Your SlideShare is downloading. ×
Jonathan Eisen talk on "Enodsymbiont Genomics" at Lake Arrowhead Small Genomes Meeting 2006
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Introducing the official SlideShare app

Stunning, full-screen experience for iPhone and Android

Text the download link to your phone

Standard text messaging rates apply

Jonathan Eisen talk on "Enodsymbiont Genomics" at Lake Arrowhead Small Genomes Meeting 2006

3,045
views

Published on

Talk by Jonathan Eisen on "Endopsymbiont Genomicsl" at Lake Arrowhead Small Genomes meeting in 2006.

Talk by Jonathan Eisen on "Endopsymbiont Genomicsl" at Lake Arrowhead Small Genomes meeting in 2006.

Published in: Health & Medicine, Technology

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
3,045
On Slideshare
0
From Embeds
0
Number of Embeds
50
Actions
Shares
0
Downloads
2
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide
  • The Wolbachia genome revealed an unexpectedly high amount of repetitive DNA and mobile genetic elements (which were never seen before in a small-genomed intracellular species)
  • Transcript

    • 1. NO TITLEJonathan A. Eisen U. C. Davis
    • 2. Famous Arrowhead Quotes 2006• Publications, student degrees, etc.• Not trying to say anything bad about anyone• The human guts are a real milieu• Where’s you evening gown?• You better kiss everybody• This is how you do metagenomics on 50 dollars, and that’s Canadian dollars
    • 3. Lessons Learned at Arrowhead 2006• Open availability of genome sequences has revolutionized microbiology• Open Source software tools can help allow non informatics specialists to make use of genome data• Open genome databases can make sense of disparate information
    • 4. Lessons Not Yet Learned• What about Open Access to publications?• Open Access can revolutionize the use of the literature just as Genbank revolutionized the use of sequence data
    • 5. Outline• Introduction• Three endosymbiont genomics tales – Wolbachia – Sharpshooter – Calyptogena• Where next?
    • 6. Sources for the Origin of Novelty• New biochemical functions – Evolution of new genes – Old genes with new functions – Mixing and matching existing genes• Changes in uses of existing genes – Targeting – Regulation• Acquisition of new functions – Recombination – Lateral gene transfer – Symbioses
    • 7. Endosymbioses Drove Eukaryotic Evolution QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture.
    • 8. But ….• Key questions unresolved – Was the pre-organelle ancestor free-living? – What the ancestor a mutualist? a parasite? – What happened early in the evolution of the symbiosis?• The problems with organelles – Symbioses were so long ago that it is nearly impossible to figure out what the early events were. – May represent frozen accidents• Solution? – Study more recent and more diverse symbioses
    • 9. Wolbachia pipientis wMel• Wolbachia are obligate, maternally transmitted intracellular symbionts• Wolbachia infect many invertebrate species – Many cause male specific deleterious effects – Model system for studying sex ratio changes in hosts – Some are mutualistic (e.g., in filarial nematodes)• wMel selected as model system because it infects Drosophila melanogaster
    • 10. Wolbachia Metagenomic Sequencing QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. shotgun QuickTime™ and aTIFF (Uncompressed) decompressor are needed to see this picture. sequence QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. Analysis led by Matin Wu in collaboration with lab of Scott O’Neill
    • 11. QuickTime™ and aTIFF (Uncompressed) decompressor are needed to see this picture.
    • 12. Genome Completed Wu et al., PLOS Biology 2004
    • 13. ORF00100 ORF00714 ORF00927 ORF00940 phosphate AMP,ADP,dAMP, dADP,ATP,dATP,ITP, glycerol-3P dITP,IMP,XMP,GMP,GDP,dGDP,dGTP,dGMP ADP ATP fructose-1,6-P2 WD1142 WD0661 (2?) WD1238 WD1305 WD1183 WD0731 WD1023 WD0197 Purine Metabolism WD0786 WD0089 WD0867 WD0195 dihydroxyacetone-P WD0091 glyceraldehyde-3P WD0337 WD0439 WD0786 WD0197 WD0451 PRPP WD1109,WD0763,WD0029,WD0913,WD1018,WD1024 Thiamine metabolismglycerol-3-phosphate/ WD0036hexose-6-phosphate 1,3-bisphosphoglycerate phosphate WD0619 WD1167 ribose-5P sedoheptulose-7P metabolite? WD0470 H + 3-phosphoglycerate glyceraldehyde-3P ATP metabolite? WD0868 WD0712 drugs ribulose-5P xylulose-5P WD1033 H + ADP WD0400 WD0551 2-phosphoglycerate WD0387 drugs metabolite? erythrose-4P WD0249 H+ WD0494 WD0387 H+ WD0248 glyceraldehyde-3P drugs phosphoenolpyruvate fructose-6P H+ Non-oxidative Pentose Phosphate Pathway WD0056 WD0690 drugs WD0695 putrescine pyruvate mannose-1P mannose-6P H+ WD0957 MALATE WD0488 WD1177 WD0384 ornithine WD0416 WD0684 drugs WD1295 WD0473 Amino Acid catabolism WD0895glutamate/aspartate WD0751 WD0325 WD0230 H+ WD0997 WD1239 WD1320 WD0211 Na+ WD0985, WD0650, WD1083, WD1170, WD0085 CYSTEINE alanine WD0228 ? Fatty Acid Biosynthesis acetyl-CoA WD1322 WD0461glutamate/aspartate GLUTAMATE glutamine UMP H+ WD0099 WD0229 Na+ GLUTAMINE WD0535 glutamate UDP ? WD0103 proline/betaine WD1151 citrate PROLINE glutamate H+ WD0621 WD1035 WD0168 H + SERINE glycine oxaloacetate WD0105 WD0617,WD0617 proline/betaine THREONINE glycine WD0414 WD1121 H+ isocitrate alanine/glycine malate TCA WD1046 Na+ CYCLE WD0791 WD0492 alanine/glycine WD0786 WD1047 Na+ adenylosuccinate fumarate oxaloacetate WD1029 aspartate WD0960 WD0954 aspartate semialdehyde WD0437 alanine/glycine WD0727 WD1309 F-type WD1221 WD0544 WD0330 Na+ WD1222 WD0751 ATPase succinate WD1209 suc-CoA WD1210 ADP ATP ADP ATP ADP ATP ATP ADP H+ H+ K + Mg2+ H+ Na+ H+ Na+ H+ Na+ H+ Zn2+/Cd2+ Zn2+ Fe3+ heme WD1233 WD1107 WD0203 WD1249 WD0375 WD0316 WD0407 WD1042 WD0362 WD1136 WD0411 WD1299 WD0204 WD0938 WD0153 WD1093 WD1300 WD0427 WD0937 WD0897 WD0340 WD1391 WD0428 WD0816 WD0429 WD0765 WD0655 WD0656
    • 14. Mitochondrial Origin Unresolved
    • 15. Wolbachia Evolutionary Rate is Accelerated
    • 16. Endosymbiont Trends• Compared to free-living relatives – Smaller genomes – Lower GC content – Higher pIs – Higher rates of sequence evolution• Wolbachia shows ALL of these – However ….
    • 17. Explanations for EndosymbiontDifferences with Free-Living Relatives• Repair hypothesis – Loss of DNA repair genes leads to increased mutation rate – Trends are the direct and indirect result of this increased mutation rate• Population genetics hypothesis – Smaller effective population size leads to more genetic drift – Trends are mostly the result of accumulation of slightly deleterious mutations• PopGen explanations favored – Wolbachia has full suite of repair genes
    • 18. Wolbachia Overrun by Mobile ElementsRepeat Size Copies Protein motifs/families IS Family Possible Terminal Inverted Repeat SequenceClass (Median)1 1512 3 Transposase IS4 5’ ATACGCGTCAAGTTAAG 3’2 360 12 - New 5’ GGCTTTGTTGCATCGCTA 3’3 858 9 Transposase IS492/IS110 5’ GGCTTTGTTGCAT 3’4 1404.5 4 Conserved hypothetical, New 5’ ATACCGCGAWTSAWTCGCGGTAT 3’ phage terminase5 1212 15 Transposase IS3 5’ TGACCTTACCCAGAAAAAGTGGAGAGAAAG 3’6 948 13 Transposase IS5 5’ AGAGGTTGTCCGGAAACAAGTAAA 3’7 2405.5 8 RT/maturase -8 468 45 - -9 817 3 conserved hypothetical, ISBt12 transposase10 238 2 ExoD -11 225 2 RT/maturase -12 1263 4 Transposase ???13 572.5 2 Transposase ??? None detected14 433 2 Ankyrin -15 201 2 - -16 1400 6 RT/maturase -17 721 2 transposase IS63018 1191.5 2 EF-Tu -19 230 2 hypothetical - Wu et al. 2004
    • 19. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. QuickTime™ and a TIFF (LZW) decompressor QuickTime™ and a are needed to see this picture. TIFF (LZW) decompressorare needed to see this picture.
    • 20. Glassy Winged Sharpshooter Symbiont • Vector for Pierce’s disease in grapes • Potential bioterror agent • Feeds on nutrient poor xylem sap • Needs to get amino- acids and other nutrients from symbionts like aphids Wu et al. PLoS Biology 2006
    • 21. Sharpshooter Shotgun Sequencing shotgun sequence
    • 22. 1 600,000 100,000500,000 200,000 400,000 300,000
    • 23. Genome Helps Resolve Phylogeny
    • 24. Higher Evolutionary Rates in Clade
    • 25. Endosymbiont Trends• Compared to free-living relatives – Smaller genomes – Lower GC content – Higher pIs – Higher rates of sequence evolution• Baumannia shows ALL of these
    • 26. Explanations for EndosymbiontDifferences with Free-Living Relatives• Repair hypothesis• Population genetics hypothesis• PopGen explanations favored
    • 27. Variation in Evolution RatesCorrelated with Repair Gene Presence MutS MutL + + + + + + + + _ _ _ _
    • 28. Explanations for Endosymbiont Differences with Each Other• Repair hypothesis• Population genetics hypothesis• Repair explanations favored
    • 29. Polymorphisms in Metapopulation• Data from ~200 hosts – 104 SNPs – 2 indels• PCR surveys show that this is between host variation• Much lower ratio of transitions:transversions than in Blochmannia• Consistent with absence of MMR from Blochmannia
    • 30. Baumannia Predicted Metabolism
    • 31. No Amino-Acid Synthesis
    • 32. ???????
    • 33. Binning by Phylogeny• Identified putative genes• Built phylogenetic trees of genes• Examined and classified trees
    • 34. Binning by Phylogeny• Four main “phylotypes” – Gamma proteobacteria (Baumannia) – Arthropoda (sharpshooter) – Bacteroidetes (Sulcia) – Alpha-proteobacteria (Wolbachia)
    • 35. Binning by Phylogeny• Four main “phylotypes” – Gamma proteobacteria (Baumannia) – Arthropoda (sharpshooter) – Bacteroidetes (Sulcia) - only a.a. genes here – Alpha-proteobacteria (Wolbachia)
    • 36. Finished 130 kb of Sulcia
    • 37. Co-Symbiosis?
    • 38. Metagenomics, Symbionts and Binning • Understanding multisymbiont ecosystems is greatly aided by binning • Multiple methods can be QuickTime™ and a TIFF (LZW) decompressorare needed to see this picture. combined for better signal – Assembly – Composition – Phylogeny – Depth of coverage
    • 39. Binning in More Complex Systems?A TB UC VD WE XF YG Z
    • 40. Venter et al.,2004
    • 41. What is Next I:Autotrophic Endosymbioses
    • 42. Calyptogena magnifica symbionts
    • 43. C. magnifica symbiont sequencing• Collaboration between Cavanaugh Lab at Harvard (Irene Newton led analysis), Eisen lab, and JGI (Woyke and others).• Funded by DOE through CSP program and sequencing and closure done at JGI• Annotation and analysis involved DOE (JGI, ORNL), Harvard, TIGR, Davis, et al.
    • 44. A Streamlined Chemoautotrophic Machine
    • 45. What is Next II+?• Vertical vs. environmental transmission – Two chemosymbioses – P.I. C. M. Cavanaugh, Harvard• Chordate symbionts – Prochloron - tunicate – P.I. Jacques Ravel, TIGR.• Epibionts – AMH epibiont of Alvinella worm – P.I. Craig Cary. U. Delaware• Commensals
    • 46. TIGR $$$ N. Ward C. Fraser J. Heidelberg Frase Other people DOE E. Eisenstadt Moore NSF N. Moran S. Salzberg NIH H. Ochman VI F. Robb I. Paulsen J. Venter M. WuJ. Battista R. Myers D. RuschE. Orias D. Wu A. HalpernD. Bryant M. Frazier S. Chatterji S. O’Neill M. Eisen H. Huse P. Hanawalt E. Rubin C. M. Cavanaugh T. Woyke A. Hartman J. Morgan JGI Eisen Mom and Dad Group
    • 47. Correlation of Endosymbiont Features • Correlation makes it difficult to tease apart cause and effect • Need examples where properties are decoupled • May be the case in Baumannia with genome size
    • 48. Ruthia magnifica
    • 49. Sulcia Role Categories
    • 50. Long Term Effects of Repair Loss• Endosymbionts are model systems for understanding the consequences of loss of repair activities• RecA lost in Buchnera and Blochmannia but kept in Baumannia and Wigglesworthia• MutSL loss mentioned previously• RecBCD present even in species without RecA• Mfd present in many species without UvrABCD
    • 51. Famous Arrowhead 2004 Quotes• Space-time continuum of genes and genomes• Gene sequences are the wormhole that allows one to tunnel into the past• The human mind can conceive of things with no basis in physical reality• Thoughts can go faster than the speed of light