MICROBIAL BIOTECHNOLOGY
Upcoming SlideShare
Loading in...5
×
 

MICROBIAL BIOTECHNOLOGY

on

  • 796 views

GENETIC ENGINEERING

GENETIC ENGINEERING

Statistics

Views

Total Views
796
Views on SlideShare
796
Embed Views
0

Actions

Likes
1
Downloads
41
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment
  • pGLO contains several genes that enable replication of the plasmid DNA and expression of the fluorescent trait (phenotype) in bacteria following transformation. Some of the essential genes include: <br /> GFP — The jellyfish gene that codes for the production of Green Fluorescent Protein <br /> bla — A gene that encodes the enzyme beta-lactamase, which breaks down the antibiotic ampicillin. Bacteria containing the bla gene can be selected by placing ampicillin in the growth medium <br /> ori — The origin of pGLO plasmid DNA replication. Must be compatible with the origin of replication of host bacteria. <br /> araC — A gene that encodes the regulatory protein that binds to the pBAD promoter. Only when arabinose binds to the araC protein is the production of GFP switched ON <br /> pBAD Promoter — A specific DNA sequence upstream from the GFP gene, which binds araC-arabinose and promotes RNA polymerase binding and transcription of the GFP gene <br /> Multiple Cloning Sites — Regions of known restriction (NdeI, HindIII, EcoRI, etc.) sites that permit insertion or deletion of the gene of interest <br />

MICROBIAL BIOTECHNOLOGY MICROBIAL BIOTECHNOLOGY Presentation Transcript

  • Microbial Biotechnology AND GENETIC ENGINEERING • PANKAJ BHATT • RESEARCH SCHOLAR • MICROBIOLOGY
  • Vector Systems • A vector is a DNA molecule used as a vehicle to transfer foreign genetic material into another cell • An ideal Vector should possess:      An origin of replication (ori) A selectable marker gene Unique restriction site(s)/MCS Small size Expression control elements
  • Cloning & Expression vectors • Cloning vectors are meant typically to isolate or multiply the insert in the target cell. • • Expression vectors specifically are for the expression of the transgene in the target cell Generally have a promoter sequence that drives expression of the transgene. Shuttle Vectors • • Vector containing two origin of replication or a broad host-range ori Multiplication in two different hosts possible
  • Plasmids: History, Uses & Types
  • Plasmids: basic biology • Circular extrachromosomal DNA molecules found in most of the prokaryotes; and also in some yeasts, but not in higher eukaryotes (Helsinki, 1979) • Provide certain additional/advantageous properties to the bacterial host viz. antibiotic resistance, degradation of complex organic compounds , production of toxins etc. • Not actually the part of bacterial genome as these can mobilize from one host to another; may sometimes be present or absent from the cells of a particular host species. Therefore, nonessential for normal bacterial growth and division • Size: vary from 1-200 Kb • Shape: majority are covalently closed circular DNA molecules; linear plasmids- Borellia, Streptomyces sp.
  • • Based on the intrinsic properties the plasmids can be: A. Conjugative and non-conjugative – Conjugation is mediated by two sets of plasmid encoded genes Transfer genes (tra) & mobilising factors (mob) – Tra comprise a set of atleast 12 different genes which are responsible for synthesis of pili & other surface components allowing physical contact – Mob defined by atleast two regions; one coding for a mobilising protein which binds to other mob region (nic/bom) present on the plasmid DNA Conjugative plasmids – have functional transfer and mobility regions (tra+, mob+) – Mediate their own transfer – Present in many Gram –ve and some Gram +ve bacteria – Are large with stringent control of DNA replication – Are present in low copy number – E.g. F plasmids Non-conjugative Plasmids – That which lack the transfer function (tra-, mob+) – Can be mobilised if other conjugative plasmid present in the same cell – E.g. ColE1, CloDF13 can be mobilised by F factor
  • • Interestingly, plasmids with (tra-, mob-) phenotype are neither conjugative nor can they be mobilised. • Yet, if only Mob-protein coding region is lost, such plasmids can still be mobilised by availability of a functional Mob-protein supplied by another plasmid; which can act in trans on the Mob- plasmid. B. Integrative (Those which integrate with the bacterial chromosome; also called as Episome) and Non-Integrative Plasmids (do not integrate) • Based on the functional properties: – F Plasmids – R plasmids – Col Plasmids – Degradative Plasmids – Virulence plasmids
  • Plasmid replication • The replication strategy that a plasmid uses directly affects its copy number, host range, and incompatibility group. • relies on the normal host DNA replication machinery. • Plasmids will carry distinct origins of replication (ori) and genes that enable and control the frequency of their replication. – Theta mode of replication • Most of the Gram –ve bacteria e.g. ColE1, RK2 – Rolling circle mode of replication • Some Gram +ve bacteria
  • • Plasmid Incompatibility – Two plasmids are incompatible if they are unable to coexist in the same cell – Usually these share a common replication system and common types of pilli, thus compete with each other during replication – Based on this, more than 30 incompatibility groups (Inc) have been defined in E. coli and 13 in S. aureus.
  • • Plasmid Host Range- determined by its ‘ori’ region • Narrow host range plasmids: – most of the naturally occurring plasmids have a restricted host range. – E.g. ColE1 and its derivatives grow only in E. coli and related organisms such as Salmonella. • Broad host range plasmids: • Possess less specific ori region such that it can function in a number of bacterial species. • Most of them require very few of the host-encoded proteins • Generally plasmids of the incompatibility group P, Q, and W have a broad host range; also called as promiscuous plasmids e.g. RP4, RSF1010, RK2 etc. • Can replicate in a no. of bacteria such as E. coli, Agrobacterium, Pseudomonas, Rhizobium etc. • Thus interesting for gene manipulation experiments!!!
  • Plasmid copy number: the no. of molecules of an individual plasmid that may normally be found in the single bacteria are referred to as the ‘Copy Number’ • Low copy no. (STRINGENT PLASMIDS) – Copy no. hardly ever >1 – Rigid control of replication – Copy no. either controlled by or correlated with the replication of chromosomal DNA molecule – Thus, pDNA replicates only once or twice before the cell division – Single copy plasmids have a partitioning system; so as to ensure segregation of duplicated copies to different daughter cells – High Mol. Wt. & Conjugative • High copy no. (RELAXED PLASMIDS) – multiple copies per cell – Relaxed control of replication – pDNA replication not dependent upon host cell chromosomal DNA replication – pDNA replicates repeatedly until a proper no. is reached – No such partitioning system +nt – Generally Low Mol. Wt and non-conjugative
  • Plasmids as Vectors: essential features • • • • • • Autonomous replication in host: Ori region Selectable marker(s) Unique restriction sites/Multiple cloning sites Low molecular weight High copy number Size: small
  • A more detailed look at plasmids Promotor Site Origin of Replication Antibiotic Resistance Gene Multiple Cloning Site
  • Cloning into a Plasmid
  • Some earlier used plasmids • pSC101 – the first cloning vector, used in 1973 by Boyer and Cohen. – 9 kb, low copy no. – the original pSC101 only contained tetracycline resistance and a restriction site for EcoRI, – the commercially available pSC101 gained restriction sites for several enzymes, including HindIII, in addition to the EcoRI site.
  • • ColE1 plasmid – – – – Approx 6.4 kb Exist as multiple copies per cell Single EcoR1 site present in colicin production (cea) gene; transformants selected by inactivation of colicin production; technically difficult and cell resistance to colicins arises spontaneously at quite high frequency in a bacterial population.
  • • Earlier natural plasmids of E. coli were used as cloning vectors e.g. pSC101, pSF2124, ColE1 etc. • Disadvantages:  Generally large sizes – difficult transformation  Presence of non-essential genes (toxin production etc.)  Absence of unique restriction sites, desired marker genes  Conjugative and mobilization properties Therefore, artificial construction of desired plasmid vectors • Advantages:  Increased efficiency of transformation  Easier to restriction map  Higher copy numbers
  • • pBR322 – an example of an early cloning vector that replicates in E. coli – Constructed by Bolivar & Rodriguez – Approx 4.3kb plasmid composed of sequences from ColE1, pMB1 and pSC101 plasmids – ori allows independent replication – single cleavage sites for various restriction enzymes (BamHI etc) – tet resistance gene – amp resistance gene Mechanism: – insertion of foreign DNA at BamHI site – tet resistance gene inactivated – transformants carrying foreign DNA are amp resistant but tetracycline sensitive – Double selection of transformants required /replica plating
  • pUC series • • • • • 1982, University of California Approx. 2.7kb in size; high copy no. amp resistance gene ori derived from pBR322 Unique restriction sites clustered into one short fragment called as ‘the multiple cloning site (MCS)’ or the polylinker site
  • Another advancement was the use of blue white screening • • The Lac Z’ gene coding for beta-galactosidase was incorporated as a part of the MCS region in plasmids Insertional Inactivation of the lac Z gene leads to the selection of transformants
  • pGEM series pGEM3Z/ pGEM4Z  next generation  introduces RNA expression for in vitro or in vivo expression
  • Limitations of Cloning in Plasmids  Upper limit for clone DNA size is 12 kb  Requires the preparation of “competent” host cells  Inefficient for generating genomic libraries as overlapping regions needed to place in proper sequence Preference for smaller clones to be transformed If it is an expression vector there are often limitations regarding eukaryotic protein expression  
  • Bacteriophage lambda (λ) as cloning vehicles
  • Life cycle of a phage
  • Phage replication • λ circles multiply by theta form and continues for 515 minutes after infection. • Rolling circles predominates after 15 minutes and produce linear concatemers (genomes linked end to end) • cos sites recognised by endonucleases/terminase producing individual phage genomes for packaging • Packaging also requires THF (termination host factor) provided by the host cell.
  • Molecular biology of λ genome • • • • Mol wt. 31X106 Da, 48.5 Kb long DNA isolated from virus particles is a ds linear molecule cos sites: 12 nucleotides long single stranded cohesive termini at each 5’ end When inside host cell: circularization of phage DNA Genetic map of λ: almost 40 genes organised in functional clusters 5’ cos sites 5’ cos sites Head Tail Left region Recombination, Lysogeny Regulation, Replication, Lysis Central region Much of this central region is not Much of this central region is not essential for lytic growth and can essential for lytic growth and can be deleted or replaced for the be deleted or replaced for the construction of suitable vectors construction of suitable vectors Right region
  • Lysis Replication ori cos Head Tail Lysis Replication ori Circularized lambda Lysogeny Deletion of non essential region Deletion of non essential region makes room for the ‘foreign makes room for the ‘foreign insert’ insert’ cos Head Tail
  • Constraints with wild type λ; construction of λ Vectors • Protein capsule of λ has a tight constraint on the amount of DNA that will fit inside it – Molecules <38kb are not packaged efficiently – However, ~105% of the normal complement of λ DNA can be packaged into phage heads leading to an upper limit of ~52kb – Therefore, 38-52Kb packaging limits of phage heads. – Elimination of non-essential part: vector can accommodate ~14.5Kb of insert. Also λ arms contain some non-essential regions that can be removed. Thus a maximum of 24.6 Kb foreign DNA can be inserted • Presence of multiple restriction sites of same enzyme.
  • Lambda vectors • Insertion vectors: cos cos EcoRI • Replacement vectors: cos cos EcoRI 20Kb What was the need for replacement vectors!!! EcoRI
  • Cloning in λ vectors Cloning in λ vectors • Restrict λ vector as well as genomic DNA • Ligation: formation of recombinants • Introduction into host: transfection or in vitro packaging • Selection screening and
  • In vitro packaging
  • Examples of lambda vectors λEMBL3 λGEM-11
  • Screening phage recombinants • • • • λ gt10: Insertional inactivation of cI gene : cI product induces lysogeny, so non-recombinants follow lysogeny and form turbid plaques but recombinants where cI gets interrupted by insert undergo lytic cycle and form clear plaques λ gt11: Interruption of Lac Z’ gene: when plated Lac Z- host on a medium containing X-gal and IPTG; recombinants form white plaques whereas non-recombinants give blue plaques. λEMBL3 and 4: size selection λGEM11 and 12: spi- phenotype of recombinants Cloning in E. coli cells containing P2 phage insertion of target makes the recombinant phage spi- hence grow on E. coli cells with P2 infection
  • • Advantages – Efficient cloning of larger fragments (10-24kb) – Phage vectors suitable for genomic library construction – Introducing phage DNA into E. coli by phage infection is much more efficient than transforming E. coli with plasmid DNA – Replacement vectors offer selection of recombinants on the basis of size itself – Several 1000s phage plaques can be screened & characterized on a single petri dish • Limitations • Not suitable for whole genome sequencing in eukaryotes.
  • M13 phages M13 phages • Filamentous non-lytic phages • Circular ssDNA; ~6400 nts in length • Exist as both dsDNA & ssDNA in different phases of its replication cycle How M13 infects and reproduces • infects through pili • Protein coat is stripped and ssDNA is converted to double stranded replicative form (RF) • DNA replicated; switch over to RF-RF  RF-ss • New particles assembled with ssDNA & released without lysis • ~200 particles per infected cell per generation Uses • • • Cloning and sub cloning expts. ssDNA for probes, sequencing Phage display technology; M13 will produce foreign protein on surface as part of its protein coat, can use to generate specific antibodies
  • Obtaining single-stranded DNA by cloning in M13 phage. Foreign DNA (red), cut with HindIII, is inserted into the HindIII site of the double-stranded phage DNA. The resulting recombinant DNA is used to transform E.coli cells, whereupon the DNA replicates by a rolling circle mechanism, producing many singlestranded product DNAs. The product DNAs are called positive (+) strands, by convention. The template DNA is therefore the negative (-) strand.
  • Cosmids • • • • • Barbara Hohn & John Collins, 1979 Plasmids containing lambda cos sites Cos sites: essential for packaging of nucleic acid into protein coat/heads Thus, any in vitro packaging reaction could work not only with lambda genomes but also with any molecule that carries the cos sites separated by 38-52 kb of DNA. Plasmid features: – Ori – Selectable marker – Unique restriction sites • • DNA (~ 33-48 kb) cloned into restriction site, the cosmid packaged into viral particles and these phages used to infect E. coli inside bacterial host, replicate as plasmids and no expression of phage functions
  • Examples: pWE15, Homer I, pJC79, c2XB, Supercos-1 etc.
  • • Advantages – – – – High insert capacity; fewer clones to be screened Useful in genomic library construction Studying larger genes Transformation frequency higher due to in vitro packaging • Limitations • Somewhat unstable due to large size, difficult to maintain Genomic libraries of Drosophila, mouse and several Genomic libraries of Drosophila, mouse and several other organisms have been produced with cosmid other organisms have been produced with cosmid vectors vectors
  • Phagemids have been engineered to produce single-stranded DNA in the presence of helper phages. •Single-stranded; •Both filamentous phage and plasmid characteristics; •Helper phage •Two RNA polymerase promoters (T7and T3) The f1 replication origin was not sufficient to direct ssDNA The f1 replication origin was not sufficient to direct ssDNA production, but if aa bacterium carrying aa phagemid was production, but if bacterium carrying phagemid was superinfected with aa functional wild type M13 or f1 helper phage, superinfected with functional wild type M13 or f1 helper phage, then the production of single stranded phagemid DNA would occur. then the production of single stranded phagemid DNA would occur. They are generally small plasmids so that they have the ability to They are generally small plasmids so that they have the ability to accept larger DNA inserts than M13 based vectors. accept larger DNA inserts than M13 based vectors.
  • Uses: Uses: DNA sequencing DNA sequencing Oligonucleotide directed mutagenesis Oligonucleotide directed mutagenesis Probe synthesis Probe synthesis Egs. • pEMBL vectors • pBluescript II series • pGEMZf series
  • Concept, types & uses of Artificial chromosomes (YACs, BACs & PACs) Need to clone larger inserts!! EUKARYOTIC GENOMIC LIBRARY CONSTRUCTION EUKARYOTIC GENOMIC LIBRARY CONSTRUCTION
  • YACs Yeast artificial chromosomes are shuttle-vectors that Yeast artificial chromosomes are shuttle-vectors that can be amplified and modified in bacteria and can be amplified and modified in bacteria and employed for the cloning of very large DNA inserts (up employed for the cloning of very large DNA inserts (up to 1–2 mega base pairs) in the yeast Saccharomyces to 1–2 mega base pairs) in the yeast Saccharomyces cerevisiae cerevisiae
  • Introduction Introduction • relatively small size (approximately 12 kb) • Circular form when they are amplified or manipulated in E. coli, but are rendered linear and of very large size, i.e. several hundreds of kilobases (kb), when introduced as cloning vectors in yeast. • contain all three cis-acting structural elements essential for behaving like natural yeast chromosomes: – an autonomously replicating sequence (ARS) necessary for replication – a centromere (CEN) for segregation at cell division; – Two telomeres (TEL) for maintenance. • Their capacity to accept large DNA inserts enables them to reach the minimum size (150 kb) required for chromosomelike stability and for fidelity of transmission in yeast cells
  • • YACs have several advantages over other large capacity vectors: – accommodation of DNA segments thousands of kilobases in size – stable maintenance of cloned eukaryotic DNA due to the compatibility with the yeast replication machinery. – are amenable to large-scale plasmid amplification in E. coli – creation of specific genetic changes within the exogenous DNA sequences by using the faithful and efficient yeast mechanism of homologous recombination.
  • Overview of Yeast Artificial Chromosomes (pYACs) Plasmids • • • • • Initial pYAC3 and pYAC4 plasmids were constructed by Burke et al. (1987) The basic structural features of YACs were developed from the yeast centromere shuttle-plasmids YCp series. These are composed of double-stranded circular DNA sequences carrying the – beta-lactamase gene bla and the bacterial pMB1 ori – yeast ARS1 with its associated CEN4 DNA sequence – the URA3 selectable marker • On this basic scaffold plasmid; are present – the yeast HIS3, – flanked by a telomere-like DNA sequence (TEL) that are adjacent to two recognition sites for the BamHI restriction enzyme Most of these YACs also contain the cloning site in the middle of the SUP4 gene During Insertional inactivation cloning process, the SUP4 gene is disrupted by the DNA insert, thus removing the suppression of the ade mutations and allowing phenotypic expression as red color.
  • Construction of Yeast Artificial Chromosomes
  • After plasmid DNA purification, two distinct digestions are performed first with BamHI; site flanking the HIS3 gene, HIS3 excised from the plasmid and lost (The excision of the HIS3 gene is used as negative selective marker for uncut pYAC molecules) first digestion generates a long linear fragment carrying telomeric sequences at each end. second digestion consists of the opening of the cloning site within the SUP4 gene Two linear fragments are produced as left and right arms of the future linear YAC The selective markers are thus separated: TRP1 adjacent to ARS1 and CEN4 on the left arm and URA3 on the right arm Large DNA fragments with ends compatible to the cloning site are ligated with phosphatase-treated YAC arms, to create a single yeasttransforming DNA molecule • Primary transformants can be selected for complementation of the ura3 mutation in the host, and successively for complementation of the host trp1 mutation, thereby ensuring the presence of both chromosomal arms. • Transformant colonies containing the exogenous DNA insert within the SUP4 gene are detected by their red color
  • Some biological features of YAC vectors The stability of YAC vectors in yeast per se is similar to that of natural The stability of YAC vectors in yeast per se is similar to that of natural chromosomes provided that all three structural elements (ARS, CEN chromosomes provided that all three structural elements (ARS, CEN and TEL) are present and functional and, in addition, that the minimal and TEL) are present and functional and, in addition, that the minimal required size is reached by the insertion of enough exogenous DNA required size is reached by the insertion of enough exogenous DNA However, the genetic and biochemical background of the However, the genetic and biochemical background of the host cell also plays an important role in determining the host cell also plays an important role in determining the stability of YACs. stability of YACs. Another important consideration is that faithful Another important consideration is that faithful duplication of YACs is guaranteed only if other duplication of YACs is guaranteed only if other DNA sequences incompatible DNA sequences incompatible with ARS do not exist on the construct. with ARS do not exist on the construct.
  • • • • Depending upon the experimental systems and the yeast strains, different selectable markers and restriction sites are appropriate on the YAC vectors. These sites can be constructed in vitro by standard techniques and then used for subcloning DNA fragments Additionally, existing YAC clones can be modified by homologous recombination in yeast i.e. transforming YAC-containing yeast cells with a 'disruption cassette carrying the desired genetic marker flanked by short DNA sequences homologous to one of the markers present on the artificial chromosome.
  • Use of Yeast Artificial Chromosomes • Generating whole DNA libraries of the genomes of higher organisms • YAC clones have been used as hybridization probes for the screening of cDNA libraries, thus simplifying the characterization of unidentified genes. • Study of regulation of gene expression by cis-acting, regulatory DNA elements after the transfer of these YACs from yeast to mammalian cells. • YACs are being used for isolation of functionally analogous mammalian DNA sequences in order to develop mammalian artificial chromosomes (MACs). – The main difficulty in constructing mammalian artificial chromosomes by using YACs is the isolation and maintenance of the mammalian centromere due to its large size and high instability in the yeast cell
  • Limitations of YACs frequent occurrence of chimeric clones frequent occurrence of chimeric clones
  • PACs: P1-derived Artificial chromosome To overcome some of the problems associated with YAC systems To overcome some of the problems associated with YAC systems • P1 bacteriophage has a much larger genome than lambda phage (110-115bp) • it can exist in E. coli in a prophage state • P1 phage has two replication regions: one to control lytic DNA replication and other to maintain the plasmid during non-lytic growth. • Low copy no. • Vectors have been designed with the essential replication components of P1 incorporated into plasmid • Insert capacity in the range of 70-100 kb • Similar to BACs, – these are also easy to manipulate – Transformation efficiency is higher than YACs – PACs are non-chimeric
  • *sacB confers sucrose sensitivity in host
  • Bacterial Artificial Chromosomes • BAC vectors are plasmids constructed with the replication origin of E. coli F factor, and so can be maintained in a single copy per cell. • These vectors can hold DNA fragments of up to 300 kb • Recombinant BACs are introduced into E. coli by electroportation • Once in the cell, the rBAC replicates like an F factor
  • Example: pBAC108L; the first BAC vector • Has a set of regulatory genes, OriS, and repE which control F-factor replication, and parA and parB which limit the number of copies to one or two. • pBAC108L lacked a selectable marker for recombinants. Thus clones with inserts had to be identified by colony hybridization.
  • pBeloBAC11 represents the second generation BAC cloning vectors. • • • • • • • It introduces the LacZ gene to facilitate recombinant identification The T7 and SP6 promoters facilitate the Generation of RNA probes The various restriction sites can be used to excise the inserts of BAC clones. CMR (chloramphenicol) as selectable marker for transformant selection The F factor codes for genes that regulate its own replication and controls its copy number The genes oriS and repE mediate the unidirectional replication of the F factor parA and parB maintain copy number at a level of one or two per cell
  • • Advantages of BACs • lower levels of chimerism • stable • ease of library generation and insert manipulation
  • Animal virus derived vectors • Replicons analogous to bacterial plasmids are not found in animal cells. • Some viruses are used to develop the vectors for animal cells • General vector construction involves replacing essential viral genes with the transgene of interest and using a packaging line to supply the missing viral functions
  • Summary of major expression systems used in animal cells
  • 1. Adenovirus Vectors • • ~36 kb linear dsDNA genome There are six early transcription units (E) and a major late transcript (MLT) Map of the adenovirus genome • Vectors were designed by deleting some of the segments of viral genome
  • Why used as gene-transfer and expression vectors?? • • • • • Stability High capacity of foreign DNA Wide host range; including non-dividing cells Ability to produce high-titre stocks Suitable for transient expression
  • • First generation “E1 replacement vectors” – Lacked the essential E1a and E1b genes + non-essential E3 gene – Maximum capacity: ~7kb – Propagated in “human embryonic kidney line 293” * The human embryonic kidney line 293 is transformed with leftmost 11% of the adenoviral genome and hence provides these gene functions in trans – Problems: cytotoxicity and recovery of replication-competent viruses • – – – Higher capacity vectors were also developed lacked E2 and E4 regions along with E1 and E3 Cloning capacity increased to ~10kb Also need to be propagated in complementary cell lines • E4 gene is responsible for many of the immunological effects of the virus: removal ensures low level of cytotoxicity • Recovery of replication-competent viruses through unwanted recombination was addressed through use of refined complementary cell lines harboring specific DNA fragment corresponding exactly to the E1 genes
  • • If viral genes are deleted then recombinant vector can be propagated in helper cell lines only • Most vectors derived from the adenoviral genome are replication deficient • Adenovirus can be used as vector for transient expression – This virus bearing foreign DNA can be used to produce the foreign protein in many different cell types, but gene expression is usually transient because the viral DNA does not integrate into the host genome. • The lack of integration may, however, be advantageous if adenoviral vectors are used in gene therapy.
  • • • • • • Advantages highly efficient at getting DNA into cells can infect both replicating and differentiating cells. Attractive as gene-therapy vectors Since they do not integrate into the host genome, they cannot bring about mutagenic effects caused by random integration events • • • Disadvantages Only transient expression is possible These vectors are based on an extremely common human pathogen and in vivo delivery may be hampered by prior host immune response to one type of virus.
  • 2. Adeno-associated virus vectors • • • First discovered as a contaminant in an adenoviral isolate (Atchison et al. 1965) a small ssDNA virus with ~5kb genome A member of the parvovirus family The genome comprises aacentral region The genome comprises central region containing rep (replicase) and containing rep (replicase) and cap (capsid) genes flanked by 145-b cap (capsid) genes flanked by 145-b inverted terminal repeats inverted terminal repeats
  • AAVs are Naturally replication defective In the presence of helpers Replicates lytically and produces thousands of progeny virions In the absence of helpers AAV DNA integrates into the host cell’s genome & remains as a latent provirus The dependence of AAV on a heterologous The dependence of AAV on a heterologous helper virus (adenovirus or herpes virus) helper virus (adenovirus or herpes virus) provides an unusual degree of control over provides an unusual degree of control over vector replication vector replication
  • • First AAV vectors; – cap region replaced with transgene – Expression from an endogenous AAV or a heterologous promoter – Rep protein interference causes inefficient transgene expression and cytotoxic effects • Subsequently vectors were developed with; – deletions of both rep & cap regions – Expression from an endogenous AAV or a heterologous promoter From such experiments, it was demonstrated From such experiments, it was demonstrated that the repeats are the only elements required for that the repeats are the only elements required for replication, transcription, proviral integration, and replication, transcription, proviral integration, and rescue. rescue. All current AAV vectors are based on this principle All current AAV vectors are based on this principle In vitro manipulation of AAV facilitated by cloning the inverted terminal repeats in a plasmid vector and inserting the transgene between them.
  • • Advantages – Proviral Integration increases the persistence of transgene expression – Also, site specificity of proviral integration theoretically limits the chances of insertional mutagenesis. – Wide host range
  • 3. Retroviruses Retroviruses are RNA viruses that replicate via a dsDNA intermediate Structure of an integrated provirus, with long terminal repeats (LTRs) comprising three regions U3, R, and U5, enclosing the three open reading frames gag, pol, and env. Structure of a packaged RNA genome, which lacks the LTR structure and possesses a poly(A) tail Generic map of an oncoretrovirus genome
  • Infection cycle  Virus envelope interacts with the host-cell’s plasma membrane, delivering the particle into the cell  The RNA genome is reverse transcribed to produce a cDNA copy  The terminal regions of the RNA genome are duplicated in the DNA as long terminal repeats (LTRs)  The DNA intermediate then integrates into the genome at an essentially random site  The integrated provirus has three genes (gag, pol, and env)  Viral genomic RNA is synthesized by transcription from a single promoter located in the left LTR and ends at a polyadenylation site in the right LTR. Thus, the fulllength genomic RNA is shorter than the integrated DNA copy and lacks the duplicated LTR structure.  The genomic RNA is capped and polyadenylated, allowing the gag gene to be translated  Some of the full-length RNA also undergoes splicing, eliminating the gag and pol genes and allowing the downstream env gene to be translated.  Two copies of the full-length RNA genome are incorporated into each capsid, which requires a specific cis-acting packaging site termed ψ.  The reverse transcriptase/ integrase is also packaged.
  • Why Retroviruses used as vectors?? • • • • • Most retroviruses do not kill the host, but produce progeny virions over an indefinite period. Therefore, can be used to make stably transformed cell lines Viral gene expression is driven by strong promoters, which can be subverted to control the expression of transgenes Some retroviruses have a broad host range allowing the transduction of many cell types Retroviruses make efficient and convenient vectors for gene transfer because the genome is small enough for DNA copies to be manipulated in vitro in plasmid-cloning vectors The vectors can be propagated to high titers (up to 108 plaque-forming units per ml), and the efficiency of infection in vitro can approach 100%.
  • The major disadvantage of oncoretroviral vectors is that they only productively infect dividing cells, which limits their use for gene-therapy applications
  • Retroviral vectors • Mostly ‘replication-defective’ • Vectors consist of only the cis-acting sites required for replication and packaging: – These include the LTRs (necessary for transcription, polyadenylation as well as integration), the packaging site ψ and ‘primer-binding sites’ which are used during the complex replication process • Deleted vectors can be propagated only in the presence of a replication-competent helper virus or a packaging cell line • The simplest cloning strategy involves deletion of all coding sequences and placing the foreign gene between the LTR promoter and the viral polyadenylation site
  • • Heterologous promoters can also be used; however LTR promoters may interfere. – Therefore, Self-inactivating vectors have been devised; wherein deletions in the 3’ LTR when copied to the 5 ′ LTR during vector replication renders the LTR promoter inactive • Since the viral replication cycle involves transcription and splicing, an important consideration for vector design is that the foreign DNA must not contain sequences that interfere with these processes • Since retroviral vectors are used for the production of stably transformed cell lines, it is necessary to co-introduce a selectable marker gene along with the transgene of interest.
  • 4. The alphaviruses: Sindbis virus & Semliki forest virus vectors • Single strand positive-sense RNA genome • Integration into the host genome is guaranteed never to occur • Alphavirus replication takes place in the cytoplasm, and produces a large numbers of daughter genomes, allowing very high-level expression of any transgene • Display broad host range • The wild-type alphavirus comprises two genes; – 5′ gene encoding viral replicase, – 3′ gene encoding a polyprotein from which the capsid is derived
  • • Insertion vectors have been constructed; – – – – replication-competent Additional sub-genomic promoter present either upstream or downstream of the capsid polyhedrin gene If foreign DNA is introduced downstream of this promoter, the replicase protein produces two distinct subgenomic RNAs, one corresponding to the transgene. Unstable • Replacement vectors • Capsid polyhedrin replaced with transgene • Both plasmid replicon and viral transduction vectors have been developed from the alphavirus genome.
  • 5. Pox viral vectors • • • • • • Pox viruses such as vaccinia, have a very large dsDNA genome (~300kb) and can accommodate large inserts of upto 35kb The poxviruses replicate in the cytoplasm of the infected cell No helper virus is required for propagation Thus, the virus must encode and package all its own DNA replication and transcription machinery & recombinant genomes introduced into cells by transfection are non-infectious Transgene expression usually needs to be driven by an endogenous vaccinia promoter, since transcription relies on proteins supplied by the virus Since the cytoplasm lacks any transcription & nuclear splicing apparatus, vaccinia vectors cannot be used to express genes with introns
  • • Recombinant viruses are generated by homologous recombination, using a targeting plasmid transfected into virus-infected cells • Direct ligation vectors have also been developed, and these are transfected into cells containing a helper virus to supply replication and transcription enzymes in trans A variety of foreign genes have been cloned in vaccinia including HTLVIII envelope protein, hepatitis B virus surface antigen, influenza virus, hemaglutinin, rabies virus glycoprotein etc.
  • 6. Herpesvirus Vectors • • • • • • • The herpesviruses are large dsDNA viruses; Epstein–Barr virus (EBV) and the herpes simplex viruses (HSV-I, varicella zoster) Most herpes simplex viruses are transmitted without symptoms (varicella zoster virus is exceptional), and cause prolonged infections Unlike EBV, which is used as a replicon vector, HSV-I has been developed as a transduction vector HSV vectors are particularly suitable for gene therapy in the nervous system because the virus is remarkably neurotropic Recombinants can be generated in transfected cells by homologous recombination, and such vectors may be replication-competent or helperdependent Generally, transgene expression is transient, although prolonged expression has been observed in some neuronal populations
  • 7. Baculovirus vectors • • • • Rod shaped capsids & large dsDNA genome Productively infect arthropods, particularly insects Used mainly for high-level transient protein expression in insects and insect cells The nuclear polyhedrosis virus group, has an unusual infection cycle that involves the production of nuclear occlusion bodies. POLYHEDRIN GENE REPLACEMENT VECTORS POLYHEDRIN GENE REPLACEMENT VECTORS The nuclear occlusion stage of the infection cycle is non-essential for the The nuclear occlusion stage of the infection cycle is non-essential for the productive infection of cell lines, thus the polyhedrin gene can be productive infection of cell lines, thus the polyhedrin gene can be replaced with foreign DNA, which can be expressed at high levels under replaced with foreign DNA, which can be expressed at high levels under the control of the endogenous polyhedrin promoter. the control of the endogenous polyhedrin promoter. The polyhedrin upstream promoter and 5′ untranslated region are important for high-level foreign gene expression and these are included in all polyhedrin replacement vectors
  • • Two baculoviruses have been extensively developed as vectors – the Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) • used for protein expression in insect cell lines, particularly those derived from Spodoptera frugiperda (e.g. Sf9, Sf21) – the Bombyx mori nuclear polyhedrosis virus (BmNPV) • infects the silkworm, and has been used for the production of recombinant protein in live silkworm larvae • Replacement of the polyhedrin gene also provides a convenient method to detect recombinant viruses – The occlusion bodies produced by wild-type viruses cause the microscopic viral plaques to appear opalescent if viewed under an oblique light source (OB+), while recombinant plaques appear clear (OB–) • many current baculovirus expression systems employ lacZ as a screenable marker to identify recombinants
  • USE IN MAMMALIAN SYSTEM USE IN MAMMALIAN SYSTEM One limitation of this expression system is that the glycosylation One limitation of this expression system is that the glycosylation pathway in insects differs from that in mammals, so recombinant pathway in insects differs from that in mammals, so recombinant mammalian proteins may be incorrectly glycosylated and hence mammalian proteins may be incorrectly glycosylated and hence immunogenic immunogenic  Using insect cell lines chosen specifically for their ability to carry out mammalian-type post-translational modifications, e.g. those derived from Estigmene acrea  Expressing appropriate glycosylation enzymes along with the transgene of interest
  • Construction of baculovirus expression vectors • Inserting the transgene downstream of the polyhedrin promoter • achieved by homologous recombination using a plasmid vector carrying a baculovirus homology region • The proportion of recombinants has been increased by using linear derivatives of the wild-type baculovirus genome containing large deletions, which can be repaired only by homologous recombination with the targeting vector.
  • ‘Plasmids with viral replicons’ Replicon vectors contain origins of replication derived from certain viruses i) SV40 vectors • • • The first mammalian cell viral vector to be developed (Hamer and Leader, 1979) Circular dsDNA tumor virus; genome: ~5kb in size The genome has two transcription units • During the first stage of the SV40 infection cycle, the early transcript produces two proteins, known as the large T and small t tumor antigens • T Antigen: binds to the viral origin of replication and is absolutely required for genome replication; also acts as an oncoprotein All vectors based on SV40 must therefore be supplied with functional All vectors based on SV40 must therefore be supplied with functional T antigen, or they cannot replicate, even in permissive cells T antigen, or they cannot replicate, even in permissive cells
  • • • • • • These viruses cause lytic infections, i.e. the viral genome replicates to a very high copy number The first SV40 viral vectors involved replacement of either ‘early’ or ‘late’ regions functions of the replaced region had to be provided in trans initially by a cointroduced helper virus Development of the COS cell line, containing an integrated partial copy of the SV40 genome, simplified the use of replacement vectors The integrated fragment included the entire T-antigen coding sequence and provided this protein in trans to any SV40 recombinant in which the early region had been replaced with foreign DNA The major problem with these initial SV40 vectors The major problem with these initial SV40 vectors was that the capacity of the viral capsid allowed a was that the capacity of the viral capsid allowed a maximum of only about 2.5 kb of foreign DNA to be maximum of only about 2.5 kb of foreign DNA to be incorporated. incorporated.
  • Plasmids carrying the SV40 origin of replication became a major breakthrough • • • • • In general, these vectors consisted of a small SV40 DNA fragment (containing the origin of replication) cloned in an E. coli plasmid vector Such plasmids behaved in the same way as virus itself i.e. replicating to a high copy number in permissive monkey cells Since these SV40 replicons were not packaged into viral capsids, there were no size constraints on the foreign DNA Some vectors also contained a T-antigen coding region and could be used in any permissive cell line, while others contained the origin alone and could only replicate in COS cells Permanent cell lines are not established when SV40 replicons are transfected into COS cells because the massive vector replication eventually causes cell death
  • • Recombinant SV40 vectors (rSV40) are good candidates for gene transfer, as they display some unique features – Non-replicative vectors are easy-to make, – can be produced in titers of 1012 IU/ml. – They also efficiently transduce both resting and dividing cells, – deliver persistent transgene expression to a wide range of cell types, – Non-immunogenic • Present disadvantages of rSV40 vectors for gene therapy are a small cloning capacity and the possible risks related to random integration of the viral genome into the host genome
  • ii) BK and BPV replicons • • Designed to facilitate episomal replication These vectors were based upon viruses which cause latent infections (where the viral genome is maintained as a low to moderate copy-number replicon that does not interfere with host-cell growth) • • Plasmids that contain such latent origins behave in a similar manner to the parental virus, except they are not packaged in a viral capsid Advantages: – DNA does not need to integrate in order to be stably maintained – These episomal vectors are not subject to ‘position effects’ The human BK polyomavirus infects many cell types and is maintained with a copy number of about 500 genomes per cell Plasmid vectors containing the BK origin replicate in the same manner as the virus when the BK T-antigen is provided in trans. BKV-derived vector
  • The first virus to be developed as an episomal replicon Bovine papillomavirus (BPV) • BPV has been exploited as a stable expression vector because: – it can infect mouse cells without yielding progeny virions. – Instead, the viral genome is maintained as an episomal replicon, with a copy number of about 100 • Early part of the replication cycle involves production of T antigen for – viral replication – oncogenic transformation of the host cell The early functions of BPV are carried on a 5.5-kb section of the genome, which is called the 69% transforming fragment (BPV69T) This was cloned in the E. coli plasmid pBR322, and was shown to be sufficient to establish and maintain episomal replication, as well as induce cell proliferation BPV-1-derived vector
  • iii) Epstein–Barr virus (EBV) Replicons • • • • Replicate very stably in mammalian cells and facilitate long-term transgene stability Large dsDNA genome ~170kb EBV predominantly infects primate and canine cells; also infects B cells in humans Only two relatively small regions of the genome are required for episomal maintenance – The latent origin (oriP); – a gene encoding a transacting regulator called Epstein Barr nuclear antigen 1 (EBNA1) These sequences have formed the basis of a series of latent EBV-based plasmid expression vectors, which are maintained at a copy number of 2–50 copies per cell
  • The first EBV vectors comprised the oriP element cloned in a bacterial plasmid, and could replicate only if EBNA1 was supplied in trans • • • • Some examples pBamC: a shuttle vector; comprising oriP, a bacterial origin, and ampicillin resistance gene derived from pBR322, and the neomycin phosphotransferase marker for selection in animal cells pHEBO: a derivative of pBamC; contained a hygromycin resistance marker instead of neo P201: construct derived by adding the EBNA-1 gene to pHEBO; it could replicate independently EBV-derived vector
  • Unlike BPV replicons; replication in EBV replicons is limited to Unlike BPV replicons; replication in EBV replicons is limited to once per cell cycle. This, together with the large genome size, once per cell cycle. This, together with the large genome size, allows EBV-derived vectors to carry large DNA fragments, allows EBV-derived vectors to carry large DNA fragments, including mammalian cDNAs and genes including mammalian cDNAs and genes EBV replicons have been used to express aawide range of proteins EBV replicons have been used to express wide range of proteins in mammalian cell lines, in mammalian cell lines, including the epidermal growth factor receptor; including the epidermal growth factor receptor; the tumor necrosis factor receptor; and Na/K ATPase the tumor necrosis factor receptor; and Na/K ATPase
  • Transcriptional & Translational Vectors • • • • • • The following considerations should apply when high-level expression is required The use of a strong and constitutive promoter The inclusion of an intron The inclusion of a polyadenylation signal The removal of unnecessary untranslated sequence Optimization of the transgene for translational efficiency The incorporation of a targeting signal
  • Cloned gene Prepare RNA transcripts/probes Purify gene products (proteins) Translational vectors Transcriptiona l vectors What are the essential What are the essential elements such a expression elements such a expression vector must possess?? vector must possess??
  • Goals To obtain as much as possible /good expression + good cell growth soluble folded protein /reduced aggregation in a form that is easy to purify /use of secretion and tags Common problem: High expression = danger of aggregation, decreased cell growth/cell toxicity
  • Genetic Elements Essential for Expression
  • Types of Expression Vectors
  • Prokaryotic expression systems • Advantages – Fast growth – Cheap medium and equipment for growing – Good knowledge of the host • Disadvantages – Limitations for expression of eukaryotic proteins – Codon usage: different frequencies with which the different codons appear in genes of these organisms E.g. CGT, CGC, CGG, AGG, AGA, CGA code for arginine, but the last 3 (AGG, AGA, CGA) are rarely used in E. coli and it has low amounts of respective tRNAs – differences in post-translational modifications (SS bonds, glycosylation etc)
  • Genetic Elements Essential for Expression
  • • Target gene under control of its own promoter • Host promoters / vector specific promoters • • • • • Optimised for binding to host (E.coli) RNA Pol Regulation of expression is much easier Basic requirements of a bacterial promoter: • Mostly require sigma factor 70 • RNA Pol must bind at the consensus sequences present at the -10 and -35 regions • Distance between -10 & -35 regions : also decides the strength of promoter. In all the cases examined the promoter was weaker when the spacing was increased or decreased from 17bp • Upstream elements: increase transcription by interacting with alpha subunit of RNA Pol Most frequently used: Plac, Ptrc (Ptac), PBAD Promoters from phages T7, T3, SP6, T5, PL Highly efficient and specific expression Promoter should be strong and controllable!! Promoter should be strong and controllable!!
  • Most of the prokaryotic expression vectors contain one of the following controllable promoters… • Ptrc (tac) or BAD • λ PL • T7
  • Ptrc/tac • • • • Hybrid promoters Stronger than parental promoters Inducible by lactose & IPTG Vectors also possess lacO operator and lacI gene for repressor Level of expression (inductor) Key features Plac Low to medium level (IPTG) •Weak, •regulated •Suitable for expression of gene products at very low intracellular level •Comparatively expensive induction Hybrid promoters Ptac/Ptrc (trp-lac) Moderately high (IPTG) •Strong but lower than T7 system •Regulated expression possible •Comparatively expensive induction
  • λ PL • Tight transcriptional control with high levels of gene expression • Trp -> cI gene (cI repressor)-> PL promoter-> cloned gene
  • pBAD promoters • • • • • Promoter of the araBAD operon Extremely tight control similar to PL araC : transcriptional regulator also present CAP and cAMP also activate the araC binding to I1 and I2 Glucose: catabolite repression
  • Phage T7 promoter pET family of expression vectors • • • E. coli strain carrying T7 gene 1 cloned downstream of the lac promoter, in the chromosome Plasmid construct with T7 LysS gene pET vector carrying T7 promoter+ lacO+ cloned gene
  • Genetic Elements Essential for Expression
  • Ribosome Binding Site (RBS) or Shine-Dalgarno (S/D) sequence RBS RBS 5-10 n START GAAGGAATTCAGGAGCCCTTCACCATG ... ... • START codons: E. coli uses 77% ATG (AUG), 14% GTG (GUG), 8% TTG (UUG) and a few others • STOP codons: TAG (UAG), TGA (UGA), TAA (UAA) Codon bias even extends to stop codons: UAA favored in genes expressed at high levels • The start codon if already present in the vector then it must be in frame with the cloned gene
  • Genetic Elements Essential for Expression
  • • Prokaryotes may involve factor-dependent and factorindependent transcription termination • Factor-independent terminators – Easy to recognise; have similar sequences: an inverted repeat followed by a string of A residues • Factor-dependent terminators – have very little sequence in common with each other – termination involves interaction with one of the three known E. coli termination factors, Rho (ρ), Tau (τ), and NusA Most expression vectors incorporate a factor-independent Most expression vectors incorporate a factor-independent termination sequence downstream from the site of termination sequence downstream from the site of insertion of the cloned gene. insertion of the cloned gene.
  • Insertion into Transcriptional Vectors
  • Specialist transcriptional vectors have been developed that facilitate the production of RNA probes and interfering RNA
  • Method for preparing RNA probes from a cloned DNA molecule using phage SP6 promoter and SP6 RNA polymerase. * No transcription terminator is required because the RNA polymerase will fall off the end of the linearized plasmid.
  • To prepare RNA probes corresponding to both strands of the insert • Either prepare two different clones corresponding to the two orientations of the insert • Or use a cloning vector in which the insert is placed between two different, opposing phage promoters (e.g. T7/T3 or T7/SP6) flanking a MCS • A further improvement has been introduced by Evans et al. (1995) in their LITMUS vectors – Polylinker regions flanked by two modified T7 RNA polymerase promoters – Unique restriction site (SpeI or AflII) engineered into the T7 promoter consensus sequences such that cleavage with the corresponding endonuclease inactivates that promoter – Selective unidirectional transcription is achieved by simply inactivating the other promoter by digestion with SpeI or AflII prior to in vitro transcription
  • To make dsRNA: If the single stranded templates thus generated, are mixed and used for in vitro transcription then double-stranded RNA will be produced
  • Insertion into Translational Vectors
  • Cloning Using Restriction Enzymes NcoI HindIII
  • Prokaryotic expression vectors
  • E. Coli Expression vectors: The pTrcHis vectors • pBR322-derived • three different versions pTrcHis A, pTrcHis B pTrcHis C that differ only in the spacing between the sequences that code for the N-terminal peptide and the MCS • For proper expression, first determine which restriction site is appropriate for ligation and then which vector will preserve the reading frame between the 5΄ sequences and the insert when ligated into that site
  • E. Coli Expression vectors: The pQE-30 series
  • E. Coli Expression vectors: The pET series The most powerful system yet developed for the cloning and expression of recombinant proteins in E. coli.
  • pBAD-TOPO based Vectors
  • pRSET vectors: pUC-derived expression vectors for high-level expression of recombinant proteins in E. coli
  • Problems with the production of Recombinant protein in E. Coli These problems can usually be solved, although the necessary manipulations may be time-consuming and costly!!!
  • Problems caused by E. coli • • • Correct processing and folding of recombinant protein Unable to synthesize the disulphide bonds present in many animal proteins E. coli might degrade the recombinant protein These problems are less easy to solve than the sequence related problems But the main problem is the absence of glycosylation But the main problem is the absence of glycosylation So far this has proved insurmountable, limiting E. coli to the So far this has proved insurmountable, limiting E. coli to the synthesis of animal proteins that do not need to be processed synthesis of animal proteins that do not need to be processed in this way. in this way.
  • The Eukaryotic expression systems: Production of recombinant proteins by eukaryotic cells • Yeast - Saccharomyces cerevisiae (baker’s yeast) - Pichia pastoris • Insect Cells – Baculovirus • Mammalian Cells
  • Expression in S.cerevisiae Autonomous replicating systems: YEps; YRps; YCps YEps can replicate as an independent plasmid, but integration into one of the yeast chromosomes can also occur Yeast replicative plasmids (YRps) Yeast centromere plasmids (YCps)
  • Expression in S. cerevisiae Integrative systems Yeast integrative plasmids (YIps) are basically bacterial plasmids carrying a yeast gene •An example is YIp5, which is pBR322 with an inserted URA3 gene •cannot replicate as a plasmid; survives only through integration YIp
  • Three factors come into play when deciding which type of yeast vector is most suitable for a particular experiment • Transformation frequency (YEps ≈ YRps > YIps) • Copy number(YRps>YEps>YIps) • Stability of recombinants – YIp: loss of a YIp that has become integrated into a chromosome occurs at only a very low frequency – YRp recombinants are extremely unstable, the plasmids tending to congregate in the mother cell when a daughter cell buds off – YEp recombinants suffer from similar problems as YRp A YIp is the vector of choice if the experiment requires the recombinant yeast cells to retain the cloned gene for long periods in culture Efficient integrative vectors are now available for aanumber of species, including Efficient integrative vectors are now available for number of species, including yeasts such as Pichia pastoris and Kluveromyces lactis, and the filamentous fungi yeasts such as Pichia pastoris and Kluveromyces lactis, and the filamentous fungi such as Aspergillus nidulans and Neurospora crassa such as Aspergillus nidulans and Neurospora crassa
  • Expression in Saccharomyces cerevisiae
  • S. cerevisiae as the host for recombinant protein synthesis • • • • • Promoters : mostly GAL promoter Most yeast expression vectors also carry a termination sequence from an S. cerevisiae gene, because animal termination signals do not work effectively in yeast Yields of recombinant protein are relatively high “Hyperglycosylated” proteins S. cerevisiae also lacks an efficient system for secreting proteins into the growth medium Other yeasts and fungi • • • • • Pichia pastoris, glycosylation abilities are very similar to those of animal cells Expression vectors for P. pastoris make use of the alcohol oxidase (AOX) promoter The two most popular filamentous fungi are Aspergillus nidulans and Trichoderma reesei The advantages of these organisms are their good glycosylation & secretion properties Expression vectors for A. nidulans usually carry the glucoamylase promoter; those for T. reesei make use of the cellobiohydrolase promoter
  • Four promoters frequently used in expression vectors for microbial eukaryotes
  • Yeast promoters are more complex than bacterial promoters positivecontrol proteins negative -control proteins The level of transcription can also be affected by sequences located within the gene itself and which are referred to as downstream activating sequences (DASs)
  • • Why P. pastoris system ?? – alcohol oxidase (AOX1) promoter is one of the strongest and most regulatable promoters known – it is possible to stably integrate expression plasmids at specific sites in the genome in either single or multiple copies – the strains can be cultivated to very high density
  • Two specialized vectors for use in Saccharomyces (YES vectors) and Pichia (pPICZ) *The YES vectors offer a choice of 2 μm origin for high copy or CEN6/ARSH4 origin for low copy in yeast In pPICZ vectors, the zeocin-resistance gene is driven by the EM-7 promoter for selection in E. coli and the TEF1 promoter for selection in Pichia
  • Construct design for high-level transgene expression in animal cells 1. The use of a strong and constitutive promoter • In viral vectors, transgenes are often expressed under the control of the strongest endogenous promoters • The elements most commonly used in mammalian cells are the SV40 early promoter and enhancer, the Rous sarcoma virus long-terminal-repeat promoter and enhancer and the human cytomegalovirus immediate early promoter 2. The inclusion of an intron • usually enhances expression • most mammalian expression vectors in current use incorporate a heterologous intron, such as the SV40 small t-antigen intron or the human growth-hormone intron • Introns may not be used in some expression systems, such as vaccinia virus
  • 3. The inclusion of a polyadenylation signal • to generate a defined 3′ end to the mRNA • In most cases, this defined end is extended by the addition of several hundred adenosine residues to generate a poly(A) (polyadenylate) tail • Required for the export of mRNA into the cytoplasm, and also increases its stability • Poly(A) sites from the SV40 early transcription unit or mouse beta-globin gene are often incorporated into mammalian expression vectors 4. The removal of unnecessary untranslated sequence • Both the 5′ and 3′ UTRs can influence gene expression in a number of ways – For example, the 5′ UTR may contain one or more AUG codons upstream of the authentic translational start site, and these are often detrimental to translational initiation – The 3′ UTR may contain regulatory elements that control mRNA stability • • both the UTRs may be rich in secondary structure, which prevents efficient translation These are generally removed from transgene constructs to maximize expression
  • 5. Optimization of the transgene for translational efficiency • The sequence around the translational initiation site should conform to Kozak’s consensus, which is defined as 5′-CCRCCAUGG-3′ • The expression of foreign genes in animals can also be inefficient in some cases due to suboptimal codon choice • translation may pause at rare codons due to the scarcity of the corresponding transfer RNA (tRNA) • It may therefore be beneficial to “codon-optimize” transgenes for the expression host 6. The incorporation of a targeting signal • Since specific types of modification occur in particular cell compartments, it is necessary to consider strategies for targeting the recombinant protein to the correct compartment to ensure that it is appropriately modified • Many mammalian expression vectors are available for this purpose, and they incorporate heterologous signal peptides
  • The Invitrogen vector pSecTag2 Incorporates a sequence encoding the murine immunoglobulin light chain signal peptide for high-efficiency targeting to the secretory pathway
  • The SV40 origin for high-level expression in COS cells, a neo selection cassette, ColE1 and f1 origins for manipulation in bacteria, and an expression cassette driven by the human cytomegalovirus promoter two epitope tags to facilitate protein purification an EK site to remove the epitope tags after purification
  • Using animal cells for recombinant protein production • Mammalian cells – Most widely used hosts for gene delivery, – Allow the production of recombinant human proteins with authentic post-translational modifications that are not carried out by bacteria, yeast, or plants – Promoters most frequently used are from viruses such as SV40 (p. 123), cytomegalovirus (CMV), or Rous sarcoma virus (RSV) – Mammalian cell lines derived from humans or hamsters have been used in synthesis of several recombinant proteins; these can be transient or stable – expensive approach – Possible co-purification of viruses may render the product unsafe
  • • Insect cells • • • provide an alternative to mammalian cells for animal protein production High yields of recombinant protein can be obtained The expression system is based on the baculoviruses • To overcome the problem of glycosylation, BacMam vectors have been devised a modified baculovirus that carries a mammalian promoter to express genes directly in mammalian cells Hence, expression is accompanied by the mammalian cell’s own posttranslational processing activities, so the recombinant protein is correctly glycosylated and therefore should be fully active • •
  • Plant based vector systems Reference: Plant Transformation Technologies Edited by C. Neal Stewart, Alisher Touraev, Vitaly Citovsky and Tzvi Tzfira © 2011 Blackwell Publishing Ltd.
  • Schematic comparison between an intermediate vector method and a binary vector method
  • • Although the cointegrate method worked with a reasonably high efficiency, one limitation was that the cointegrate plasmid was larger than 150 kb, which made it complicated to confirm the genetic structure of the plasmid • To increase the plasmid stability during a long co-cultivation period of A. tumefaciens with the target host plant tissues • To understand the molecular mechanism of broad host-range replication, and to use it to reduce the size of plasmid for ease in cloning and for higher plasmid yield in E. Coli
  • Commonly Used Binary Vectors The progress in DNA technology has made it possible to design binary vectors in a more sophisticated fashion!!
  • • A series of pPZP vectors provide many user-friendly features such as, – a wide selection of cloning sites – high copy number in E. coli for a high plasmid yield owing to the employment of the ColE1 replication origin from pBR322, – high stability in A. tumefaciens • The pCAMBIA series (www.cambia.org) was later created from the pPZP vectors • The pPZP and pCAMBIA series are widely used together with the other classic vectors
  • Basic structure of binary vectors
  • • Because the transfer intermediate of the T-DNA is created in the direction from the RB to the LB, placing a selectable marker gene for plants adjacent to the LB is generally preferred for the complete introduction of the T-DNA into plants • It is an important issue to choose an adequate plant selectable marker gene in a particular study – affects the efficiency of the transformation experiment – restrictive or permissive concentrations of selective agents vary considerably among plant species • kanamycin: dicots; Hygromycin: rice; Phosphoinothricin: maize – Usually driven by constitutive promoters – CaMV35S, nos: dicots – Ubi of maize; Act of rice: monocots • Selectable marker genes are followed by a DNA fragment, the so-called 3’ signal
  • • Genes for β-glucuronidase (gusA or uidA), green fluorescent protein (gfp), and luciferase (luc) are widely used as reporter genes – Analysing Expression profiles & Subcellular localisation of their fused protein pair • Expression of such reporter genes immediately after the inoculation of plant cells with A. tumefaciens, which is referred to as “transient expression,” indicates transfer of the T-DNA into the nuclei of plant cells • The later expression in a cluster of cells growing on selection media provides evidence of transgene integration
  • • • • • Binary vectors need to replicate in both E. coli and A. tumefaciens Either a broad host range replication function is used or two replication functions, one for E. coli and the other for A. tumefaciens, can be combined Broad host range Replication functions of the plasmid incompatibility group P (IncP) or W (IncW) are frequently used in binary vectors In the binary vector system, there are two important considerations in compatibility and utility of selectable marker genes: – Whether the bacterial strain has any intrinsic antibiotic resistance – Secondly, the ampicillin-resistance gene in binary vectors should be avoided because penicillin-based antibiotics (e.g., carbenicillin), which are detoxified by the product of the ampicillin-resistance gene, are used to remove residual A. tumefaciens from plant cells after cocultivation • The introduction of binary vectors into A. tumefaciens can be achieved by three methods: – triparental mating, electroporation and freeze thaw – If the triparental mating method is used, binary vectors need to carry a specific sequence for mobility
  • Advanced features • Introduction of sites for rare cutters: Such sites are rarely present in the conventional vector backbones and fragments to be inserted • Gateway® system (Invitrogen) based cloning system being used • Strategies for efficient transformation have been devised – E.g. The Superbinary vector system : these carry additional virulence genes to enhance the efficiency • BIBAC & TAC vectors: able to transfer large fragments to higher plants • Removal or Suppression of Transfer of Unnecessary DNA – Cotransformation with two separate T-DNAs – Site-specific recombinases • Control of integration sites
  • Diagram of construction of superbinary vectors. Because the total size of the vector components is relatively large in the superbinary system, Therefore, cointegration of an intermediate vector, such as pSB11 and an acceptor vector, such as pSB1, via homologous recombination between the shared DNA segments in A. tumefaciens is employed during the final step of construction of a superbinary vector Unlike the intermediate vector system, however, the final product in the superbinary vector system is a plasmid that can be confirmed by routine restriction analysis of a miniscale DNA preparation from A. tumefaciens
  • pORE series of binary vectors
  • Purification Tags Tags can be a short peptide that specifically interacts with an immobilized antibody or metal ion, or larger binding domains that interact with specific immobilized ligands • To improve solubility and for affinity purification and hence roughly divided as ‘Purification’ & ‘Solubility’ tags • The term ‘‘fusion protein’’ is also often used instead of the term ‘tag’. • Multiple tags can be added together in different combinations • Tags can be fused to proteins for a broad range of applications— – labeling for imaging and localization studies, – protein detection and quantification, – protein–protein interaction studies, – subcellular localization or transduction etc. fusion sometimes refers to the simpler end-to-end joining of two proteins while tags are typically shorter and include linker regions
  • Some Considerations When Designing a Tagged Protein • • • • • Affinity and/or solubility? Which tag(s) to use? Tandem tags? N- or C-terminal? Cleavage sites to remove tags?
  • Affinity and/or solubility? • The basis of solubility tags: Attaching a highly translated native gene as a fusion on the Nterminal end of the heterologous target protein improves yield and has the added benefit of increasing the solubility of the target protein • The basis of Affinity tags: Crucial during protein purification and allow the use of a variety of strategies to bind the target protein on an affinity matrix *Some protein tags can function in both affinity and solubility roles
  • Which tag(s) to use? • Vary in size; varying metabolic load on cells • Also vary in the cost of purification • The choice between different affinity tags often depends on finding purification buffer conditions suitable for the target protein. For e.g. – For proteins susceptible to oxidation or proteolytic damage, the His-tag may not be very suitable since immobilized metal affinity chromatographic (IMAC) media cannot tolerate reducing agents or EDTA – Conversely, for target proteins requiring denaturing conditions or refolding, the His-tag and IMAC purification is an excellent choice • Expression levels can dictate the choice of tags in some cases; for e.g. – solubility tags have strong translational initiation signals and can drive expression levels higher – when low expression levels are desirable, such as when studying complexes or physiological interactions, more stringent epitope tags or tandem tagging may be more appropriate
  • Tandem tags? • Multiple tags can be attached on target proteins, allowing for improved purification, expression, or tracking • Solubility tags such as Trx or NusA can also be linked with affinity tags such as His-tags for efficient purification of the fusion protein • Affinity tags can also be attached at both ends of a target protein
  • N- or C-terminal? • Tags can be placed at either the N- or C-terminus of a target protein • N –terminal: – the construct can take advantage of efficient translation initiation sites on the tag – the tag can be removed more cleanly, since most endoproteases cut at or near the C-terminus of their recognition sites – Expression efficiency is more • Care should be taken to preserve the positioning of any signal sequences or modification sites Solubility tags based on highly expressing proteins such as MBP, Trx, are also more efficient at solubilizing target proteins when positioned at the N-terminal end
  • Cleavage of Tags • Tags can interfere with the structure and function of the target protein • Provision must be made to remove tags after the expression and purifications steps • Multiple cleavage sites can be engineered into the expression construct to remove individual tags at different stages of purification
  • Protein Affinity Tags • His-tag • GST tag • Epitope tags
  • The His-tag (6xHis-tag) One of the simplest and most widely used purification tags • SIZE: – Six or more consecutive histidine residues which readily coordinate with transition metal ions such as Ni2+ or Co2+ • BINDING CHEMISTRY/CONDITIONS OF BINDING: – Metal ions are immobilized using linkages on resins and beads (such as Ni(II)nitrilotriacetic acid (Ni-NTA) or Co+2-carboxymethyl-aspartate) – His-tags bind the immobilized metal via the histidine imidazole ring – Binding to IMAC (immobilized metal ion affinity chromatography) resins is stronger under denaturing conditions as the His-tag becomes more exposed • – – – ELUTION: elution buffers with imidazole (100–250 mM) or low pH (4.5–6) Care has to be taken to avoid EDTA (or EGTA) in any of the buffers TRIS salts weakly chelate metal ions as well, and the use of TRIS buffers should be minimized (50 mM or less) – Most IMAC media very sensitive to reducing agents such as DTT, low levels of beta-mercaptoethanol (<10 mM) should be used instead
  • • The small size of the His-tag minimizes interference with the folding and structure of the target protein • The His-tag can also be used with commercially available His-tagspecific antibodies for protein detection • The tag can be removed by introducing a protease cleavage site
  • GST tag • GST cloned from Schistosoma japonicum was shown to promote solubility and expression as an N-terminal fusion (Smith and Johnson, 1988) • SIZE: – an abundantly expressed 26 kDa eukaryotic protein • BINDING CHEMISTRY/CONDITIONS OF BINDING: – GST binds to resin immobilized glutathione – Resins: such as Glutathione-Sepharose beads, are relatively cheap, have high binding capacity and can be regenerated and reused multiple times – The GST tag has to be properly folded to bind glutathione, and thus the fusion protein needs to be soluble and in non-denaturing conditions for efficient purification – Unlike for His-tagged proteins, EDTA can be used in buffers during sample preparation to reduce proteolytic damage – Care should also be taken to use reducing conditions since GST has four solvent exposed cysteines that can be involved in oxidative aggregation
  • ELUTION: under rather mild conditions using free reduced glutathione (10–40 mM) at neutral pH
  • • Commercial anti-GST antibodies are also available for detecting • The kinetics of GST binding to glutathione and its elution are relatively slow, and so GST fusion proteins need to be loaded and eluted from GST columns at slow flow rates When positioned at the C-terminal end, GST is less efficient at improving protein solubility but still functions well as an affinity tag
  • Epitope tags • • • A number of short amino acid (aa) sequences, recognized by commercially available antibodies, can be used as tags for detection and purification of proteins Can also be placed within a target protein (in loops or between structural domains in a solvent exposed region) Advantage: – High specificity – Use of short tags minimizes deleterious effects on the structure and function of the target protein • • Epitope tags are usually sequences absent in the host cell, making the detection of the target protein straightforward Epitope tag binding media typically involves monoclonal antibodies immobilized on chromatographic resins; is expensive and less suitable for large-scale preparations than other affinity media
  • • Examples • The FLAG tag: short, eight-residue (DYKDDDDK) hydrophilic peptide tag that can be used for detection and purification of target proteins • The HA-tag : Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 • The c-Myc: A myc tag is a polypeptide protein tag derived from the c-myc gene product that allows one to follow the protein with an antibody against the Myc epitope • V5 epitope tag: Derived from a small epitope (Pk) present on the P and V proteins of the paramyxovirus of simian virus 5 (SV5) – The V5 tag is usually used with all 14 amino acids GKPIPNPLLGLDST), although it has also been used with a shorter 9 amino acid sequence (IPNPLLGLD)
  • Solubility Tags Several soluble proteins are used as tags to improve folding of the target protein; These act as passive partners in the folding of target proteins These tags should be used in conjunction with other approaches to improve protein folding such as lowering temperature after protein induction or coexpression of chaperones None of these tags work universally with every partner protein. Each solubility tag also has different effects, and several tags may need to be tried for recalcitrant proteins Studies have suggested that after removal of the tag solubility of aggregationprone target proteins appears to depend on the characteristics of the target protein rather than the tag used • • • MBP tag Trx tag Other solubility tags
  • Maltose Binding Protein Tag ranks as one of the best tags for making soluble fusions • MBP is a large 43 kDa secreted E. coli protein that can be expressed at very high levels, and helps keep proteins fused at its C-terminal end soluble • Can also be used for effective affinity purification, since it binds specifically to maltose or amylose • Cross-linked amylose resin is used to bind MBP tagged proteins, and the bound fusion protein can be easily eluted by adding 10 mM maltose to the wash buffers • However, amylose affinity purification cannot be carried out with reducing agents or under denaturing conditions • Amylose resins can be regenerated and reused several times.
  • Trx tag • Thioredoxin (Trx) is a thermostable, 12-kDa intracellular E. coli protein that is easily overexpressed • Soluble even when overexpressed up to 40% of the total cellular protein (LaVallie et al., 1993) • Very useful as a tag in avoiding inclusion body formation in recombinant protein production • Thioredoxin accumulates at cytoplasmic membrane adhesion sites, which allows Trx fusion proteins to be released by simple osmotic shock or freeze/thaw treatments, providing a simple initial purification step • Tests by Dyson et al. (2004) indicate that the Trx tag is more effective when placed on the N-terminal end of the target protein
  • Removal of Tags • It is often useful to remove it for biological and functional studies since the tag can potentially interfere with the proper functioning of the target protein • Most commercial expression vectors that are used to add tags on target proteins also include cleavage sites with specific sequences that allow the tag to be removed using recombinant endoproteases • After the initial affinity purification step, the sample can be treated with the endoprotease to cleave off the tag, which can subsequently be separated from the target protein by passing the sample back on the affinity column and collecting the flow through • The recombinant endoprotease usually also comes with an affinity tag, allowing for its easy removal after the cleavage reaction
  • • Complete removal of C-terminal tags is more problematic, since most endoproteases cut toward the C-terminal end of their recognition sequence • Specialized cleavage sites can also be designed that take advantage of structure-based recognition (such as with the SUMO protease; Malakhov et al., 2004) or an autocatalytic protein self-splicing element (Inteins; Saleh and Perler, 2006) • Both of these cleavage systems have been coupled with affinity purification tags— – the SUMO fusion system – Intein-chitin-binding domain – Intein-polyhydroxybutyrate-binding (PHB) • Tags can also be cleaved chemically – Cyanogen bromide (CNBr): cleaves at methionines – Hydroxylamine: cleaves the peptide bond between Asn and Gly
  • The IMPACT system (Intein Mediated Purification with an Affinity Chitin-binding Tag)
  • Some practical considerations during Tag removal… • Each construct has to be experimentally tested both for cleavage efficiency, and for any secondary cleavages that may occur when promiscuous proteases are used • Often, the level of the protease and the duration of incubation have to be optimized • Optimization esp. becomes essential in the case of oligomeric proteins, where tags have to be removed for each monomer for productive yields of the target protein • The cleavage sequence also has to be sterically accessible to the protease and relatively unstructured • poor cleavage can sometimes be alleviated by – introducing a spacer or linker between the recognition site and the target protein, – by using sequences around the cleavage site that are unlikely to form secondary structures