Nani

409
-1

Published on

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
409
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
8
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Nani

  1. 1. GENE CLONING by Harsha Manoj Vineeth kumar GUIDE: Dr.Anuradha Internal guide: miss HEMA
  2. 2. OBJECTIVE <ul><ul><li>To clone the Drug Resistant Gene of Bacillus subtilis by making use of TA Cloning Technology </li></ul></ul>Bacillus subtilis
  3. 3. STEPS INVOLVED <ul><li>Amplification of Gene of interest </li></ul><ul><li>Construction of T-tailed vector (pBS-SK) </li></ul><ul><li>Ligation </li></ul><ul><li>Transformation </li></ul><ul><li>Screening </li></ul>
  4. 4. WORK THAT HAS BEEN DONE <ul><li>Isolation of Genomic DNA (insert) </li></ul><ul><li>Amplification of the Desired Gene </li></ul><ul><li>Isolation of Plasmid DNA (vector) </li></ul><ul><li>Restriction Digestion </li></ul><ul><li>Ligation </li></ul>
  5. 5. Isolation of Genomic DNA (insert) <ul><li>Bacillus subtilis culture was used for the isolation of genomic DNA. </li></ul><ul><li>Culture was taken and centrifuged at 6000rpm for 10min </li></ul><ul><li>Supernatant was discarded and 1ml of lysis buffer to the pellet and was resuspended </li></ul><ul><li>Incubated at 45 C for 10min in a water bath </li></ul><ul><li>Phenol and Chloroform was added in the ratio of 1:1 </li></ul><ul><li>This was centrifuged at 10000 rpm for 10min </li></ul><ul><li>Supernatant was taken and equal volume of Chloroform and Isoamyl alcohol </li></ul>
  6. 6. <ul><li>1/20 th volume of 3M Sodium Acetate was added to the supernatant </li></ul><ul><li>This was centrifuged at 10000rpm for 10min </li></ul><ul><li>Supernatant was taken and double the volume of chilled ethanol was added </li></ul><ul><li>This was incubated at -20 C for 25min </li></ul><ul><li>This was centrifuged at 10000 rpm for 10min </li></ul><ul><li>The supernatant was discarded and pellet was dissolved in 25-50microlitres </li></ul>
  7. 7. AMPLIFICATION(PCR) <ul><li>DNA purified from Bacillus subtilis as the template. </li></ul><ul><li>Fwd primer:5’TAATACGACTCACTATAGGG 3’ </li></ul><ul><li>RVS primer:5’TATGCTAGTTATTGCTCAGCG 3’ </li></ul><ul><li>Nuclease free water 29 micro lit </li></ul><ul><li>10x assay buffer 5 micro lit </li></ul><ul><li>10mM dNTP mix 4 micro lit </li></ul><ul><li>Template DNA(100mg/mic l) 3 micro lit </li></ul><ul><li>Forward primer(0.1-1micM) 3 micro lit </li></ul><ul><li>Reverse primer(0.1-1micM) 3 micro lit </li></ul>
  8. 8. PLASMID
  9. 9. ISOLATION OF PLASMID DNA (VECTOR) <ul><li>Plasmid used was pBlueScript II SK+ vector </li></ul><ul><li>1.5ml of overnight E.Coli culture was taken </li></ul><ul><li>This was centrifuged at 12000rpm for 5min </li></ul><ul><li>The supernatant was discarded and the pellet was resuspended in 100microlitres of solution I </li></ul><ul><li>This was incubated on ice for 5min </li></ul><ul><li>200microlitres of solution II was added and incubated at room temperature for 5min </li></ul><ul><li>150microlitres of solution III and incubated on ice for 5min </li></ul><ul><li>This was centrifuged at 10000rpm for 10min </li></ul>
  10. 10. <ul><li>Supernatant was collected and double the volume of chilled ethanol and was incubated at -20 C for 15min </li></ul><ul><li>This was centrifuged at 12000rpm for 10min </li></ul><ul><li>Pellet was collected and 50microlitre of TE buffer was added </li></ul>
  11. 11. <ul><li>Taq DNA polymerase(3u/mic l) 3 micro lit </li></ul><ul><li>Total reaction volume 50 micro lit </li></ul><ul><li>carry out the amplification in a thermal cycler for 35 cycles using the following reaction conditions. </li></ul><ul><li>Initial denaturation 94 C 3 min </li></ul><ul><li>Final denaruration 94 C 30 sec </li></ul><ul><li>Annealing 55 C 30 sec </li></ul><ul><li>Early extension 68 C 1 min </li></ul><ul><li>Late entension 68 C 10 min </li></ul><ul><li>the pcr program was run for 35 cycles. </li></ul>
  12. 12. LIGATON <ul><li>1x ligase assay buffer :2 mic lit </li></ul><ul><li>T4DNA ligase :1 mic lit </li></ul><ul><li>PCR product : 3 mic lit </li></ul><ul><li>Ttailed-vector : 1 mic lit </li></ul><ul><li>Procedure: </li></ul><ul><li>Mix the above components in adequate ratio and incubate at 16 C overnight. </li></ul><ul><li>Inactivate the ligase at 65 C for 10 </li></ul><ul><li>minutes. </li></ul><ul><li>Further use this ligation mix for transformation. </li></ul>
  13. 13. APPLICATIONS <ul><li>Gene cloning has many applications in medical research </li></ul><ul><li>and pharmaceuticals industries including the development of diagnostic methods for detecting and disease causing agents,the production of vaccines for preventing illness,and the devolopment of antibiotics for fighting infections. </li></ul>
  14. 14. Nice to see u all
  15. 15. Thank you
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×