Your SlideShare is downloading. ×
Regulation of atp7 a gene expression by the    grx1 as an inducer in menkes disease
Regulation of atp7 a gene expression by the    grx1 as an inducer in menkes disease
Regulation of atp7 a gene expression by the    grx1 as an inducer in menkes disease
Regulation of atp7 a gene expression by the    grx1 as an inducer in menkes disease
Regulation of atp7 a gene expression by the    grx1 as an inducer in menkes disease
Regulation of atp7 a gene expression by the    grx1 as an inducer in menkes disease
Regulation of atp7 a gene expression by the    grx1 as an inducer in menkes disease
Regulation of atp7 a gene expression by the    grx1 as an inducer in menkes disease
Regulation of atp7 a gene expression by the    grx1 as an inducer in menkes disease
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Regulation of atp7 a gene expression by the grx1 as an inducer in menkes disease

707

Published on

A hypothetical solution to genetically treat Menkes Disease using various molecular biology techniques

A hypothetical solution to genetically treat Menkes Disease using various molecular biology techniques

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
707
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
4
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Engineering Glrx1 expression cassette for ATP7Ainteractions in Menkes diseaseKeywords: ATP7A gene, truncated protein, Cu++, X-linked recessive, Glrx1 A20263866 PRANAMEE SARMA
  • 2. INTRODUCTIONMenkes disease is an X-linked disease due to mutations in a gene which is designated as ATP7Agene (basolateral form). The apical form of this gene, ATP7B is known to cause Wilson disease.ATP7A gene is known as the Cu++ transporting alpha polypeptide while the beta polypeptide isthe ATP7B gene. Copper is necessary for the cells but a defect in the ATP7A gene leads to toxicaccumulation of this heavy metal in the body. Menkes disease effects the bone, hair, skin,blood vessels and nerve function.ATP7A gene encodes for a P-type copper transolcating ATPase which generally stays in thetrans-Golgi network and then shuttles in and out as per requirement. It has heavy-metalbinding domains in the N-terminal and these are six in number which bind Cu via their CxxCamino acid motifs, where X is any amino acid ( C is the acronym for Cysteine). The Cysteineresidues aid in the Cu metal binding to these domains via their thiol groups. Also, theseCysteine residues (thiol groups) are glucathionylated which triggers the binding of Glrx1 to theCxxC motif of the N-terminal side of ATP7A thus forwarding the entire process of ATP7A tosupply Copper to the enzymes needing it and to help the cells in the efflux of excess Copperfrom it.A mutation in the ATP7A gene results in the production of an abnormal truncated protein whichgets stuck in the cell membrane and thus cannot shuttle in and out from the Golgi apparatus.This mutated activity disrupts the normal distribution of Copper in the body leading toaccumulation of Copper , also impairing the Copper-dependent enzyme activities in the bodyaffecting the bone, skin, hair, blood and nervous system.GENE INFORMATION :Name of the Gene : ATP7A; ATPase, Cu++ transporting, alpha polypeptideAccession number : NM_000052Species : Homo sapiensSize : 8499 base pairs (bp)Chromosome location : Xq 13.2 (q is the long arm)Reason for the disease : Mutations such as ‘Deletions’ ‘Transitions’ ‘Nonsense’ or ‘Mismatch’are the most common mutations causing Menkes disease and thus, a truncated ATP7A proteinwhich is not long enough to bind Copper and activate Glrx1 activity for further metabolism. Theshortened ATP7A remains in the Trans-Golgi network because it can not reach out for thenormal activity.
  • 3. cDNA sequence of ATP7A 5’atggatccaa gtatgggtgtgaattctgtt accatttctg ttgagggtat gacttgcaat tcctgtgttt ggaccattgagcagcagatt ggaaaagtga atggtgtgca tcacattaag gtatcactgg aagaaaaaaa tgcaactatt atttatgacc ctaaactaca gactccaaag accctacagg aagctattgatgacatgggc /////////////////////////////////////////////////////////////////////////// taaactttac aggaaaccaa tcagcgttca tgttggaata gatgatacct caaggaattctcctaaactg ggtttgctgg accggattgt taattatagc actgtctgat aaacgctccc taaacagtgt tgttaccagt gaacctgaca agcactcactcctggtggga gacttcaggg aagatgatga cactgcatta taa 3’ 3’ cc ttctactact gtgacgtaat att 5’Protein size : 8499bp/3 x 110=311.63 kDaRequisites for PCRPrimers (Primer design)Top Primer : - Tm = 70⁰C - Sequence 5’ atggatccaa gtatgggtgtgaatt 3’Bottom Primer : - Tm = 68⁰C - Sequence 5’ ttataatgcagtgtcatcatcttcc 3’LINKERSThe restriction sites on pmWasabi-C and our gene of interest gives us two restriction enzymes –BsaAI and DraI.Top Primer with BsaAI Linker5’ acgt atggatccaa gtatgggtgtgaatt 3’Bottom Primer with DraI Linker5’ ttt ttataatgcagtgtcatcatcttcc 3’*Used NEBcutter online version for the above restriction site determination; we can alsoMOLECULAR COMBING technique.
  • 4. In-vitro protocol for the process:Raw Material. Amniotic stem cells (diseased and normal), DNA isolation kit, enzymes, cellculture system, PCR, synthetic tRNA suppressors (amber, UAG; opal, UGA)Procedure. ATP7A gene is also expressed in the placenta, due to its functional importance.Amniocentesis allows us to isolate few amniotic stem cells from the amniotic fluid around thegrowing embryo. These cells are grown in vitro in a culture dish. When these cells are at least70-80% confluent in the dish, they are Trypsinised and the cell suspension is centrifuged . Thepellet that is obtained now contains DNA and RNA. It is treated with Dnases. The mRNA fromtotal RNA content is isolated using Oligo (dT) magnetic beads. To isolate ATP7A mRNA, we useHis Trap ᵀᴹ Column for Affinity chromatographical separation of Histidine rich ATP7A mRNA.Wash the column with Elution buffer and the eluate contains ATP7A mRNA. mRNA is ReverseTranscribed into cDNA using RT-PCR and the above designed primers. cDNA is amplified by PCR.The product is then purified using PCR product purifying kit. The cDNA is then subjected torestriction digestioin with enzymes BsaAI and DraI. The vector Allᵉᴵᵉustrious pmWasabi-C is alsotreated with the same two restriction enzymes. Followin digestion, the cDNA is inserted intothe expression vector using Ligase. The plasmid is transformed into competent DH5α cells(better strain than others) by heat shock. These cells are plated in LB-Agar medium containingAmpicillin (ampᴿ gene present in the Vector is used for selection of transformed cells). Theselected cells are inoculated and cultured in LB media containing Ampicillin. The recombinantplasmids are then isolated by screening and selection.Validation of cDNA. The plasmids obtained can be validated by :1) Restriction digestion of the plasmids with BsaAI and DraI. The produced fragments are thenrun on gel and the bands obtained corresponding to the ‘gene of interest’ and ‘vector used’ areobserved.2) Automated DNA sequencing of the resultant recombinant plasmid will also give us the ‘gene’and ‘vector’ sequence.3) Restriction digestion using only BsaAI will give a linear molecule from which the cDNA can bevalidated using DNA Microarray technique by using probed DNA primers complementary to thegene/cDNA region.
  • 5. Transfection of the recombinant plasmidTARGET CELLS : Paneth or Goblet cell lines (Small Intestine where Cu²⁺ absorption occurs)TRANSFECTION METHOD : Liposome mediated transfectionVALIDATION of TRANSFECTION :The expression vector we are using is a Green Fluorescent protein (GFP) which can be detectedand thus our protein localisation can be visualised under Flourescent microscope.Two more methods that we may use for validation : 1) IMMUNOSTAINING : A primary antibody is used against target ATP7A protein. Then asecondary antibody tagged with a Fluorophore/Chromophore is used against the primaryantibody. The reaction between these two give detectable results which can be visualisedunder the microscope if the protein is translated successfully. 2) WESTERN BLOT : The protein is isolated traditionally and run on SDS-PAGE gel. This gel isthen transferred onto the membrane and a primary antibody agains ATP7A protein is used. Wethen incubate this membrane with a secondary antibody against the primary antibody. Thebinding of these two gives a chemiluminiscent reaction which can be developed on the X-rayfilm in a dark room.
  • 6. RESEARCH PROPOSALGOAL : The goal is to design codon read-through ‘tRNA suppressors’ for UGA terminationcodons which occur in some exons of the ATP7A gene due to mutations (Nonsense) leading tosudden termination and thus a non-functional truncated protein which remains in the Trans-Golgi network due to unusually shortened length.BACKGROUND : According to many experiments conducted on the Mouse homolog of HumanATP7A gene, it was found that this gene produces a protein which help in Cu ²⁺ absorption aswell as efflux of the excess and is Copper-transporting ATPase (Vulpe et al, 1993). The differentmutations of the ATP7A gene that lead to Menkes Disease were X-linked recessive with pointmutations and exon skipping were observed and identified by Kaler et al, 1994; Tumer et al,1997; Poulsen et al, 2002; Moller et al, 2005; Moizard et al, 2011. Almost all of these mutationsled to a truncated ATP7A protein.The work of Chiara Cecchi, Mario Tosi et al, 1997 indicated the 3D model of the ATP7A genewhich showed the transmembrane properties of the protein and indicated the 6 metal bindingdomains on the -NH₂ terminal and an ATP-binding domain on the –COOH terminal. Thepresence of this protein in the Gastrointestinal tract and Golgi body was determined by IliaVoskoboinik et al, 2002 and Subba Rao Gangi Setty et al, 2008 and Sharon La Fontaine et al,1998. The metal binding sites have a consensus sequence of MXCXXC where X is any amino acidand the main domains important for proper functioning of ATP7A is Metal binding site 5 and 6was determined by Daniel Strausak et al, 1999. The ATP7A is also rich in amino acid Histidineand Methionine, which is found to be essential for ATP7A was studied by Yan Guo et al, 2004.OUTLINE : The ATP7A protein (an ATPase) is truncated due to the mutations (nonsense, etc)and thus its Cu²⁺effluxing is affected leading to accumulation of Cu²⁺ in high toxicconcentrations. Glrx1 interacts with ATP7A’s CXXC motifs in the N-terminal which is signalled byglutathionylation of the ‘Cysteine’s thiol residues’ but Glrx1 cannot sense that in a truncatedprotein. Thus, we can create an expression cassette including ATP7A gene and Glrx1 and insertinto the same vector.RESULT ANALYSIS : The validation can be done using the GFP in the pmWasabi-C vector. Oncethe glutathionylation (post-translational modification) occurs, Glrx1, due to close proximity oftranscription of the gene, might be able to bind to the N-terminal of ATP7A and carry forth thefunctional responsibility as in a normal situation. We can make use of the Locus control regions(LCR) of both genes to stimulate gene expression as per the layout. If this works, we can thenuse this ‘expression cassette’ as a gene therapy for Menkes Disease.(*http://www.ncbi.nlm.nih.gov/projects/gorf/orfig.cgi- the mutation can be counted andanalysed using ORF Finder, maximum are point mutations of various kinds)
  • 7. ESTIMATED COSTRent and Miscellaneous(utility, insurance,etc.) $ 20, 000/monthBase Materials required(Glasswares, plastics, chemicals, expression cassette*) $ 50, 000-80, 000Laser Capture Microdissection $ 70, 000Fluorescence Microscope $ 30, 000PCR Machine (Cycler) $ 10, 000Co₂ Incubator $ 5000Centrifuge machine $ 5000Chromatography Column $ 500 - 800Refrigerator $ 1000Water Bath $ 800Autoclave $ 500-800Maintenance $ 20 – 50,000TOTAL COSTS (Approx.) $ 2, 73, 4000 (approx)*Hypothetical construct diagram for the expression cassette
  • 8. REFERENCES 1. Danks, D. M., Campbell, P. E., Stevens, B. J., Mayne, V., Cartwright, E. Menkes’ kinky hair syndrome: an inherited defect in copper absorption with widespread effects. Pediatrics 50: 188-201, 1972 2. Tumer, Z., Horn, N. Menkes disease: recent advances and new aspects. J.Med. Genet. 34: 265-274, 1997 3. Moller, L. B., Bukrinsky, J. T., Molgaard, A., Paulsen, M., Lund, C., Tumer, Z., Larsen, S., Horn, N. Identification and analysis of 21 novel disease-causing amino acid substitutions in the conserved part of ATP7A. Hum. Mutat. 26: 84-93, 2005 4. Poulsen, L., Horn, N., tumer, Z., Heilstrup, H., Lund, C., Moller, L. B. X-linked recessive Menkes disease : identification of partial gene deletions in affected males. Clin. Genet. 62: 449-457, 2002 5. Moizard, M., Ronce, N., Blessen, S., Bieth, E., Burglen, L., Mignot, C., Mortemousque, I., Marmin, N., Dessay, B., Danesino, C., Feillet, F., Castelnau, P., Toutain, A., Moraine, C., Raynaud M Twenty-five novel mutations includiing duplications in the ATP7A gene. Clin. Genet. 79: 243-253, 2011 6. Zeynep, T., Lisbeth, B. M., Nina, H. Mutation spectrum of ATP7A, the gene defective in Menkes disease. Adv. Exp. Med. Biol. 448: 83-95, 1999 7. Baci, L., Bertini, I., Cantini, F., Migliardi, M., Rosato, A., Wang, S. An atomic-level investigation of the disease causing A629P mutant of the Menked protein, ATP7A. J Mol Biol 16: 352(2) : 409-17, 2005 8. Kuo, Y. M., Gitshcier, J., Packman, S. Developmental expression of the mouse mottled and toxic milk genes suggests distinct functions for the Menkes and Wilson disease Copper transporters. Hum. Molec. Genet. 6: 1043-1049, 1997 9. Tumer, Z., Lund, C., Tolshave, J., Vural, B., Tonnesen, T., Horn, N. Identification of point mutations in 41 unrelated patients affected with Menkes disease. Am. J. Hum. Genet. 60: 63-71, 1997 10. Gourdon, P., Liu, X. Y., Skjorringe, T., Morth, J. P., Moller, L. B., Pedersen, B. P., Nissen, P. Crystal structure of copper-transporting PIB-type ATPase. Nature 475: 59-64, 2011 11. William C. J., Kelly T. M., Michael A. C., Wendy R. W., Ross M., Yu Y., Philip E. T., Julian F. B. M., Sharon L. F. Role of Glutaredoxin 1 and Glutathione in regulating the activity of the copper-transporting P-type ATPases, ATP7A and ATP7B. The Journal of Biological Chemistry 285 : 27111-27121, 2010 12. http://www.ncbi.nlm.nih.gov/nuccore/NM_000052.5 The source pages are attached on the next page, for ATP7A sequence as obtained from NCBI site.

×