Your SlideShare is downloading. ×
0
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
4 – la revolución genética
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

4 – la revolución genética

832

Published on

Presentación sobre la biotecnología

Presentación sobre la biotecnología

Published in: Education
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
832
On Slideshare
0
From Embeds
0
Number of Embeds
3
Actions
Shares
0
Downloads
44
Comments
0
Likes
1
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. 4 – La revolución genética Ciencias para el Mundo Contemporáneo
  • 2. Aportaciones de Mendel• Mendel (1822-1884) demostró que las unidades de la herencia determinantes de los caracteres no se mezclan, sino que mantienen su individualidad, transmitiéndose independientemente a la descendencia.• Los factores hereditarios almacenados en los gametos (óvulos y espermatozoides) son de doble procedencia (materna y paterna) se unen en el nuevo individuo sin mezclarse.• La herencia sigue normas estadísticas sencillas.
  • 3. Vocabulario• Alelo: cada una de las versiones de un gen. Si los alelos son diferentes, se expresa el dominante, quedando oculto el recesivo.• Genotipo: composición genética de un organismo.• Fenotipo: manifestación externa del genotipo. Está determinado por el genotipo y los factores ambientales.
  • 4. 1ª Ley de Mendel Al cruzar entre sídos razas puras seobtiene unageneración filialque es idénticaentre sí e idénticaa uno de lospadres.
  • 5. 2ª Ley de MendelAl cruzar entre sí doshíbridos oheterocigotos, losfactores hereditarios(alelos) de cadaindividuo se separan,ya que sonindependientes, y secombinan entre sí detodas las formasposibles.
  • 6. 3ª Ley de Mendel Al cruzar entre sí dos dihíbridos los caracteres hereditarios se separan, puesto que son independientes, y se combinan entre sí de todas las formas posibles.
  • 7. Problema 1En el hombre, el albinismo (falta de pigmentación) es el resultado dedos alelos recesivos, a, y la pigmentación, carácter normal, vienedeterminada por el alelo dominante A. Si dos individuos conpigmentación normal tienen un hijo albino:a) ¿Cuáles pueden ser sus genotipos?b) ¿Cuál es la probabilidad de que en su descendencia tengan un hijo albino?
  • 8. a) ¿Cuáles pueden ser sus genotipos? pigmentación normal x pigmentación normal Albino aaComo indica el enunciado, el albinismo se debe a la presencia de dosalelos recesivos a, por tanto el hijo albino tiene un genotipo aa y harecibido un alelo a de cada uno de sus progenitores.
  • 9. a) ¿Cuáles pueden ser sus genotipos? pigmentación normal x pigmentación normal Aa Aa Albino aaAl tener pigmentación normal, los padres deben tener también presenteel alelo A y, por consiguiente, son heterocigotos (Aa).
  • 10. b) ¿Cuál es la probabilidad de que en su descendencia tengan un hijo albino? pigmentación normal x pigmentación normal Aa AaGAMETOS A a A a AA Aa Aa aa 1 albino De cada cuatro descendientes La probabilidad de tener un hijo albino es, en este caso, de ¼ (25%).
  • 11. Problema 2En los melocotones, el genotipo homocigoto GOGO produce glándulasovales en la base de las hojas. El heterocigoto GAGO produce glándulasredondas, y el homocigoto GAGA carece de glándulas. En otro locus, elalelo dominante L produce piel peluda y su alelo recesivo l da lugar apiel lisa. Si se cruza una variedad homocigota para piel peluda y singlándulas en la base de sus hojas con una variedad homocigota conglándulas ovales y piel lisa,a) ¿qué proporciones fenotípicas se pueden esperar en la F2?
  • 12. a) ¿qué proporciones fenotípicas se pueden esperar en la F2?P Piel peluda y sin glándulas x glándulas ovales y piel lisa GAGA LL El individuo de piel peluda y sin glándulas en la base de las hojas es GAGA porque éste es el único genotipo que determina la ausencia de glándulas. Además es LL porque nos indican que es homocigoto y que manifiesta el carácter dominante “piel peluda”, determinado por el alelo L.
  • 13. a) ¿qué proporciones fenotípicas se pueden esperar en la F2?P Piel peluda y sin glándulas x glándulas ovales y piel lisa GAGA LL GOGO ll El individuo de glándulas ovales y piel lisa es GOGO porque éste es el único genotipo que determina la presencia de glándulas ovales. Además es ll porque manifiesta el carácter recesivo “piel lisa” determinado por el alelo l.
  • 14. a) ¿qué proporciones fenotípicas se pueden esperar en la F2? P Piel peluda y sin glándulas x glándulas ovales y piel lisa GAGA LL GOGO llGAMETOS  GA L GO l F1 GAGO Ll Glándulas redondas y piel peluda La primera generación filial será uniforme y estará formada por dihíbridos de glándulas redondas y piel peluda.
  • 15. a) ¿qué proporciones fenotípicas se pueden esperar en la F2?Para obtener la F2 cruzaremos dos individuos de la F1Cada individuo puede formar cuatro tipos de gametos F1 GAGO Ll x GAGO Ll GAL GAl GAL GAlGAMETOS  G OL G Ol G OL G OlDispondremos los gametos en una cuadrícula genotípica para obtener laF2 .
  • 16. a) ¿qué proporciones fenotípicas se pueden esperar en la F2? GAGO Ll GAMETOS  G AL GA l GO L GO l  GAL GAGA LL GAGA Ll GAGO LL GAGO Ll GA l GAGA Ll GAGA ll GAGO Ll GAGO llGAGO Ll F2 G OL GAGO LL GAGO Ll GOGO LL GOGO Ll G Ol GAGO Ll GAGO ll GOGO Ll GOGO ll
  • 17. a) ¿qué proporciones fenotípicas se pueden esperar en la F2? GAGA LL GAGA Ll GAGO LL GAGO Ll GAGA Ll GAGA ll GAGO Ll GAGO ll GAGO LL GAGO Ll GOGO LL GOGO Ll GAGO Ll GAGO ll GOGO Ll GOGO ll Proporciones fenotípicas6/16 glándulas redondas - piel peluda 2/16 glándulas redondas - piel lisa3/16 sin glándulas - piel peluda 1/16 sin glándulas - piel lisa3/16 glándulas ovales - piel peluda 1/16 glándulas ovales - piel lisa
  • 18. Problema 3Un gen recesivo ligado al sexo produce en el hombre el daltonismo. Ungen influido por el sexo determina la calvicie (dominante en los varonesy recesivo en las mujeres). Un hombre heterocigoto calvo y daltónico secasa con una mujer sin calvicie y con visión de los colores normal, cuyopadre no era daltónico ni calvo y cuya madre era calva y con visiónnormal.¿Qué fenotipos pueden tener los hijos de este matrimonio?
  • 19. ¿Qué fenotipos pueden tener los hijos de este matrimonio? X visión normalDaltonismo X > Xd Xd daltonismo C calvo C>NCalvicie N sin calvicie N>C calvo y daltónico x sin calvicie y visión normal CN XdYNos indican que el hombre es heterocigoto calvo, por lo que su genotipo paraeste carácter es CNPor otra parte, si es daltónico tendrá el gen que lo determina en su únicocromosoma X
  • 20. ¿Qué fenotipos pueden tener los hijos de este matrimonio? X visión normalDaltonismo X > Xd Xd daltonismo C calvo C>NCalvicie N sin calvicie N>C calvo y daltónico x sin calvicie y visión normal CN XdY CN XXLa mujer será también heterocigota para el gen que determina la calvicie, yaque su madre era calva y tiene que haber heredado de ella un alelo C (CC esel único genotipo posible para una mujer calva)Además, si no es daltónica y ni su padre ni su madre se indica que lo fueran,su genotipo debe ser homocigoto para la visión normal
  • 21. ¿Qué fenotipos pueden tener los hijos de este matrimonio? calvo y daltónico CN XdY GAMETOS  CXd CY NXd NY  sin calvicie y CX CC XdX CC XY CN XdX CN XY visión normal CN XX NX CN XdX CN XY NN XdX NN XY
  • 22. ¿Qué fenotipos pueden tener los hijos de este matrimonio? calvo y daltónico CN XdY GAMETOS  CXd CY NXd NY  sin calvicie y CX CC XdX CC XY CN XdX CN XY visión normal CN XX NX CN XdX CN XY NN XdX NN XY Fenotiposcalvas portadoras calvos con visión normalno calvas portadoras no calvos con visión normal
  • 23. • Un gen es, por tanto, un fragmento de cromosoma que codifica para un determinado carácter.• El cariotipo es el conjunto de todos los cromosomas de una célula ordenados.• En humanos está formado por 23 parejas. Todas las células poseen 46 cromosomas, excepto los gametos que, por una división especial llamada meiosis, tienen 23. Con la fecundación, se recupera el número de la especie.
  • 24. Después de Mendel• 1900. Redescubrimiento de las Leyes de Mendel.• 1910. Experimentos de Morgan. Demuestra que los genes están en los cromosomas, y los que están en el mismo cromosoma se transmiten juntos y los que están en cromosomas independientes se transmiten por separado. Se comprobó la existencia de recombinación o intercambio entre cromosomas homólogos (los dos cromosomas iguales que proceden uno del padre y otro de la madre)• 1944. El ADN es el portador de la información genética (Experimentos de Avery)
  • 25. Después de Mendel• 1953. Watson y Crick describen la estructura en doble hélice del ADN.
  • 26. LA BIOLOGÍA MOLECULAR
  • 27. ADN Nucleótido Cadena de ADN
  • 28. ADN
  • 29. Niveles de empaquetamiento
  • 30. Cromosomas
  • 31. Del gen a la proteína Gen: fragmento de ADN que contiene la información codificada para la síntesis de una proteína Replicación ADN Transcripción ARN m Traducción Proteínas
  • 32. Del gen a la proteína
  • 33. El código genético• Marca la correspondencia entre la secuencia de bases del ADN y los aminoácidos que forman las proteínas.• Cada aminoácido está codificado por un grupo de tres bases consecutivas llamado triplete o codón.
  • 34. El código genético• El código es universal• El código es degenerado• La información se lee de forma continua• El código tiene tres tripletes o codones sin sentido, que no codifican aminoácidos y que se interpretan como señales de terminación
  • 35. Ejercicio 1 La secuencia de bases que se indica a continuación corresponde a un fragmento de una cadena de un gen que tiene información para la síntesis de una proteína. ATGCCGTCGCAAACGTTGCACGTCAAATGG A) ¿De qué tipo de ácido nucleico se trata? B) A partir de esta secuencia, elabora la secuencia correspondiente de ARN mensajero C) ¿Cuántos codones tiene dicho ARNm? D) ¿Cuántos aminoácidos tendrá la proteína sintetizada por traducción de este ARNm?
  • 36. BIOTECNOLOGÍA
  • 37. Biotecnología• Implica la manipulación deliberada de material genético (ADN) de los organismos vivos con el fin de fabricar o modificar un producto, mejorar animales o plantas o desarrollar microorganismos con capacidades determinadas para usos específicos.
  • 38. Herramientas de la BiotecnologíaTecnología del ADN recombinante, permiteaislar partes de ADN, hacer copias de ella ysecuenciarla. Ingeniería genética, permite la transferencia de genes entre organismos, y conseguir OGM o transgénicos Clonación celular, permite la reparación de tejidos y órganos adultos dañados o defectuosos Cultivo de células y tejidos, permiten mantener y crecer in vitro células, órganos y embriones durante mucho tiempo.
  • 39. AGRICULTURA Y MEDICINA GANADERÍA•Técnicas de diagnóstico •Plantas y animales•Reparación de tejidos a transgénicos partir de células madre •Rendimiento de cultivos •Terapia génica •Sanidad animal •Lucha contra plagas INDUSTRIA Desarrollo de OGM para MEDIOAMBIENTEla producción de nuevos • Prevención de la tipos de vacunas, contaminación antibióticos, otros •Control medioambiental fármacos y todo tipo de •Biorremediación sustancias químicas
  • 40. 1. ADN recombinante• Técnicas que permiten manipular el ADN: cortar, aislar, pegar, reproducir y secuenciar fragmentos específicos del ADN de cualquier organismo. Enzimas de restricción: cortan el ADN en fragmentos por lugares específicos.
  • 41. Obtención de un plásmido como vector
  • 42. Clonación del ADNLas colecciones de clones de ADN obtenidas a partir de un ADNde interés se denomina biblioteca o genoteca de ADN
  • 43. Polymerase Chain Reaction (PCR)La PCR es una reacción en cadena que origina millones de copias de un segmentoespecífico de ADN mediante la repetición de múltiples ciclos de replicación del ADN invitro.
  • 44. Huella genética
  • 45. Caso 1: Determinación de la paternidadLa autorradiografía de la derecha muestra los resultados de un análisis de huella dactilar de ADN, con una sonda de locus único, aplicado a un varón, una mujer y sus cuatro hijos/as. ¿Cuál de los hijos/as es el que con menor probabilidad desciende de esta pareja?
  • 46. Caso 2: Perfil del padreLa figura muestra los resultados del análisis de huella dactilar de ADN, con una sonda de locus único, para un varón y sus cuatro hijos/as. ¿Qué calle contiene el ADN del padre?
  • 47. Caso 3: Investigación de una violaciónEsta figura muestra la parte significativa de la autorradiografía de un análisis, con sonda de locus único, de varias muestras de ADN procedentes de la investigación de una violación.Las muestras de ADN se cargaron en las calles del gel de este modo:• Muestra de sangre de la víctima.• Muestra de sangre del acusado.• Marcadores de tamaño de ADN.• Fracción femenina de la muestra vaginal de la víctima.• Fracción masculina de la muestra vaginal de la víctima.Si Ud. fuera el analista de ADN, debería sacar como conclusión:A. El sospechoso es culpable.B. El sospechoso podría ser culpable, pero deben usarse más sondas.C. La muestra vaginal procede de una víctima errónea.D. El sospechoso queda excluido como origen del ADN presente en la prueba del delito.E. NINGUNA de éstas.
  • 48. 2. Ingeniería genéticaSe pueden transferir genes entre especies distintas, es decir, de un organismo a cualquier otro.Organismos modificados genéticamente (OGM) o transgénicos son los organismos (bacterias, hongos, animales y plantas) que contienen un gen procedente de otro organismo o trasgén
  • 49. Microorganismos genéticamente modificados Aplicaciones Productos Producción de industriales, Biorremediación biocombustibles farmacéuticos y médicos Eliminación de Antibióticos mareas negras y de metales pesados Insulina
  • 50. Animales transgénicos• Aumentar la resistencia a enfermedades y mejorar la producción animal.• Diseñar animales knockout• Fabricar órganos de animales para trasplantes• Crear granjas farmacéuticas
  • 51. Plantas transgénicas• Resistencia contra herbicidas o plagas• Resistencia a las heladas, las sequías o al exceso de salinidad y acidez del suelo• Retrasar la maduración• Mejorar el valor nutritivo de las plantas empleadas en agricultura• Producir sustancias de interés farmacológico
  • 52. Terapia génica• Tiene como objetivo tratar, curar y prevenir enfermedadesproducidas por un solo gen defectuoso introduciendo en el paciente un gen funcional• Línea somática y línea germinal
  • 53. Clonación• Proceso mediante el cual se producen organismos genéticamente idénticos entre sí e idénticos al organismo original del que proceden• Clones naturales por reproducción asexual
  • 54. Clonación animal
  • 55. ¿Clonación humana?
  • 56. Células madre (stem cells)Son células indiferenciadas que pueden dividirse indefinidamente produciendo nuevas células madre, o en condiciones adecuadas, pueden diferenciarse en uno o varios tipos celulares especializados, por ejemplo células musculares, células sanguíneas o células hepáticas

×