Simulation Theory


Published on

1 Comment
  • This is intriguing..I didn't get audio but the text was magnetic. Thanks
    Are you sure you want to  Yes  No
    Your message goes here
  • Be the first to like this

No Downloads
Total Views
On Slideshare
From Embeds
Number of Embeds
Embeds 0
No embeds

No notes for slide

Simulation Theory

  1. 1. REALITY HAS BECOME SCIENCE FICTION A collection of images and information by Jonathan Lippe For Millenaissance learning.
  2. 2. Reality Has Become Science Fiction <ul><li>The purpose of this presentation is to explain that the reality most people agree upon to live in isn’t the entire picture of what is going on. </li></ul><ul><li>Right in front of our eyes exists a more grand, splendid, incredible world that most of us choose not to observe. </li></ul>
  4. 4. Who Created Man? God ? The Annunaki ? Aliens ? The Wingmakers ?
  5. 5. Which is our true home planet ? TIAMET MARS Nibiru / Planet X EARTH
  6. 6. My Answer: The Matrix This is a neurological simulation. We’re all gamers – souls inside of bodies. Body = Computer hardware. Soul = Operating system / software. Our experience – that as of a “user” or “simmer” The Architect in Matrix Reloaded
  7. 7. “ Rules (Laws) to the Videogame” Gravity Thermodynamics Conservervation of Mass Conservation of Energy Chaos and Order
  8. 8. Same Operating System, Just updated graphical user interface, gameplay, features and efficiency. Different versions of man, and Microsoft Windows Operating Systems Homo Sapien = Latest Upgrade
  9. 9. Same Game Updated Graphics Zelda: 1989 Zelda: 2001 The videogames look better than ever, and have more buttons and movement, but its still the same storyline, same objective.
  10. 10. PART II Understanding Human Life and Reality By interacting with and creating robots and computers / artificial intelligence.
  11. 11. Muscle, Skeletal, Nervous Layers of human beneath the surface.
  12. 12. Human Skeleton Computer Android / Robot / 1 st building stage 1 st stage of human design
  13. 13. Muscle layer Human Robot
  14. 14. Communications Channels Human - Nerves, Veins Robot - Wires, Circuits
  15. 15. The next upgrade: Man and machine blended together.
  16. 16. Design Stages of building a creature.
  17. 17. Robot hands, human hands
  18. 18. Man and Machine = No Rise of the Machines but a Hybridization Best of both worlds. Incorporating Matrix like abilities into the human.
  19. 19. We are advanced robots.
  20. 20. God made man, Man made robot
  21. 21. Human Genetic Code: DNA 4 states - ATCG atcgtgcgagtcgtcgatgatgtcgctagtgtgtagc adenine, thiamine. cytosine, guananine <ul><li>Computer Machine Code: Binary – 0, 1 </li></ul><ul><li>2 states – off and on </li></ul><ul><li>010101010101011010101010101010101001 </li></ul>
  22. 22. Pyramids and Structures on Mars
  23. 23. Nibiru / 12 th Planet / Planet X
  24. 24. Nibiru
  25. 27. Tiamet / Asteroid Field
  26. 28. Our own human-made aircraft is far more bizarre than alien spacecraft.
  27. 29. What is the Matrix?
  28. 30. Both movies came out shortly after it was briefly announced on television that Asteroid XF-11 was on a collision course with Earth by the year 2028.
  29. 31. Kevin Warwick is a human cyborg who invents technology to enhance the human body in order to survive when the robots take over. Recently he connected his body to the Internet by having electrodes surgically implanted into his nervous system in New York and had someone across the Atlantic Ocean in England control his body remotely. Pictures of this and other experiments he conducted on himself are available on
  30. 32. The Core and 007 Die Another Day show what would happen if direct radiation from the sun could get through the protective layers of the atmosphere and touch the Earth’s surface. In both movies, there were secret bases located in Alaska and some other snowy cold region. In real life there is a government research facility called HAARP located in Alaska which conducts experiments loosely related to some of the things depicted in the movie.
  31. 33. So, is there any truth to the Bible Code or Numerology? The occult? Secret Societies? Astrology?
  32. 34. These 3 movies suggest there is life on Mars. The picture to the left is a NASA photograph of a Mars region called CYDONNIA. This photograph shows several pyramids (about 4) and a face structure. In the movie Mission to Mars, the astronauts land in the Cydonnia area.
  33. 35. Genetic Mutation Man made viruses. Genetic weapons. Viral weapons. Zombies used by the military created in laboratories by multinational corporations. Genetic enhancements. Secret genetic experiments.
  34. 36. Thirteenth Floor and Matrix suggest that we live in a computer generated reality and are experiencing a simulation of what we think is real life.
  35. 37. Movies that suggest what we think is reality is not. Vanilla Sky falls in the same category with Matrix and 13 th Floor with a manufactured reality.
  36. 38. TSUNAMI’s GLOBAL WARMING Code Hunter depicts Hurricanes as an un-intended by-product of space to surface weaponry. Again, research HAARP
  37. 39. SETI – Search for Extraterrestrial Intelligence - Real life organization. Organization depicted in Contact and The Arrival..
  38. 40. = Al Pacino’s character is very loosely based on real life RAY KURZWEIL . Ray Kurzweil is one of the leaders in virtual reality and Artificial Intelligence, and in real life created an artificial intelligent avatar known as RAMONA (movie was called SIMONE). You can learn more at his interesting website www and you can view Ramona as well as video presentations of his merging of virtual reality.
  39. 41. Biometrics – Blood sample scanner Genetic Engineering, genetic family planning Eugenics Dystopia Department of Pre-Crime = Department of Homeland Security Biometrics / Retina scans, thumb scans Pre-cogs (precognition) Remote Viewing Fascism Big Brother Total Information Awareness
  40. 42. Genetic algorithms. Artificial Life. Artificial Intelligence Virtual Reality. Neural Networks Computer animation Ray Kurzweil – In TRON and Virtuosity, people’s body’s were scanned by a laser and then recreated into the computer.
  41. 43. The movie SIGNS was based on the PHOENIX LIGHTS incident in Arizona in 1997 In the movie Joaquin Phoenix watches real video from the Phoenix Lights coverage on television In Independence Day, the president (Bill Pullman) visits Area 51.
  42. 44. You can make dinosaurs. You can clone humans. We can remove the aging strand in our DNA and live forever.
  43. 45. Pre-911 movie about manufacturing terrorist attacks to “Save Americans freedoms”
  44. 46. Monoliths are in these movies which were put in certain areas to detect stages of human intelligence evolution. We have now landed on the moon created the computer and harnessed the power of the atom.
  45. 47. Mind Control – MK ULTRA Implanted Microchips – Applied Digital Solutions “Verichip” Gulf War Syndrome
  46. 48. George Meeks invented the Spiricom which enabled him to get messages from dead people. He also took many pictures in a room with a lightbulb that does not shine the visible light frequencies and was able to capture photos of spirits. VISIT to learn about the research of George W Meek and how it relates to EVP
  47. 49. Secret Societies – Freemasons, Skull and Bones Symbols on the dollar bill.
  48. 50. The government working either with the aliens or against the aliens. Aliens disguised as humans.
  49. 51. Time Travel
  50. 52. Children’s movies from the 80s.
  51. 53. Visionary movies from the ’30s
  52. 55. JDS Uniphase – Lasers, X-ray, laser surgery, machines in airports Altair Technologies New England Metal Form / Microwave Specialties Ericsson computers ties w/ Lockheed Martin Jennings Technology Eaton Technology Manhattan Associates RFMD OATSystems ConnecTerra Globe Ranger TIBCO Software AIM Global Cipher Trust Vonage IBM Microsoft Sun Microsystems HP Oracle / Peoplesoft Cisco Worldcom
  53. 56. 407-882-0260 ucf networking mcse If you want to know about the social, its 53-6-27 Great gumballs. Superglue the mfer My name is a bad word Jared Skalko was here
  54. 57. Reality does not exist in its solid form as we see it. Everything we see is a hologram. Reality is really just a bunch of waves, frequencies. Our eyes gather the frequencies and our brain converts it into images that we see in the same way a radio decodes sound waves into audible sound that we hear through a speaker and understand or a television decodes frequencies into understandable visual images that we see displayed through various heated red,green,blue phosphorus or liquid crystal dots that appear to make an image. You can’t see a TV signal or a radio signal without a television or a radio to tune the invisible frequencies to our eyes, yet they are there. Reality really looks like a bunch of wavey lines. We experience things as physical and as painful or pleasureeable only because our nevers take in sensation information and our brain decodes it and reacts. All emotions are electro-chemical reactions. (Electronic signal from the brain releasing different elements or compounds into the body through its various cchannels.) The brain and human body is electronic. Just like a computer. Except that the source code for man is DNA and a computer is binary.
  55. 58. Buildup of Garbage Global Warming Extinction of Species Loss of Habitat Rainforest Doing nothing about it. Mind intention – creates results. Non-locality – space time makes no difference. Quantum – energy – matter patterns information War cost – 200 billion dollars. Imagine using that on alternative energy development. Energy – petrochemical. Global future studies. Bio,nano,info,tech Molecular barcode – sprinkled in like dust Synthetic sentience Privacy is something we pride ourselves as a right.
  56. 60. Aliens and Origins of Man <ul><li>Origins of man </li></ul><ul><li>Government </li></ul><ul><li>Sightings/Abductees </li></ul><ul><li>Disclosure </li></ul><ul><li>Even if fake what’s up </li></ul><ul><li>U.S. Technology </li></ul><ul><li>Alien Races </li></ul><ul><li>Annunaki </li></ul><ul><li>Dinosaurs </li></ul><ul><li>Regular Taught Version </li></ul><ul><li>Religious Version </li></ul><ul><li>Pyramid Building Civilizations </li></ul><ul><li>Atlantis, Lemuria </li></ul><ul><li>Genesis Elohim Nephilim </li></ul><ul><li>Slave Planet </li></ul><ul><li>Why exist, what’s your version of reality? </li></ul><ul><li>Aristotle writing about the greats. </li></ul><ul><li>Many documents books destroyed at Alexandria. </li></ul>
  57. 61. DNA Reality, Soul Body Duality <ul><li>Watson Crick discovered DNA </li></ul><ul><li>ATCG 0101 </li></ul><ul><li>Source code of man </li></ul><ul><li>Ethics in genetic enhancements is a joke because we eat food and take vitamins. </li></ul><ul><li>Reprogram your body. </li></ul><ul><li>Body soul separate entities </li></ul><ul><li>What is a memory? Simulation of the matrix </li></ul><ul><li>Body is a spacesuit </li></ul>
  58. 62. What is reality? <ul><li>Neurological simulation </li></ul><ul><li>Video game </li></ul><ul><li>Our framework of reality </li></ul><ul><li>survivalists </li></ul><ul><li>hunters and gatherers </li></ul><ul><li>capitalism, still hunting </li></ul><ul><li>everything Is a rat race to stay alive and everyone dies. </li></ul><ul><li>Religious view </li></ul><ul><li>Computer matrix </li></ul><ul><li>Aliens created man </li></ul><ul><li>The boring pointless view – eat, crap, sleep, reproduce, die, that’s it. </li></ul><ul><li>Make as much money as you can, die with most toys </li></ul><ul><li>Darwin – leave as much offspring </li></ul><ul><li>The new age spiritual – in one frequency vibration of many dimensions </li></ul><ul><li>The man lives/groundhog day – going through life to learn lessons until you get it right </li></ul><ul><li>Salvation – living to die to gain entry into heaven </li></ul>
  59. 63. Getting to the bottom of reality <ul><li>Who controls everything? </li></ul><ul><li>Illuminati? </li></ul><ul><li>Aliens? </li></ul><ul><li>Bankers? </li></ul><ul><li>God? </li></ul><ul><li>Satan? </li></ul>
  60. 64. I. Source Code Of Man: DNA a. DNA vs Binary b. DNA Modification (via RNA or Virus) c. The Holy Grail: Eternal Life – Remove DNA that causes aging or reverse aging process and recessive genes. d. DNA Printers e. Genetic Engineering f. Cloning, Stem Cell Research, creating organs for replacement. g. Creating X-Men Mutant abilities. IX Science and Mathematics a. Quantum Theory / Mechanics b. PI (1.6 trillion digits, implications, einstein’s theory) c. Energy d. The Frequency of Visible Light and the entire range of the electromagnetic spectrum of radiation. VIII. SCI-FI Technology TODAY a. OLEDs Organic Light Emitting Diodes (cloak suit harry potter coat, Aurora, Die Another Day) b. Wireless Technology c. ISS International Space Station d. Boba Fett Suit for soldiers e. b-2 stealth bomber f. Mars pathfinder in ’96 landing within 2 miles of destination G. secret projects are 50 years ahead of what we can imagine. h. Alternate energy.
  61. 65. XI. Humans that May Not Have Been Human a. Nikola Tesla b. John Von Neumann c. Albert Einstein d. Jesus Christ XIV. Imaginary Things That Are Real a. Stock Market - Economy b. Money – Paper – Trust c. Religions d. Borders e. Time, keeping time f. Numbers, letters, symbols g. Reality h. Laws i. Language j. Operating systems, software.
  62. 66. VII. RISE OF THE MACHINES a. Insect Robots that Learn b. Business Computer AI that buy and sell. c. Artificial Intelligence d. Artificial Life e. Super Computers f. Q-Bit (anti-matter for binary) g. Neural Networks f. Genetic Algorithms
  63. 67. II. UFO RESEARCH a. Firefighter Handguide b. Roswell (If no aliens landed, what’s up with the coverup. If aliens DID land … well….) c. The Law That You Receive 1 Year in jail, $150,000 fine for interacting with Aliens. d. UFO COMMENTS BY ASTRONAUTS 1. Edgar Mitchell “ aliens exist” “Universe is conscious” Noetic Research 2. John Glenn on Frazier e. Columbia and Challenger Disasters and Apollo 13 and failed Russian and U.S. Mars Missions f. The face and Cydonnia, Mars g. EZEKIEL (aliens in the bible and history / hiero / cave drawings) h. Phoenix Lights, Battle of LA Crop Circles, Colin Andrews j. Dark side of the moon, can’t face hubble to dark side. Cometa Report Blue Book Special
  64. 68. UFOLOGISTS (may separate into groups) Stanton Friedman Colin Andrews Peter Davenport Whitley Strieber Budd Hopkins Zecharia Sitchin Jason Martell Carl Sagan (SETI) Dan Ackroyd William Cooper Bob Lazar Tom Mahood George Knapp David Icke Al Bielek Preston Nichols Stewart Swerdlow Nancy Lieder Ellie from Crystal Links Rael Art Bell Goerge Noory Jeff Rense Lou Gentile
  65. 69. IV. ORIGIN OF MAN Annunaki from Nibiru Sumerians, Zecharia Sitchin, Jason Martell Wingmakers Bible Version Aliens from other planets. / Various alien races. Mayans, Egyptians, Wormholes – Pyramid Alightment with space. Bible Code Dinosaurs Lost Civilizations Historical Records Destroyed after conquer VI. EXISTENTIALISM BODY SOUL DUALITY DREAMS ETERNAL BEINGS Virtual Reality Life Experience Afterlife Dimension / Near Death Experiences
  66. 70. V. SECRET PROJECTS /COVERUP a. Philadelphia Experiment b. Montauk Project c. Area 51 d. TR3B e. Vatican City f. genetic engineering X. Real Government Organizations / Projects a. HAARP b. DARPA c. NSA XI. BIG BROTHER Echelon Applied Digital Solutions Total Information Awareness TIA Secret Societies GPS Surveillance, Biometrics, Retinal Scan, Fingerprints, Human Soul Frequency Department of Homeland Security Patriot Act
  67. 71. Physical Reality vs Logical Reality TV – 1 MHZ Radio – 20 KHZ Phone – 2 KHZ-15 KHZ Brain 45 MHZ Stephen O. Gibbs Jack Peterson – Small Device, Invisibility John Hutchinson – Fused metal and Wood Colonel Corso – Day After Roswell Nitevision Transistor Fiber Optic Distopian Movies of Technology enslavement.(THX 1138, Brave New World, Gattaca)
  68. 72. XIII. THE FALL OF MANKIND Apocalpse Clock Nuclear Weapons Money – Almighty Dollar Overpopulation Disease Epidemic Exhaust fish supply, strain soil nutrients for commercial gain in the rat race. The necessity for machines to aid our lives and the eventual takeover of the machines – humans are inefficient to the equation. Since the beginning of time man has been throwing rocks at each other. Greed, Jealousy Alien takeover. Air or water poisoning Asteroid impact Pole shift
  69. 73. LIMITATIONS OF MAN a. Vision frequency. b. Hearing Range c. Brain calculation limits d. Humans currently die via aging. e. G-FORCE POTENTIALS OF MAN Higher vibrational frequency CHAKRAS Beyond 5 Sense Reality ESP, Remote Viewing, Collective Consciousness, Dimensional Transcending Astral Projection Eternal Life Fully automated society, removal of currency, survival needs provided without 40 hour work week and traffic congestion allows personal development, voyaging and discovery to be achieved.
  70. 77. Class Is In Session : Compound interest. 6.2 billion people. Gotta be skillful, not insignificant. Under my ideal world we can all exist, but since all you fuckfaces want to keep this fucked up paradigm YOUR ASS BETTER BE USEFUL. How many people in 30 years. 3% growth rate. Not gonna happen? Why not? Well, then we have shit city on our hands. Cigars n guitars I’m not a doomsday person, I don’t want this to happen. I have a great life. But when I plan for retirement, those are the things I think about. I want there to be a future. Brief history of major religions Does facing N-S-E-W affect sleep pattern? Changing Barnes n Noble’s section titles.
  71. 78. Global Warming / Greenhouse Gasses <ul><li>Critical Mass = 400 PPM CO2 </li></ul><ul><li>Current = 379 ppm CO2 </li></ul><ul><li>Growth rate = 2 ppm per year </li></ul><ul><li>Estimated time left: 10.5 years </li></ul>
  72. 79. Traffic <ul><li>$ in traffic violation tickets </li></ul><ul><li>$ for new roads and maintenance </li></ul><ul><li>$ for funerals for road related deaths </li></ul><ul><li>$ Americans paid for auto insurance </li></ul><ul><li>$ Physical therapy for those injured </li></ul><ul><li>$ In tolls paid </li></ul><ul><li>$ Car repairs from accidents </li></ul><ul><li>$ Paid to lawyers / court fees </li></ul><ul><li>$ Gas </li></ul><ul><li>$ in man hours </li></ul><ul><ul><li>Police </li></ul></ul><ul><ul><li>Insurance agent </li></ul></ul>
  73. 80. How To Protect Borders <ul><li>Infrared or laser </li></ul><ul><li>Remote aircraft w/ camera </li></ul><ul><li>Sound detectors </li></ul><ul><li>Hidden rock camera sound mic </li></ul><ul><li>Talk, thermal satellites </li></ul><ul><li>The technology exists </li></ul>
  74. 81. 2003 Traffic stats <ul><li>42,643 auto deaths 0-34 yrs old </li></ul><ul><li>2.89 million injured </li></ul><ul><li>$230 billion in damages </li></ul><ul><li>$820 per person </li></ul>
  75. 82. <ul><li>64 bit IP Addressing </li></ul><ul><li>IPTV, VOIP used to be free, video conferencing </li></ul><ul><li>Transportation </li></ul><ul><li>How to stop illegal immigration </li></ul><ul><li>Economics of prison system </li></ul>
  76. 83. Message In The Movies <ul><li>I don’t watch movies to be entertained, I go to be educated and informed. </li></ul><ul><li>When you watch TV, a movie, play videogames or do anything, you are investing time. Time of your life that you will never get back. </li></ul><ul><li>Since this is such a precious investment, you should expect a return. </li></ul>
  77. 84. Message in Movies Cont. <ul><li>Every moment of your life spent is a moment closer to your death. </li></ul><ul><li>You don’t want to waste any moments because once they’re gone, that’s it. They don’t rollover like Cingular Wireless minutes. </li></ul><ul><li>All around you is interesting information that can provide answers to your questions about life should you make yourself aware. </li></ul>
  78. 85. Message cont. <ul><li>TV Shows and movies are shot and filmed to a storyboard that has been thought out. It’s not like you using your camcorder hitting record and taping everything in sight. It is all very specific with angles that subconsciously convey meaning and pans that suggest passages of time and colors that will create a mood. </li></ul>
  79. 86. Message cont. <ul><li>Most of the stuff you see is specific and ordered, not random or by accident. Millions of dollars are going into these productions. Everything has a meaning. Everything is there for a purpose. </li></ul><ul><li>My journey to becoming aware of all of this was from simultaneous sources of information all coming to me at the same general time. </li></ul><ul><li>I was in Mass Media / TV Production, celestine prophecy, ryan introduced me to Tarantino and Kevin Smith. Dialogue. Transformation. </li></ul>
  80. 87. DNA <ul><li>Human Cell – Library </li></ul><ul><li>Chromosomes – Book </li></ul><ul><li>DNA – Chapters </li></ul><ul><li>Genes – Paragraphs sentences </li></ul><ul><li>30 trillion cells </li></ul><ul><li>“ We don’t have to believe anything, the evidence is there.” </li></ul><ul><li>Gematria </li></ul>
  81. 88. Mass Media – Television “Programming” <ul><li>Media for the masses. Mass media, not millenaissance media. </li></ul><ul><li>If you’re looking for answers on TV you probably won’t find it there. </li></ul><ul><li>Agenda: Gatekeepers </li></ul><ul><li>STATUS CONFERRAL </li></ul><ul><li>SELECTIVE EXPOSURE </li></ul><ul><li>Reuters, AP Press – rip n read </li></ul><ul><li>70 % of stuff presented as news is actually a paid press release campaign. </li></ul><ul><li>Publicist generate controversy. Media plays along if affiliated. </li></ul><ul><li>The Big 3, Big 4 – everything they own </li></ul><ul><li>Clear Channel </li></ul><ul><li>What you don’t see. Burt Rutan, Alex Jones, 3 rd Party views. </li></ul><ul><li>What you do see. Nonsense. Paris Hilton. Britney Spears MJ </li></ul><ul><li>Who’s Number 1 on the charts, in ratings, box office. Who fuckin cares how does it benefit you ? </li></ul>
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.