante la Replicación y no se rompen sus enlaces de hidrógeno3- Escribe verdadero ofalsoa-Un solo cambio en una base nitrogenada del ADN puede representar una mutación.______b- Una de las enzimas responsable de la replicación del ADN es la ADNpolimerasa.______c- La unión entre las bases complementarias del ADN se realiza mediante puentes dehidrógeno. _____d- Las dos hebras de ADN no son iguales sino complementarias. ____e- El modelo de la doble hélice del ADN fue descubierto por Fred Griffith. ____
  2. 2. f- Los nucleótidos de los ácidos nucleicos se unen entre si por grupos fosfato formandolargas cadenas. ______g- La molécula de ARN está formada por dos largas cadenas de nucleótidos formandouna doble hélice. _____h- La longitud de una molécula de ADN y el número de genes varía de unosorganismos a otros. ____i-La mutación que sufre un organismo en cualquiera de sus células se transmitirá a ladescendencia._______j- Algunos fallos producidos en la replicación pueden originar mutaciones. ______k- Las largas cadenas de ARN contienen una sucesión lineal de genes. _______II- Marque la respuesta correcta1-En la síntesis proteica, los aminoácidos son transferidos del citoplasma al ribosomapor:a- ADN cargado con un aminoácido se alinea debidamente sobre un molde ad ARNmb- ARNt, cargado con un anticodón + aminoácido que se alinea debidamente sobre unMolde de ARNm.c- ARNm lleva el aminoácido desde el citoplasma al núcleo donde está el ADNd- ARNr lleva los aminoácidos desde el citoplasma al núcleo donde está el ADNe- Ninguno de los anteriores2- La función principal del ARN de transferencia (ARNt) es la siguiente: a- Transporta aminoácidos desde el núcleo al citoplasma celular en donde los alinea b- Transporta aminoácidos del citoplasma al ribosoma en donde los alinea con un Anticodón para la síntesis de proteína. c- Transporte de sodio y potasio del exterior al interior de la célula d- Ninguna de las anteriores e- Todas las anteriores3- La función principal del ARN mensajero (ARNm) es la siguiente: a- Transporta la información del ADN, desde el núcleo al citoplasma y crear proteínas b- Transporta con ciertas proteínas el material para formar los ribosomas delcitoplasma c- Transporta aminoácidos desde el citoplasma al ribosoma en donde los alinea d- Ninguna de las anteriores e- Todas las anteriores4- La función principal del ARN ribosómico (ARNr) es la siguiente: a- Transporta la información del ADN, desde el núcleo al citoplasma y crear proteínas b- Transporta aminoácidos desde el citoplasma al ribosoma en donde los alinea c- Transporta con ciertas proteínas el material para formar los ribosomas delcitoplasma para su mantenimiento y descifrar el código genético. d- Ninguno de los anteriores e- Todos los anteriores5- Mencione la base de nucleótido que se encuentra en el ARN pero no en el ADN: a- adenina b- Guanina c- Uracilo
  3. 3. d- Timinae- Ninguna de las anteriores6- Mencione las bases de nucleótidos presentes en el ADN: a - 2 purinas: adenina (A) y guanina (G) y 2 pirimidinas: citosina (C) y timina (T) b- 2 purinas: adenina (A) y guanina (G) y 2 pirimidinas: citosina (C) y uracilo (U) c- 2 purinas: adenina (A) y guanina (G) y 2 pirimidinas: uracilo (U) y timina (T)d- 2 purinas: adenina (A) y uracilo (U) y 2 pirimidinas: citosina (C) y timina (T)e- Todas las anteriores7- ¿Cual de las siguientes aseveraciones es correcta acorde con el “código genético”? a- Es el lenguaje de los genes que se utiliza para convertir la secuencia lineal de ADN En la secuencia de aminoácidos en las proteínas b- Basta sólo cuatro bases de nucleótidos para codificar las miles de proteínas que Constituyen un órgano o tejido de un ser vivo c- Las bases de nucleótidos de la doble hélice del ADN se aparean con puentes de Hidrógeno entre (A) adenina con (T) timina y entre (G) guanina con (C) citosina d- Sólo (a) y (b) son ciertas e- Todas las anteriores son ciertas8. Señale el dogma central de la biología molecular en las siguientes secuencias: a- ADN PROTEINA ARN b- ARN ADN PROTEINA c- ADN ARN PROTEINA d- PROTEINA ADN ARN e- Ninguna de las anteriores es correcta9- La principal diferencia entre el ADN Y EL ARN es la siguiente, razone su respuesta: a- Que el ARN contiene doble hélice, la desoxirribosa, adenina, guanina, citosina ytimina b- Que el ARN contiene un azúcar llamado desoxirribosa y doble hélice c- Que el ARN contiene un azúcar llamado ribosa, una sola hélice y una base uracílo d- No hay ninguna diferencia e- Todas son correctas10- Tomando en cuenta el dogma central de la biología molecular cuando la secuenciade bases de una porción de ADN, se utiliza como modelo para formar una molécula deARN con una secuencia complementaria de bases, este proceso se denomina: a- Taslocación b- Traducción c- Transcripción d- Inversión e- Ninguna de las anteriores11- - Tomando en cuenta el dogma central de la biología molecular cuando lasecuencia de bases de una porción de ARN, se utiliza como molde para formar unasecuencia de aminoácidos (proteinas) este proceso de denomina: a- Taslocación b- Traducción c- Transcripción d- Transverción e- Ninguna de las anteriores
  4. 4. 12- Se le atribuyen el título de precursores de la biología molecular, del ADNrecombinante, doble hélice del ADN y premios Nobel de fisiología y medicina del año1962 a los siguientes teóricos, señale la alternativa más correcta: a- James D. Watson b- Francis Crick c- Maurice Wilkins d- Ninguno de los anteriores e- A, B Y C juntos, participaron en el descubrimiento de la estructura del ADN13 – Quien transporta aminoácidos del citoplasma al ribosoma y lo alinea con unanticodón para la síntesis de proteína se llama: a- ARNm (ARN mensajero) b- La Bomba de Nacl y Kcl c- ARNt (ARN de transferencia)d- ARNr (ARN ribosómico)e- Todas las anteriores14- Quien transporta con ciertas proteínas el material para formar los ribosomas delcitoplasma su mantenimiento y a descifrar el código genético se denomina: a- ARNm (ARN mensajero) b - ARNr (ARN ribosómico) c- ARNt (ARN de transferencia) d- ADN polimerasa e- Ninguna de las anteriores15 – Quien Lleva la información del ADN, desde el núcleo al citoplasma para crearproteínas recibe el nombre de: a- ARNm (ARN mensajero) b- ARN polimerasa c- ARNt (ARN de transferencia) d- ARNr (ARN ribosómico) e- Ninguna de las anteriores16 – ¿Cuál de las siguientes bases de nucleótidos pertenece al ARN? a- 2 purinas: adenina (A) y guanina (G) y 2 pirimidinas: citosina (C) y uracilo (U) b- 2 purinas: adenina (A) y guanina (G) y 2 pirimidinas: uracilo (U) y timina (T) c - 2 purinas: adenina (A) y guanina (G) y 2 pirimidinas: citosina (C) y timina (T) d- 2 purinas: adenina (A) y uracilo (U) y 2 pirimidinas: citosina (C) y timina (T) e- Solamente en (a), (b) y (d) son ciertas17- En la síntesis proteica, los aminoácidos son transferidos del citoplasma alribosoma por: a- ADN cargado con un aminoácido se alinea debidamente sobre un molde ad ARNm b- ARNt, cargado con un anticodón + aminoácido que se alinea debidamente sobre un Molde de ARNm. c- ARNm lleva el aminoácido desde el citoplasma al núcleo donde está el ADN d- ARNr lleva los aminoácidos desde el citoplasma al núcleo donde está el ADN e- Ninguno de los anteriores18 - ¿Cual de las siguientes aseveraciones es correcta acorde con el “códigogenético”? a- Es el lenguaje de los genes que se utiliza para convertir la secuencia lineal de ADN
  5. 5. En la secuencia de aminoácidos en las proteínasb- Basta sólo cuatro bases de nucleótidos para codificar las miles de proteínas que Constituyen un órgano o tejido de un ser vivoc- Las bases de nucleótidos de la doble hélice del ADN se aparean con puentes de Hidrógeno entre (A) adenina con (T) timina y entre (G) guanina con (C) citosinad- Sólo (a) y (b) son ciertase- Todas las anteriores son ciertas19- ¿Dónde se encuentran los genes:a) en los alelos; b) en el ARN; c) en los cromosomas; d) por toda la célula.20- ¿En qué molécula está contenida la información genética?a) En el ARN; b) en el ADN; c) en el nucleótido; d) en el cromosoma.21- ¿Cómo se llaman las moléculas de menor tamaño que constituyen los ácidosnucléicos?a) ARN b) ADN c ) en el nucleótido; d) en el cromosoma.22- La unidad hereditaria responsable de la manifestación de un carácter se llama....a) gameto b) alelo c) gen d) zigoto23- Las diferentes variedades de un gen referidas a un mismo carácter se llaman...a) heterocigóticos; b) alelos; c) recesivos; d) mutantes.24- Se entiende por genotipo:a) el conjunto de caracteres de un individuo; b) el conjunto de alelos no recesivos deun individuo;c) el conjunto de manifestaciones hereditarias; d) el conjunto de genes que posee unindividuo para un carácter.25- Un individuo homozigótico es...a) el que no tiene genes dominantes; b) el que no tiene genes recesivos;c) el que tiene el genotipo respecto de un carácter formado por genes iguales;d) el que tiene tantos genes dominantes como recesivos.26- Un individuo que tiene los genes Aa respecto un determinado carácter puededecirse que es...a) recesivo; b) alelo; c) híbrido o heterocigótico; d) híbrido puro.27- La manifestación externa del genotipo se llama....a) dotación cromosómica; b) fenotipo; c) genotipo, d) gametos.10- Un individuo heterocigótico Aa puede transmitir.a) a todos sus gametos el gen A porque este gen es dominante;b) a un 75% el gen A y al 25% el gen a por ser el gen A dominante;c) a un 50% el gen A y a otro 50% el gen a;d) a todos los gametos Aa.28- En la especie humana todas las células no reproductoras tienen:a) 23 pares de autosomas; b) 22 pares de autosomas;c) 22 autosomas; d) 22 heterocromosomas.29- En las vacas la presencia de cuernos (c) es recesiva respecto al alelo (C) "sincuernos". Se cruzan un toro con cuernos y una vaca sin cuernos y tienen un ternerocon cuernos.a) Eso quiere decir que "con cuernos" era, en realidad, dominante.
  6. 6. b) Eso no puede ser, pues, al ser sin cuernos dominante, los terneros no pueden tenercuernos.c) Puede ser si ambos son dominantes.d) Puede ser si la vaca es heterocigótica.31- Estudiantes de bioquímica en un laboratorio determinaron la siguiente secuenciade bases nitrogenadas en una hebra de ADN que estaba siendo transcrita Adenina Timina Citosina GuaninaDe acuerdo con esto se puede esperar que la secuencia de bases nitrogenadas en elARN mensajero formado sea:32- La base complementaria del uracilo (U) es:a) timina (T) b) guanina (G) c) adenina (A) d) citosina (C).33- Las siguientes bases nitrogenadas son pirimidinasa) Citosina y Guanina b) Adenina y Timina c) Adenina y Uracilo d) Adenina yGuanina.34- ¿El ADN esta contenido en?a) Toda la celula; b) nucleo c) en el nucleótido d). en el ARN;35- ¿El ADN están constituido por unidades básicas llamadas?a) nucleotidos b) enzimas c ) aminoácidos d) péptidos.36- Partiendo del ARN m construye la cadena de ADN y el péptido correspondiente:ADNARN m AGCGAAAAGGUGUCAGGGGGAUGCUGCCCCUCUUUGAGUGAGUGAPéptido37- La síntesis de proteínas es un proceso unidireccional que se puede resumir así:La cadena de _______ es copiada por el ______ este proceso se conoce como_______________ Luego el ________ lleva la información al __________, parte de lacélula donde se produce la síntesis de proteínas este proceso se llama ____________38- Señalar la secuencia complementaria de la banda de ADN formada por:ATTGGTACCGCA a. TAACCATGGCGT b. UTTGGTACCGCA c. TUUGGTCCGCT d. ATTGGTACCGCAIII Resuelve 1- Se cruza una mujer de ojos azules (carácter recesivo) con un hombre de ojos café heterocigoto, dibuje el cuadro de Punnett y encuentre todos los posibles genotipos y fenotipos para los hijos.
  7. 7. 2- En la arveja de jardín la posición axial de las flores es una característica dominante sobre la posición terminal de las flores. Si una planta homocigota de flores axiales se cruza con una planta de flores terminales ¿cuál será el fenotipo y el genotipo para F1 y F2 respectivamente. 3- Se cruza dos ratones uno blanco heterocigoto y otro negro. Si usted sabe que el alelo dominante para el color de pelo es blanco y el recesivo negro, dibuje el cuadro de Punnett y encuentre todos los posibles genotipos y fenotipos para de la descendencia. 4- Un individuo de grupo A (IAi) producirá los siguientes gametos: 5- ¿Cómo serán los hijos de un hombre daltónico y una mujer portadora de este carácter? 6- Decir los fenotipos esperados entre los hijos de una pareja en la que él es del grupo AB y ella del grupo A, pero su padre era del grupo O. 7- A partir de esta secuencia de un ARN mensajero, ACG-CCA-UCA-GGA-. ¿Qué cadena de aminoácidos se sintetizaría? 8- Describe con tus palabras lo que significa para ti esta frase: "El fenotipo es una reacción del genotipo con el medio ambiente". 9- Una alteración en la información del ADN ¿qué es?. 10- Explica qué son: genes, alelos, cariotipo y cromosomas homólogosRealizar ejercicios propuestos en el blog o en el siguiente linkhttp://recursostic.educacion.es/secundaria/edad/4esobiologia/4quincena7/index_4quincena7.htmInstrucciones1-entra al blog profeluz4.blogspot.com2- Buscar actividad resaltada con amarillo3- Dar click en entrar, repasar contenidos y luego en el menú seleccionar ejercicios;entrar en uno por uno y hacerlos, lo mismo que en autoevaluaciónAutoevaluación 1: Conceptos de genéticaAutoevaluación 2: Caracteres hereditariosAutoevaluación 3: Los genes y la expresión génicaAutoevaluación 4: Las mutacionesHerencia ligada al sexo: Daltonismo y hemofiliaGenética humana: Herencia de un carácterGenética humana: Herencia de dos caracteresGenética humana: Herencia de los grupos sanguíneosAlguna inquietud correo profeluz4@hotmail.com

×