Your SlideShare is downloading. ×
  • Like
Lecture 7 (biol3600)   genetic code and translation
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Now you can save presentations on your phone or tablet

Available for both IPhone and Android

Text the download link to your phone

Standard text messaging rates apply

Lecture 7 (biol3600) genetic code and translation

  • 1,844 views
Published

 

Published in Technology
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
No Downloads

Views

Total Views
1,844
On SlideShare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
115
Comments
0
Likes
2

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide
  • The Hutterites are a religious branch of Anabaptists who live on communal farms in the prairie states and provinces of North America. A small number of founders, coupled with a tendency to intermarry, has resulted in a high frequency of the mutation for Bowen-Conradi syndrome among Hutterites. Bowen-Conradi syndrome results from defective ribosome biosynthesis, affecting the process of translation. [Kevin Fleming/Corbis]
  • Figure 15.5 The common amino acids have similar structures. Each amino acid consists of a central carbon atom (Cα) attached to: (1) an amino group (NH3+); (2) a carboxyl group (COO–); (3) a hydrogen atom (H); and (4) a radical group, designated R.
  • Figure 15.6 Amino acids are joined together by peptide bonds. In a peptide bond (red), the carboxyl group of one amino acid is covalently attached to the amino group of another amino acid.
  • Figure 15.8 (part 1) Nirenberg and Matthaei developed a method for identifying the amino acid specified by a homopolymer.
  • Figure 15.11 Wobble may exist in the pairing of a codon and anticodon. The mRNA and tRNA pair in an antiparallel fashion. Pairing at the first and second codon positions is in accord with the Watson and Crick pairing rules (A with U, G with C); however, pairing rules are relaxed at the third position of the codon, and G on the anticodon can pair with either U or C on the codon in this example
  • Figure 15.13 An amino acid attaches to the 3′ end of a tRNA. The carboxyl group (COO–) of the amino acid attaches to the hydroxyl group of the 2′- or 3′-carbon atom of the final nucleotide at the 3′ end of the tRNA, in which the base is always adenine.
  • Figure 15.14 Certain positions on tRNA molecules are recognized by the appropriate aminoacyl-tRNA synthetase
  • Figure 15.15 An amino acid becomes attached to the appropriate tRNA in a two-step reaction.
  • Figure 15.16 (part 1) The initiation of translation requires several initiation factors and GTP.
  • Figure 15.16 (part 2) The initiation of translation requires several initiation factors and GTP.
  • Figure 15.16 (part 3) The initiation of translation requires several initiation factors and GTP.
  • Figure 15.16 (part 4) The initiation of translation requires several initiation factors and GTP.
  • Figure 15.16 The initiation of translation requires several initiation factors and GTP.
  • Figure 15.17 The Shine–Dalgarno consensus sequence in mRNA is required for the attachment of the small subunit of the ribosome.
  • Figure 15.18 The poly(A) tail of eukaryotic mRNA plays a role in the initiation of translation.
  • Figure 15.19 The elongation of translation comprises three steps.
  • Figure 15.19 The elongation of translation comprises three steps.
  • Figure 15.19 The elongation of translation comprises three steps.
  • Figure 15.19 The elongation of translation comprises three steps.
  • Figure 15.19 The elongation of translation comprises three steps.
  • Figure 15.19 The elongation of translation comprises three steps.
  • Figure 15.20 Translation ends when a stop codon is encountered. Because UAG is the termination codon in this illustration, the release factor is RF.
  • Figure 15.20 Translation ends when a stop codon is encountered. Because UAG is the termination codon in this illustration, the release factor is RF.
  • Figure 15.20 Translation ends when a stop codon is encountered. Because UAG is the termination codon in this illustration, the release factor is RF.
  • Figure 15.23 An mRN15.23 An mRNA molecule may be transcribed simultaneously by several ribosomes. (a) Four ribosomes are translating an mRNA molecule; the ribosomes move from the 5′ end to the 3′ end of the mRNA. (b) In this electron micrograph of a polyribosome, the dark- staining spheres are ribosomes, and the long, thin filament connecting the ribosomes is mRNA. The 5′ end of the mRNA is toward the left- hand side of the micrograph. [Part b: O. L. Miller, Jr., and Barbara A. Hamaklo.] CONCEPTS In both prokaryotic and eukaryotic cells, multiple ribosomes may be attached to a single mRNA, generating a structure called a polyribosome. ✔ CONCEPT CHECK 9 A molecule may be transcribed simultaneously by several ribosomes. (a) Four ribosomes are translating an mRNA molecule; the ribosomes move from the 5′ end to the 3′ end of the mRNA. (b) In this electron micrograph of a polyribosome, the dark- staining spheres are ribosomes, and the long, thin filament connecting the ribosomes is mRNA. The 5′ end of the mRNA is toward the left- hand side of the micrograph. [Part b: O. L. Miller, Jr., and Barbara A. Hamaklo.
  • Figure 16.16a Two different secondary structures can be formed by the 5 ′ UTR of the mRNA transcript of the trp operon.
  • Figure 16.16b Two different secondary structures can be formed by the 5 ′ UTR of the mRNA transcript of the trp operon.
  • Figure 16.17 Whether the premature termination of transcription (attenuation) takes place in the trp operon depends on the cellular level of tryptophan.

Transcript

  • 1. Transcription - Recapitulation• All genes (eukaryotic and prokaryotic) have a unique region (promoters) of DNA sequenceupstream of (before) the transcriptional start site that serves as a binding site for the RNApolymerase enzyme• General functions of promoters: 1. Provides specificity – Each gene has a unique promoter sequence 2. Tell RNA polymerase where to start (they are usually at the beginning) - No promoter (or mutated promoter), no transcription 3. Indicate which strand will be transcribed and the direction of transcription•Most promoters share a few common sequences called consensus sequencesProkaryotic promoters share 2 main types of consensus sequences - TATA box (aka Pribnow box) (-10-15), sequence is usually TATAAT - TTGACA – found 35 nucleotides upstream•Prok. RNA polymerase enzyme makes direct contact with the promoter at these consensussequences• Unique seq. within and around promoters help determine rates of transcriptionProkaryotic cells only produce 1 type of RNA polymerase to produce all of the mRNA, tRNA,and rRNA in the cell.• Prokaryotic RNA polymerase structure: - 2 alpha (α), 1 beta (β), 1 beta prime (β), 1 sigma (σ) subunit, and one omega (ω) subunit. - Together they have the basic catalytic function of producing new RNA - σ factor controls binding to the promoter (PROMOTER RECOGNITION) - After initial binding has been successful, the σ factor comes off the core - Bacteria make many different types of sigma factors - Different sigma factors recognize different promoter sequences.
  • 2. Transcription - Recapitulation• Prokaryotic RNA polymerase structure: - β, β’, α and ω subunits interact and form the CORE ENZYME - Together they have the basic catalytic function of producing new RNA - σ factor controls binding to the promoter (PROMOTER RECOGNITION) - After initial binding has been successful, the σ factor comes off the core - Bacteria make many different types of sigma factors - Different sigma factors recognize different promoter sequences• Once it binds to the specific promoter, RNA polymerase positions itself over the transcriptional start site based on its distance from the consensus sequences - No specific “start signal” exists for beginning of transcription.• RNA pol unwinds the DNA near the start site (transcription bubble created).• RNA pol continues producing a complimentary RNA molecule until it transcribes a terminator signal.Two major prokaryotic transcriptional terminator signals exist. - Both must: (a) Slow down the RNA polymerase; (b) Weaken the interaction between the DNAand RNA in the bubble.Properties of the two major prokaryotic terminator signals 1. Rho-independent terminators - The DNA sequence contains an inverted repeat followed by astring of 6 adenines. Following their transcription, the inverted repeats form Hydrogen bonds witheach other within the RNA and form a hairpin loop - Loop formation causes the RNA pol to pause - The pause combined with weak hydrogen bonding between 6 straight A-U pairs cause the RNA to totally fall off of the DNA template.
  • 3. Transcription - Recapitulation• (… two major prokaryotic terminator signals) 2. Rho-dependent terminators - Also contain inverted repeats that cause hairpin loop formation in the new RNA. Slows down the polymerase - RNA contains a binding site for the Rho protein. Rho moves towards the 3’ end - Acts as a RNA/DNA helicase. Rho is ATPase and helicase. - Many prokaryotic genes are organized in operons (genes in tandem, in similar pathway).Eukaryotic transcription follows the same basic steps of prokaryotic transcription - Activation, initiation, elongation, termination - Major differences exist in how they accomplish the above steps• General features of transcriptional activation is similar in prokaryotic and eukaryotic cells - Some genes are constituitively expressed, others are regulated - The exact nature of the signals that activate transcription can be very different• Initiation – Making the DNA accessible. Eukaryotic DNA is tightly coiled around proteins calledhistones (and some nonhistone proteins) - DNA is negatively charged (phosphate groups), histones are very positively charged-A histone octamer (8 histone proteins in a complex). Each group is called a nucleosome• DNA is freed from histones in 2 major ways: 1) Histone acetylation (HATs) add an acetyl group (CH3CO) to histones. This neutralizes theirpositive charge and causes them to lose their attraction for DNA. - Occurs only in the area to be transcribed (it is specific!)  Deacetylases remove acetyl groups after transcription 2) Chromatin remodeling - Some proteins move nucleosomes around without directly modifyinghistones.
  • 4. Benjamin A. Pierce GENETICS A Conceptual Approach FOURTH EDITION CHAPTER 15 The Genetic Code and Translation© 2012 W. H. Freeman and Company
  • 5. HUTTERITES, RIBOSOMES, AND BOWEN-CONRADI SYNDROMEAlmost all children with Bowen-Conradi syndrome are Hutterites, (1500s in Austria).Hutterites immigrated to South Dakota in the 1870s . They live on communal farms, arestrict pacifists, and rarely marry outside of the Hutterite community. founder effect—thepresence of the gene in one or more of the original founders—and its spread asHutterites intermarried within their community. 2009: Bowen-Conradi syndrome resultsfrom the mutation of a single base pair in the EMG1 gene, located on chromosome 12.The protein encoded by the EMG1 gene plays an essential role in processing 18SrRNA and helps to assemble it into the small subunit of the ribosome. Because of amutation in the EMG1 gene, babies with Bowen-Conradi syndrome produce ribosomesthat function poorly and the process of protein synthesis is universally affected.
  • 6. The genetic code and translation
  • 7. Chapter 15 Outline15.1 Many Genes Encode Proteins, 40215.2 The Genetic Code Determines How the Nucleotide Sequence Specifies the Amino Acid Sequence of a Protein, 40715.3 Amino Acids Are Assembled into a Protein Through the Mechanism of Translation, 41215.4 Additional Properties of RNA and Ribosomes Affect Protein Synthesis, 420
  • 8. 15.1 Many Genes Encode Proteins• The One Gene, One Enzyme Hypothesis • Genes function by encoding enzymes, and each gene encodes a separate enzyme. • More specific: one gene, one polypeptide hypothesis
  • 9. Transcription, mRNA processing, and translation Instructions  Product• Reviewing how we go from instructions (DNA) to product (protein) 1. Transcription - The information contained in the DNA is copied into a complementary strand of RNA (ribonucleic acid) - This RNA copy is called messenger RNA or mRNA - It contains the same protein-building instructions as contained in the DNA 2. mRNA editing/export (only in eukaryotes) - The mRNA copy is capped, given a poly-A tail, and spliced - Processed mRNAs are shipped out of the nucleus 3. Translation - Cytosolic mRNA is recognized by a ribosome - Ribosomes read the mRNA and make a protein
  • 10. Genetic code The language of genetics• Ribosomes can read protein-building instructions  some genetic language must exist - This language is called the genetic code• Properties of the genetic code 1. Location of the genetic code - DNA stores the genetic information, but mRNA contains the actual “words” that are read by the ribosome - Ribosomes do nothing with DNA (genetic code is found within mRNA) 2. The letters of the alphabet - mRNA contains the ribonucleotides A, U, C, G - Ribosomes read the linear order of these letters (don’t bounce around) GCGAUUGCAAUGCUACGGA 3. How are words organized? - Ribosomes read nucleotides in separate small groups (words) - Maximizes efficiency and minimizes errors
  • 11. Genetic code The language of genetics• Properties of the genetic code 3. How are words organized? - Experimental evidence – Francis Crick and others introduced point mutations into a specific gene and monitored how they affected the amino acids Normal GCGAUUGCAAUGCUACGGACAUGCUUG sequence amino acids 1 2 3 4 5 6 7 8 9 frameshift mutation Insert GCGUAUUGCAAUGCUACGGACAUGCUUG 1 nt amino acids 1 XXXXXXX X 2 3 4 5 6 7 8 9 Insert GCGUGAUUGCAAUGCUACGGACAUGCUUG Ribosomes 2 nt amino acids 1 XXXXXXX X 2 3 4 5 6 7 8 9 read the letters in groups of 3 Insert GCGUGGAUUGCAAUGCUACGGACAUGCUUG 3 nt amino acids 1 X 2 3 4 5 6 7 8 9
  • 12. Genetic code The language of genetics• Properties of the genetic code 3. How are words organized? - Another way of visualizing the previous experiment (assuming 3 letter words) Correct THEDOGBITTHEMAN THE DOG BIT THE MAN Insert 1 THEBDOGBITTHEMAN THE BDO GBI TTH EMA N Insert 2 THEBIDOGBITTHEMAN THE BID OGB ITT HEM AN Insert 3 THEBIGDOGBITTHEMAN THE BIG DOG BIT THE MAN  Inserting 3 nucleotides restored the reading frame – very strong evidence that ribosomes read letters in groups of 3 - Also think about the math (remembering there are 20 amino acids): - If the words were single letters – only 4 possible words (A, U , C, or G) - If the words are made of only 2 letters (GU, CC, etc.) – only 16 possible words
  • 13. Genetic code The language of genetics• Properties of the genetic code 3. How are words organized? - The groups of 3 ribonucleotides in mRNA that are read by the ribosome are called codons - Codons are not separated from one another on the strand (no spaces, etc.) - Ribosomes read codons one after another with no breaks - Each codon specifies only a single amino acid (e.g. it is unambiguous) - e.g. AUG  tells the ribosome to put in the a.a. methionine AAA  tells the ribosome to put in the a.a. lysine - It is universal for all species - Examples: AAA codes for lysine in bacteria, plants, fungi, animals,..... GUU codes for valine in all species - Exception: Some Archae utilize different codons for a given amino acid
  • 14. Genetic code The language of genetics• Properties of the genetic code 4. Is the genetic code overlapping? - In other words, do we see: GUACCG  2 nonoverlapping codons (GUA CCG) GUACCG  4 overlapping codons (GUA, UAC,ACC,CCG) - Experiment - If we change the U in the above sequence to a different letter, how many amino acids should change if its nonoverlapping? How many if its overlapping? - Results showed that such a mutation only resulted in a single amino acid change  The genetic code is NONOVERLAPPING - The ribosome reads the first three, moves down three letters and reads the second three
  • 15. 64 20 Genetic code The language of genetics• Properties of the genetic code 5. Is the genetic code is degenerate (redundant) - Each codon is made up of 3 letters and there are 4 possible letters  4 x 4 x 4 = 64 possible codons - Only 20 different amino acids normally found in proteins  Possibilities: - 44 codons (64 minus 20) do not code for any amino acid (wasteful) - More than 1 codon can code for the same amino acid (smart!) - Studies have shown that more than 1 codon can code for the same amino acid (IT IS DEGENERATE) - Example: UCU, UCC, UCA, UCG, AGU, AGC all code for the a.a. serine - If you have a codon UCU and it is mutated to UCC, what happens to the amino acid sequence? - The last nucleotide of a codon can often be changed with no effect on a.a. - Allows for a little flexibility  Called wobble
  • 16. Genetic code The language of genetics• Properties of the genetic code 6. Which codon codes for which amino acid? - Marshall Nirenberg and Heinrich Matthaei – 1961 - Did several key experiments that deciphered the genetic code a) Making polypeptides with artificial mRNAs 1) Developed an in vitro (test tube) translation system - Contained ribosomes, tRNAs, amino acids, and translation factors - Add mRNA  Polypeptide chain is made in the tube 2) Made artificial mRNAs containing only 1 repeated nucleotide - Examples: UUUUUUUUUU or CCCCCCCCC or AAAAAAAAAAA - Poly U – Contains codons UUU UUU UUU UUU UUU....... 3) Set-up 20 different in vitro translation tubes - Each contained ribosomes, tRNAs, translation factors, and poly U mRNA - Each tube contained 1 radioactive amino acid - Each had a different one
  • 17. Genetic code The language of genetics• Properties of the genetic code 6. Which codon codes for which amino acid? - Marshall Nirenberg and Heinrich Matthaei – 1961 - Did several key experiments that deciphered the genetic code a) Making polypeptides with artificial mRNAs 4) Looked to see which radioactive amino acid formed a chainPoly U exp. Ala* Met* Lys* Phe* Tyr* His* - Results from above: UUU codes for Phe - Repeated for poly A and poly C
  • 18. Genetic code The language of genetics• Properties of the genetic code 6. Which codon codes for which amino acid? a) Making polypeptides with artificial mRNAs - Different picture of the experiment just described b) Triplet binding assay - Review of transfer RNA (tRNA) function - tRNAs TRANSFER different amino acids to the ribosome - Each type of tRNA molecule carries 1 of the 20 a.a. (different tRNAs carry different amino acids) - Review of tRNA structure - All tRNAs fold into a complex 3-D shape that looks like a cloverleaf - All possess two distinct structural regions: - Amino acid binding site - Anticodon loop
  • 19. The Degeneracy of the Code• Degenerate code: Amino acid may be specified by more than one codon.• Synonymous codons: codons that specify the same amino acid• Isoaccepting tRNAs: different tRNAs that accept the same amino acid but have different anticodons
  • 20. aa Genetic code The language of genetics• Properties of the genetic code 6. Which codon codes for which amino acid? 3) Triplet binding assay - Two major regions of tRNAs: a) Amino acid binding site (acceptor stem) - Single-stranded 3 end that binds to the amino acid - Enzymes called aminoacyl-tRNA synthetases read the tRNA sequence and add the appropriate amino acid to the stem - Amino acid addition is VERY SPECIFIC! b) Anticodon loop - at center of middle loop - Sequence of three bases that is complementary to a codon in the mRNA - Each type of tRNA contains a different anticodon (and each is carrying a specific a.a.) Anticodons bind to the complimentary codons in mRNA!
  • 21. Genetic code The language of genetics• Properties of the genetic code 6. Which codon codes for which amino acid? 3) Triplet binding assay a) Made an artificial mRNA consisting of just 1 codon b) Added to ribosomes - The triplet (just 1 codon) binds to the mRNA binding site in the ribosome c) Have 20 tubes set-up - To each, add a different tRNA-amino acid (radioactive) - The codon will only bind to the tRNA with the matching anticodon - Example: CAG in mRNA will recruit tRNA with the anticodon GUC d) Look to see which radioactive amino acid is brought into the ribosome  Was able to assign an amino acid to all the codons (but 3)
  • 22. Genetic code The language of genetics• Found that 61 of 64 possible codons code for an amino acid• Notice the redundancy (degeneracy) - UCU, UCC, UCA, UCG, AGU, AGC all code for serine - Third position often unimportant (UC_) - H bonding is more important in 1st 2 positions• Not all codons code for an amino acid - 3 stop codons exist - When ribosome reads, termination occurs and protein synthesis ceases• AUG is always the start codon - Thus, all proteins start with a methionine
  • 23. The Degeneracy of the Code• Codons – Sense codons: encoding amino acid – Initiation codon: AUG – Termination codon: UAA, UAG, UGA• Wobble hypothesis
  • 24. Concept Check 3Through wobble, a single can pair with more than one . a. codon, anticodon b. group of three nucleotides in DNA, codon in mRNA c. tRNA, amino acid d. anticodon, codon
  • 25. Concept Check 3Through wobble, a single can pair with more than one . a. codon, anticodon b. group of three nucleotides in DNA, codon in mRNA c. tRNA, amino acid d. anticodon, codon
  • 26. 15.3 Amino Acid Are Assembled into a Protein Through the Mechanism of Translation•The Binding of Amino Acids to Transfer RNAs•The Initiation of Translation•Elongation•Termination
  • 27. The Binding of Amino Acids to Transfer RNAs• Aminoacyl-tRNA syntheses and tRNA charging • The specificity between an amino acid and its tRNA is determined by each individual aminoacyl-tRNA synthesis. There are exactly 20 different aminoacylt-tRNA syntheses in a cell.
  • 28. Concept Check 4Amino acids bind to which part of the tRNA? a. anticodon b. DHU arm c. 3’ end d. 5’ end
  • 29. Concept Check 4Amino acids bind to which part of the tRNA? – anticodon – DHU arm – 3’ end – 5’ end
  • 30. Translation Review and ribosomes• Translation – Process by which a ribosome reads the sequence of codons in a strand of mRNA and uses the information to produce a polypeptide from amino acids• Ribosomes are made up of 2 subunits – a small and a large - Each subunit contains 20-50 different proteins and several molecules of ribsomal RNA (rRNA) - Differences in sizes exist between prokaryotic and eukaryotic ribosomes 1) Prokaryotic – 70S - Large (50S) + small (30S) - Contains 16S rRNA - Used for species ID 2) Eukaryotic – 80S - Large (60S) + small (40S)
  • 31. Translation Ribosomes• All ribosomes have 1 mRNA binding site and 3 binding sites for tRNAs - Remember tRNAs are going to bring the appropriate amino acids to the ribosome - A (aminoacyl) site = Holds a tRNA that just arrives to the ribosome - P (peptidyl) site = Holds a tRNA that contains the growing polypeptide chain - E (exit) site = Holds a tRNA that has already given up its amino acid and is getting ready to exit the ribosome
  • 32. Translation The process• Translation can be divided into 3 major stages: 1) Initiation – Getting the ribosome ready a) Several initiation factors bind to the small ribosomal subunit - Initiation factors (IFs) are proteins that help get the ribosome/mRNA/tRNA assembled - IF3 binds to the small subunit and helps keep it apart from the large subunit b) Recruitment of an initiator tRNA to the small subunit - IF2 (euk and prok) binds to an initiator tRNA and brings it to the P site of the small subunit - Initiator tRNA contains the anticodon UAC and a the amino acid methionine - Why this tRNA? - Remember the universal start codon is AUG - Thus need to start with a tRNA that has the anticodon UAC
  • 33. The Initiation of Translation• Initiation factors IF-3, initiator tRNA with N- formylmethionine attached to form fmet-tRNA• Energy molecule: GTP
  • 34. The Initiation of Translation• The Shine–Dalgarno consensus sequence in bacterial cells is recognized by the small unit of ribosome.• The Kozak sequence in eukaryotic cells facilitates the identification of the start codon.
  • 35. Translation The process• Translation can be divided into 3 major stages: 1) Initiation – Getting the ribosome ready c) The mRNA binds to the small ribosomal subunit - In eukaryotic cells, a complex of initiation factors (collectively called IF4) binds to the mRNA 5 cap - IF4 on the mRNA interacts with IF3, which is already bound to the small subunit - Starting at the end, the small subunit begins scanning the mRNA until reaching the first available AUG (start codon) - Ribosome helps identify the start codon by the presence of an upstream Kozak sequence AUG AUG - Bacterial mRNA dont have a cap – bind to ribosome via IF3 only (no scanning from the end). - Shine-Dalgarno sequence before AUG helps the ribosome find it
  • 36. Translation The process• Translation can be divided into 3 major stages: 1) Initiation – Getting the ribosome ready d) The large subunit binds to the assembled complex - The large ribosomal subunit comes in and attaches to the small subunit complex - Most of the other initiation factors then come off the complex  The ribosome is now ready to begin constructing a polypeptide
  • 37. Elongation• Exit site E• Peptidyl site P• Aminoacyl site A• Elongation factors: Tu, Ts, and G
  • 38. Translation The process• Translation can be divided into 3 major stages: 2) Elongation – Stage when the polypeptide is actually made a) The ribosome reads the next codon (3 nucleotides) and the specific tRNA with the complimentary anticodon will come into the A site - Attachment of tRNAs to the ribosome is aided by various elongation factors (EFs) in prokaryotes and eukaryotes b) The methionine is removed from the 1st tRNA and enzymatically added to the amino acid on the 2nd tRNA (the one in the A site) - A peptide bond is formed - This transfer reaction is catalyzed by the rRNA in the ribosome
  • 39. Translation The process• Translation can be divided into 3 major stages: 2) Elongation – Stage when the polypeptide is actually made c) The empty (uncharged) tRNA in the P site moves into the E site briefly and exits the ribosome - tRNA movement is aided by other EFs d) mRNA shifts by 3 nucleotides (also aided by EFs) - The tRNA with the 2 amino acids moves to the P site - The 3rd codon is now exposed in the A site e) The tRNA with the complimentary anticodon comes into the A site
  • 40. Translation The process• Translation can be divided into 3 major stages: 2) Elongation – Stage when the polypeptide is actually made f) Dipeptide on the tRNA in the P site is transferred onto the amino acid in the A site............  The whole process continues – a polypeptide chain is created  The order of codons determines the order of amino acids!! Elongation summary
  • 41. Concept Check 5In elongation, the creation of peptide bonds between amino acids is catalyzed by . a. rRNA b. protein in the small subunit c. protein in the large subunit d. tRNA
  • 42. Termination• Termination codons: UAA, UAG, and UGA• Release factors
  • 43. Translation The process• Translation can be divided into 3 major stages: 2) Elongation - How are a.a. chemically-linked during elongation? - The amino group of one amino acid reacts with the carboxyl group of an adjacent amino acid - Water is removed (dehydration) and a peptide bond is formed - All peptides/polypeptides/proteins have 2 ends - N-terminus (a.a. 1) – Free NH2 group - C-terminus (last a.a.) – Free COOH group
  • 44. Termination• Termination codons: UAA, UAG, and UGA• Release factors
  • 45. Translation The process• Translation can be divided into 3 major stages: 3) Termination – The process stops - As the ribosome reads the mRNA, it eventually will arrive at one of the 3 stop codons (UAA, UAG, UGA) - No tRNA has a corresponding anticodon  No amino acid can be added to the chain - This acts as a signal to the ribosome that it needs to end translation - Protein release factors bind to the ribosome and release both the mRNA and polypeptide (and cut the polypeptide from the last tRNA)
  • 46. Translation The process• Review of translation Animation: http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter15/animations.html
  • 47. Benjamin A. Pierce GENETICS A Conceptual Approach FOURTH EDITION CHAPTER 16 Control of Gene Expression in Prokaryotes© 2012 W. H. Freeman and Company
  • 48. Chapter 16 Outline16.1 The Regulation of Gene Expression Is Critical for All Organisms, 43216.2 Operons Control Transcription in Bacterial Cells, 43516.3 Some Operons Regulate Transcription Through Attenuation, the Premature Termination of Transcription, 44816.4 RNA Molecules Control the Expression of Some Bacterial Genes, 451
  • 49. 16.1 The Regulation of Gene Expression is Critical for All Organisms•Genes and Regulatory Elements•Levels of Gene Regulation•DNA-Binding Proteins
  • 50. Genes and Regulatory Elements• Structural genes: encoding proteins• Regulatory genes: encoding products that interact with other sequences and affect the transcription and translation of these sequences• Regulatory elements: DNA sequences that are not transcribed but play a role in regulating other nucleotide sequences
  • 51. Genes and Regulatory ElementsConstitutive expression: continuously expressed under normal cellular conditionsPositive control: stimulate gene expressionNegative control: inhibit gene expression
  • 52. Regulation of transcription Prokaryotic cells• Transcriptional regulation in prokaryotic cells 2) Gene grouping (operons) - Bacteria organize their genes much more efficiently than do eukaryotic cells - Examples Genes controlling eye color in humans may be found on 7 different chr. All genes controlling Trp production in bacteria are found 1 after another - Bacteria typically organize all genes that have a related function together into what is known as an operon - Operons contain: 1) A promoter region, which contains the operator region - Operator = Binding site for a repressor protein (ON/OFF switch) 2) Set of related genes found in tandem (back-to-back) - Because they share a promoter, TURN 1 GENE ON, TURN THEM ALL ON!! promoter reg gene gene 1 gene 2 gene 3 gene 4 operator
  • 53. Regulation of transcription Prokaryotic cells• Transcriptional regulation in prokaryotic cells 2) Gene grouping (operons) b) Negative regulation of operons (repressible operons) - Transcription is normally on - A corepressor comes along and activates the repressor, - The activated repressor then binds to the operator - Transcription of all genes in the operon is shut off!! - Example: Trp operon http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter18/animations.html#
  • 54. The lac Operon of E. coli • A negative inducible operon • Lactose metabolism • Regulation of the lac operon • Inducer: allolactose – lacI: repressor encoding gene – lacP: operon promoter – lacO: operon operatorhttp://www.youtube.com/watch?v=iPQZXMKZEfw&list=PL8091AA96CA7136B2&index=14&feature=plpp_video
  • 55. Regulation of transcription Prokaryotic cells a) Positive regulation of operons (inducible operons) - Transcription is normally turned off (because the repressor is active when it is unbound by anything) - An inducer comes along, binds to the repressor, and inactivates it - With the repressor shut down, transcription of all genes in the operon is allowed to occur - Example: Lac operonhttp://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter18/animations.html#
  • 56. Concept Check 4In the presence of allolactose, the lacrepressor . a. binds to the operator b. binds to the promoter c. cannot bind to the operator d. binds to the regulator gene
  • 57. Concept Check 4In the presence of allolactose, the lacrepressor . a. binds to the operator b. binds to the promoter c. cannot bind to the operator d. binds to the regulator gene
  • 58. Attenuation in the trp Operon of E. coli• Four regions of the long 5′ UTR (leader) region of trpE mRNA • When tryptophan is high, region 1 binds to region 2, which leads to the binding of region 3 and region 4, terminating transcription prematurely.
  • 59. Attenuation in the trp Operon of E. coli • Four regions of the long 5′ UTR (leader) region of trpE mRNA • When tryptophan is low, region 2 binds to region 3, which prevents the binding of region 3 and region 4, and transcription continues.http://www.youtube.com/watch?v=42RqqAYs8Fk&list=PL8091AA96CA7136B2&index=17&feature=plpp_video
  • 60. Transcription Regulation in eukaryotic cells• Eukaryotic cells utilize much more complicated mechanisms of controlling transcription• Some mechanisms of eukaryotic transcriptional control: 1) Regulatory transcription factors - Basal TFs only provide baseline levels of transcription - Sole function: Get the RNA polymerase onto the DNA - Regulatory TFs function to alter transcription above or below basal levels - Provides fine control over transcription - Cells have 100s of them - Regulatory TFs bind to 2 types of DNA seq.: - Promoters (not just consensus seq) - Enhancers - Function to increase rates of transcription - Can be located far from the promoter (up or down) - TF binding causes DNA bending so that enhancer/promoter close in 3-D
  • 61. Levels ofGene Regulation in Eukaryotes
  • 62. Transcription Regulation in eukaryotic cells• Some mechanisms of eukaryotic transcriptional control: 1) Regulatory transcription factors - Regulatory transcription factors do their job by: a) Binding to DNA and directly altering recruitment/binding/movement of basal TF and RNA pol - Some may sterically block binding whereas others stabilize it b) Others bind to DNA and recruit or block HATs - Increasing or decreasing histone acetylation can alter how well basal TF get to the DNA  End result of both: - Clear the way for basal TF (or increase their affinity)  enhancement - Block basal TF in any way  reduce transcription 2) DNA methylation - A methyl group is enzymatically added to cytosines via specific methyltransferases - CG is usually the recognition sequence
  • 63. Transcription Regulation in eukaryotic cellsDNA methylation (cont) - Methylated bases serve as binding sites for methyl-CpG-binding domain proteins (MGDs) - These block transcription factor assembly, block chromatin remodeling, and also recruit histone deacetylases  DNA methylation usually functions to block transcription - Methylation is cell and tissue-specific - Programmed during early development - During cell differentiation, different genes become methylated in different cell types - Example: Brain-specific genes methylated in liver cells and vice versa embryo brain embryo liver
  • 64. Transcription Regulation in eukaryotic cellsDNA methylation (cont) - Pattern of methylation is unique in each person and is somewhat influenced by environment - Total collection of DNA structural alterations = epigenetics - Epigenetics and relationship to reproductive animal cloning - Somatic cell nuclear transfer procedure - Take nucleus out of a donor somatic cell (e.g. skin cell) - That cell already has certain genes methylated - Inject it into an empty egg and implant into a surrogate mom - Theory: All methylated DNA gets demethylated once inside an egg again (reset) - Baby born will have identical genome as the donor animal
  • 65. Transcription Regulation in eukaryotic cellsDNA methylation (cont) - Epigenetics and relationship to reproductive animal cloning - Two problems result from the above procedure: a) Demethylation is never complete in the egg - Ideal situation: All genes get demethylated and the zygote starts with a blank slate ideal - All genes start in the “on” position and can be methylated differently in the different tissues - Actual situation: A few genes fail to be demethylated - Start a new animal with certain genes in the “off” position permanently - Imagine if that gene is involved in brain development real - Will never be turned on!!  Result: Most clones die very young!!
  • 66. Transcription Regulation in eukaryotic cellsDNA methylation (cont)b) Methylation is affected by the environment - Methylation of the original donor’s DNA can be different from that of the clone - We still can’t predict or control it - Genome is identical  Epigenome is not Original Clone  End result: Clone can have different appearance and personality as the donor - Example: CopyCat and Rainbow- Epigenetics and imprinting - Imprinting = Specific case of DNA methylation whereby a given gene is methylated differently depending on what parent it came from - Transcription of gene A may be shut off on mom’s chr. 10 ,but active on dad’s chr. 10 (essentially only having 1 functional copy)