• Like
Βιολογία Κατεύθυνσης Γ λυκείου
Upcoming SlideShare
Loading in...5

Βιολογία Κατεύθυνσης Γ λυκείου

Uploaded on


  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
No Downloads


Total Views
On Slideshare
From Embeds
Number of Embeds



Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

    No notes for slide


  • 1. ΣΗΜΕΙΩΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΝΑΓΙΩΤΑ ΓΚΟΓΚΟΣΗ, ΒΙΟΛΟΓΟΣ ΕΚΠΑMSc Κλινικής Βιοχημείας και Μοριακής Διαγνωστικής 2009-2010 114 [Type the company address]
  • 2. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΕισαγωγή στη Βιολογία Η βιολογία είναι η επιστήμη που μελετά την ζωή, το πιο ενδιαφέρον και διαδεδομένοφαινόμενο του πλανήτη μας. Είναι επιστήμη αλματώδους εξέλιξης, της οποίας τα σύγχροναεπιτεύγματα ξαφνιάζουν. Τα σύγχρονα επιτεύγματα απασχολούν σχεδόν καθημερινά, τοραδιόφωνο τον τύπο και την τηλεόραση με την μοριακή βάση ποικίλων ασθενειών, το πρόβληματου υπερπληθυσμού, της ισορροπίας των οικοσυστημάτων, δημιουργώντας όμως ταυτόχροναπολλά ηθικά διλήμματα. Είναι φανερό ότι για να καταλαβαίνουμε αυτά που συμβαίνουν γύρω μας, για να έχουμεάποψη γι αυτά αλλά πάνω από όλα για να καταλαβαίνουμε τον ίδιο μας τον εαυτό πρέπει ναέχουμε βασικές γνώσεις Βιολογίας. Βέβαια ο σκοπός της διδασκαλίας της Βιολογίας στα σχολείαπρωταρχικά είναι να μάθουν οι μαθητές να χαίρονται την ζωή και την καθημερινότητά τους. Νασέβονται την ζωή σε όλα τα επίπεδα οργάνωσης της από το κύτταρο μέχρι το οικοσσύστημα. Νασέβονται το περιβάλλον, να αναγνωρίζουν την σημασία της ποικιλότητας στο φύλο το χρώμα τηνφυλή τα μορφολογικά χαρακτηριστικά τις απόψεις και να σέβονται την μοναδικότητα του κάθεενός. Έτσι, διαβάζοντας βιολογία αποκτάς την ικανότητα να παρατηρείς να συγκρίνεις (μόρια,κύτταρα, οικοσυστήματα, καταστάσεις) να τα ταξινομείς με βάση ορισμένα κριτήρια, ναδιατυπώνεις υποθέσεις να καταλήγεις σε συμπεράσματα. Διαβάζοντας βιολογία αποκτάς κριτικόκαι ερευνητικό πνεύμα (διερευνάς κάθε κατάσταση, παρατηρείς τα δεδομένα, τα αναλύεις καικαταλήγεις σε συμπέρασμα) μαθαίνεις να έχεις το θάρρος της γνώμης σου, να εργάζεσαι ομαδικά.Όταν αντιμετωπίζεις ένα πρόβλημα (πχ υγείας) στο οποίο από μόνος σου δεν μπορείς να δώσειςλύση η βιολογία σε μαθαίνει να απευθύνεσαι στους κατάλληλους φορείς (ιατρούς, νοσοκομεία) καινα συνεργάζεσαι μαζί τους παρουσιάζοντας τις σκέψεις και τους προβληματισμούς σουπροκειμένου να δοθεί λύση στο πρόβλημα. Η Βιολογία φέτος είναι το μάθημα στο οποίο εξετάζεσαι πανελλαδικά. Συνεπώς θαοργανώσουμε έτσι την προετοιμασία σου ώστε να έχεις το καλύτερο δυνατό αποτέλεσμα. Αυτάπου πρέπει να γνωρίζεις είναι ότι επειδή στο βιβλίο εξετάζεσαι, αρχικά θα διαβάζεις προσεκτικάτην θεωρία του βιβλίου. Καθώς θα διαβάζεις την θεωρία θα δίνεις ιδιαίτερη έμφαση στους όρους-λέξεις κλειδιά τους οποίους θα πρέπει να είσαι σε θέση να τους περιγράφεις ορθά αλλά και νατους χρησιμοποιείς στα κείμενά σου.Ξέρω βιολογία σημαίνει χρησιμοποιώ το κατάλληλο λεξιλόγιο.Καθώς θα αναλύουμε το μάθημα στην τάξη θα συγκρίνουμε μόρια ή διαδικασίες ή φαινόμεναβρίσκοντας ομοιότητες και διαφορές. Αυτά θα τα οργανώνουμε σε πινακάκια τα οποία θα πρέπεινα είσαι σε θέση να τα αναπαράγεις.Ξέρω βιολογία σημαίνει περιγράφω- συγκρίνω- ταξινομώ.Καθώς θα αναλύουμε τις διαδικασίες θα χρησιμοποιούμε χάρτες εννοιών. Στους χάρτες εννοιώνοι όροι- λέξεις κλειδιά συνδέονται μεταξύ τους ώστε να φαίνεται η λογική τους σχέση. Ο χάρτηςεννοιών δεν δείχνει μια στιγμιαία σκέψη αλλά είναι προϊόν μιας ολιστικής προσέγγισης τηςγνώσης. Οι χάρτες εννοιών ως εργαλείο μάθησης σε βοηθούν να καταλάβεις την αιτιολογία τωνφαινομένων και καταστάσεων, μειώνοντας έτσι την στείρα αποστήθιση. 206
  • 3. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΜΙΤΩΣΗ ΚΑΙ ΜΕΙΩΣΗ ΔΥΟ ΔΙΑΔΙΚΑΣΙΕΣ ΠΟΥ ΠΡΕΠΕΙ ΝΑ ΞΕΡΕΙΣ!ΜΙΤΩΣΗΗ μίτωση είναι ο τρόπος διαίρεσης ενός ευκαρυωτικού κυττάρου. (Οι προκαρυωτικοί οργανισμοί,δηλαδή τα βακτήρια ΔΕΝ διαιρούνται με την διαδικασία της μίτωσης)Με την διαδικασία της μίτωσης παράγονται δύο θυγατρικά κύτταρα τα οποία είναι πανομοιότυπαμεταξύ τους αλλά και με το αρχικό.Γενικά την ζωή του κυττάρου μπορούμε να την χωρίσουμε σε δυο μεγάλες φάσεις. Στην πρώτηφάση που λέγεται μεσόφαση, το κύτταρο ζει κάνει τον μεταβολισμό του, μεγαλώνει καιεπικοινωνεί με το περιβάλλον του. Στη φάση της μεσόφασης επιτελούνται οι διαδικασίες τηςμεταγραφής της μετάφρασης ενώ στο τέλος της μεσόφασης γίνεται και η αντιγραφή του γενετικούμας υλικού, του DNA. Στην δεύτερη φάση την μίτωση το κύτταρο διαιρείται. Στην αρχή τηςμίτωσης διασπάται η πυρηνική μεμβράνη και άρα το διπλασιασμένο πια DNA βρίσκεται στοκυτταρόπλασμα. Επειδή το DNA έχει διπλασιαστεί λέμε ότι διακρίνουμε δύο αδερφές χρωματίδεςενωμένες μεταξύ τους στο κεντρομερίδιο. Οι δυο αδερφές χρωματίδες που είναι ενωμένες στοκεντρομερίδιο αρχίζουν να συσπειρώνονται και τότε πια δομούν τα χρωμοσώματα. Ταχρωμοσώματα είναι στη μέγιστη συσπείρωση τους στη φάση της μετάφασης. Τότε είναι ορατά καιμε το οπτικό μικροσκόπιο. Στη φάση της μετάφασης τα χρωμοσώματα έχουν διαταχθεί στοκέντρο του κυττάρου το ένα κάτω από το άλλο με μεγάλη ακρίβεια. Αφού το κύτταρο σιγουρευτείότι έχει γίνει με μεγάλη ακρίβεια η ταξινόμιση των χρωμοσωμάτων περνάει στη φάση τηςανάφασης όπου και διαχωρίζονται μεταξύ τους οι αδερφές χρωματίδες και οδεύουν προς τα άκρατου κυττάρου. Στο τέλος της μίτωσης διαιρείται και το κυτταρόπλασμα του κυττάρου καιδημιουργούνται έτσι δυο θυγατρικά κύτταρα παρόμοια μεταξύ τους αλλά και με το μητρικό. 3
  • 4. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΜείωσηΜείωση είναι η διαδικασία παραγωγής γαμετών (ωάρια και σπερματοζωάρια) στουςευκαρυωτικούς διπλοειδείς οργανισμούς. Διπλοειδέις λέγονται οι οργανισμοί που έχουν από δύοφορές τα γονίδια τους. Έχουν δηλαδή ομόλογα χρωμοσώματα. Χρωμοσώματα ίδιου μεγέθους ίδιουσχήματος τα οποία φέρουν γονίδια αλληλόμορφα μεταξύ τους. Γονίδια που κωδικοποιούν για τηνίδια ιδιότητα αλλά πιθανά να την εκφράζουν με διαφορετικό τρόπο. Το ένα από τα δύο ομόλογαχρωμοσώματα είναι μητρικής και το άλλο πατρικής προέλευσης.Σε έναν διπλοειδή ευκαρυωτικό οργανισμό όλα τα κύτταρα διαιρούνται με μίτωση εκτός και ανπρόκειται να γίνουν γαμέτες οπότε ακολουθείται η διαδικασία της μείωσης.Στη μείωση διακρίνουμε την μείωση Ι και την μείωση ΙΙ.Πριν ξεκινήσει η διαδικασία της μείωσης το γενετικό υλικό διπλασιάζεται και έτσι διακρίνουμεαδερφές χρωματίδες ενωμένες μεταξύ τους στο κεντρομερίδιο.Στην διαδικασία της μείωσης Ι διαχωρίζονται μεταξύ τους τα ομόλογα χρωμοσώματα.Στην διαδικασία της μείωσης ΙΙ διαχωρίζονται μεταξύ τους οι αδερφές χρωματίδες.Τελικό προιόν της μείωσης είναι τέσσερα κύτταρα τα οποία έχουν μισή ποσότητα γενετικούυλικού από το μητρικό. 206
  • 5. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΚεφάλαιο:1Το γενετικό υλικό 3
  • 6. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΔιδακτικοί Στόχοι • Ν α αναφέρεις τα μακρομόρια που δομούν ένα κύτταρο • Να ορίζεις τις έννοιες (μαύρα γράμματα) και να τις διακρίνεις μεταξύ τους σε ερωτήσεις πολλαπλής επιλογής • Να διακρίνεις και να ταξινομείς τα αποτελέσματα των ερευνητών στα πειράματα προσδιορισμού της ταυτότητας του γενετικού υλικού • Να αναφέρεις ποια δεδομένα υπέδειξαν και ποια πειράματα απέδειξαν ότι το DNA είναι το γενετικό υλικό • Να συγκρίνεις τα χαρακτηριστικά του γενετικού υλικού σε προκαρυωτικούς (βακτήρια, πλασμίδια βακτηρίων) και ευκαρυωτικούς οργανισμούς (πυρήνας, μιτοχόνδρια, χλωροπλάστες) • Να αναφέρεις τα βιοφυσικά χαρακτηριστικά γενετικού υλικού • Να αναφέρεις τις λειτουργίες γενετικού υλικού • Να αναφέρεις τα επίπεδα οργάνωσης του γενετικού υλικού σε κάθε φάση του κυτταρικού κύκλου • Να μπορείς να επεξηγήσεις την χρησιμότητα της οργάνωσης του γενετικού υλικού. Να το συνδυάσεις με τα κεφάλαια 2 & 6. • Να περιγράφεις τα στάδια παρασκευής του καρυότυπου • Να λύνεις προβλήματα: προσανατολισμού αλυσίδων • Υπολογισμού φωσφωδιεστερικών δεσμών • Δεσμών υδρογόνου 206
  • 7. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΧρήσιμοι ορισμοίΓΟΝΙΔΊΩΜΑ : Το σύνολο του γενετικού υλικού ενός κυττάρου. Περιλαμβάνει κυρίως τογενετικό υλικό του πυρήνα αλλά και το γενετικό υλικό των μιτοχονδρίων και τωνχλωροπλαστών.ΑΠΛΟΕΙΔΈΣ ΚΎΤΤΑΡΟ : Το κύτταρο στο οποίο το γονιδίωμα βρίσκεται σε ένα αντίγραφο.ΑΠΟΙΚΊΑ: Σύνολο μικροοργανισμών που προέρχεται από διαδοχικές διαιρέσεις ενόςμικροοργανισμού. Οι αποικίες είναι ορατές με γυμνό οφθαλμό.Diplococcus pneumoniae: Το βακτηριακό στέλεχος που χρησιμοποίησε ο Griffith σταπειράματά του. Οι λείες αποικίες αποτελούνταν από κύτταρα με κάψα και ήτανπαθογόνες ενώ οι αδρές από κύτταρα χωρίς κάψα και δεν ήταν παθογόνες. Ομετασχηματισμός των αδρών αποικιών σε λείες γινόταν με μετασχηματισμό τωνβακτηρίων με πλασμίδιο ανθεκτικότητας.ΔΙΠΛΟΕΙΔΈΣ ΚΎΤΤΑΡΟ : Το κύτταρο στο οποίο το γονιδίωμα βρίσκεται σε δύο αντίγραφα .ΠΛΑΣΜΊΔΙΟ : Είναι δίκλωνο κυκλικό μόριο DNA που εμφανίζεται σε ορισμένα βακτήριαεκτός του κύριου βακτηριακού DNA . Ένα βακτήριο ενδέχεται να μην έχει κανέναπλασμίδιο, να έχει ένα πλασμίδιο που είναι και το σύνηθες, αλλά ενδέχεται να έχει καιπερισσότερα του ενός πλασμίδια. Το πλασμίδιο περιέχει το 1- 2% του γενετικού υλικούτου κύριου βακτηριακού μορίου DNA και αντιγράφεται ανεξάρτητα από αυτό .Ένα πλασμίδιο συνήθως έχει: • Μια περιοχή αντιγραφής του γενετικού υλικού • Μια θέση ενσωμάτωσης στο γενετικό υλικό του πυρήνα • Γονίδιο ανθεκτικότητας στα αντιβιοτικά • Γονίδιο που ευνοεί την μεταφορά από βακτήριο σε βακτήριο. 3
  • 8. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ • Γενικά τα πλασμίδια μεταφέρονται από βακτήριο σε βακτήριο και αποτελούν έναν από τους μηχανισμούς προσαρμογής του βακτηρίου. Το πλασμίδιο Τι μεταφέρεται από βακτήριο σε φυτικό κύτταρο.ΝΟΥΚΛΕΌΣΩΜΑ : Βασική μονάδα οργάνωσης της χρωματίνης . Μοιάζει σαν χάντρακομπολογιού. Αποτελείται από DNA μήκους 146 ζευγών βάσεων που περιελίσσεταιγύρω από ένα οκταμερές ΙΣΤΟΝΩΝ ( δύο μόρια από κάθε ιστόνη Η2Α ,Η2Β ,Η3 ,Η4 )Επίσης στο σφράγισμα του νουκλεοσώματος παίζει ρόλο η ιστόνη Η1 .Το νουκλεόσωμασυγκρατείται με δεσμούς μεταξύ ιστονών –DNA , οι οποίοι είναι ιοντικοί και υδρόφοβοι .ΚΑΡΥΌΤΥΠΟΣ: Η απεικόνιση των χρωμοσωμάτων ενός οργανισμού κατά σειράελαττούμενου μεγέθους .Ένας καρυότυπος μπορεί να μας δώσει τις εξής πληροφορίεςα) τον αριθμό των χρωμοσωμάτων του κυττάρου,β) αν πρόκειται για απλοειδές ή διπλοειδές κύτταρο,γ) αν υπάρχουν χρωμοσωμικές ανωμαλίες καιδ) το φύλο του ατόμου .ΜΙΤΟΧΟΝΔΡΙΑΚΌ DNA : Κυκλικό μόριο. Περιέχονται 2- 10 αντίγραφα μιτοχονδριακούDNA . Το γενετικό υλικό των μιτοχονδρίων κωδικοποιεί πρωτεΐνες που είναιαπαραίτητες για την λειτουργία τους. Οι περισσότερες όμως πρωτεΐνες κωδικοποιούνταιαπό τον πυρήνα. 206
  • 9. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΕπισημάνσεις θεωρίαςΚΥΤΤΑΡΙΚΌΣ ΚΎΚΛΟΣΚυτταρικός κύκλος είναι η περίοδος από την έναρξη μιας διαίρεσης ως την έναρξη τηςεπόμενης. Κατά την διάρκεια του κυτταρικού κύκλου από ένα κύτταρο έχουμε τηνδημιουργία δύο θυγατρικών κυττάρων.Ο κύκλος αυτός αποτελείται από μια σειρά διαδοχικών γεγονότων αλλά γιαεκπαιδευτικούς ρόλους τον διαχωρίζουμε σε διακριτά στάδια. Αρχικά διακρίνουμε δύοφάσεις την μεσόφαση και την κυτταρική διαίρεση.Μεσόφαση: 90-95 % του κυτταρικού κύκλου Κατά την διάρκειά της γίνονται διάφορες μεταβολικές διαδικασίες όπως η αντιγραφή του DNA, η μεταγραφή σε RNA και η πρωτεινοσύνθεση.Μίτωση: Κατά την διάρκεια της μίτωσης το DNA έχει ήδη διπλασιαστεί (αδερφέςχρωματίδες ενωμένες στο κεντρομερίδιο) και ακολουθεί συσπείρωση του γενετικούυλικού, διαίρεση του κυτταροπλάσματος και του κυττάρου. 3
  • 10. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΟι όψεις της χρωματίνης στις διάφορες φάσεις του κυτταρικού κύκλου Φάση κυτταρικού κύκλου Φάση χρωματίνης Μεσόφαση Ινίδια χρωματίνης Πριν τον διπλασισμό του DNA Μεσόφαση Αδερφές χρωματίδες ενωμένες Μετά τον διπλασιασμό του DNA στο κεντρομερίδιο Μίτωση Συσπείρωση αδελφών Πρόφαση χρωματίδων προς χρωμοσώματα Μίτωση Μέγιστος βαθμός συσπείρωσης μετάφαση των χρωμοσωμάτων Εικόνα Τα χρωμοσώματα είναι διατεταγμένα στο κέντρο της ατράκτου Τέλος μετάφασης, αρχή ανάφασης 206
  • 11. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΜε βάση την παραπάνω θεωρία, να συμπληρώσετε στις παρακάτω προτάσεις τους όρους που λείπουν. 1. Η χημική σύσταση του γενετικού υλικού των ιών είναι ……….………… ή ………………………… 2. Το DNA …………………………, δηλαδή κατασκευάζει αντίγραφο του εαυτού του. 3. Τα χαρακτηριστικά ενός οργανισμού καθορίζονται από τις γενετικές πληροφορίες, που περιέχουν τμήματα του DNA με καθορισμένη ακολουθία βάσεων, ……………………..…… . 4. Το γενετικό υλικό του κυττάρου ονομάζεται ………………………… . 5. Στα φυτικά κύτταρα το γενετικό υλικό εντοπίζεται εκτός από τον πυρήνα, ………………………… και ………… ……………………… . 6. Η βασική μονάδα οργάνωσης της χρωματίνης είναι ………………… . 7. Το νουκλεόσωμα αποτελείται από τμήμα μορίου ……………… μήκους 146 ζευγών βάσεων και από 8 μόρια πρωτεϊνών, που ονομάζονται …………… . 8. Τα νουκλεοσώματα πακετάρονται σχηματίζοντας ινίδια ………………… . 9. Τα ινίδια χρωματίνης αναδιπλώνονται και σχηματίζουν θηλιές, οι οποίες με τη σειρά τους αναδιπλώνονται και σχηματίζουν ………………… . 3
  • 12. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Ερωτήσεις Θεωρίας1. Ποιο μακρομόριο πίστευαν μέχρι το 1944 ότι αποτελεί το γενετικό υλικό των οργανισμών και γιατί;2. Περιγράψτε το πείραμα του Griffith.3. Ποιους μικροοργανισμούς χρησιμοποίησε ο Griffith στο πείραμά του;4. Ποιοι επιβεβαίωσαν τελικά το παραπάνω πείραμα και πώς;5. Ποια βιοχημικά δεδομένα στα μέσα του προηγούμενου αιώνα υποστήριζαν ότι το DNA είναι το γενετικό υλικό;6. Περιγράψτε το πείραμα των Hershey- Chase.7. Ορισμοί: ιχνηθέτηση, in vivo, in vitro. Παραδείγματα.8. Ποια η χημική σύσταση του δεοξυριβονουκλεϊκού οξέος;9. Ποιοι ανακάλυψαν το μοντέλο της διπλής έλικας και πότε; Σε τι πειράματα βασίστηκαν;10. Ποιες οι βασικές παραδοχές του μοντέλου της διπλής έλικας του DNA;11. Τι γνωρίζετε για το λόγο Α+Τ/ G+C;12. Ποιες οι λειτουργίες του γενετικού υλικού;13. Ορισμοί: γονιδίωμα, απλοειδή- διπλοειδή κύτταρα (παραδείγματα).14. Ποιος όρος χρησιμοποιείται για την περιγραφή του μήκους ή της αλληλουχίας ενός νουκλεϊκού οξέος;15. Τι γνωρίζετε για την οργάνωση του DNA των προκαρυωτικών οργανισμών; Ποια η ιδιαιτερότητά του και ποιες ιδιότητες του προσφέρει;16. Οργάνωση του γονιδιώματος των ευκαρυωτικών οργανισμών. Ποιες μορφές παίρνει αυτό κατά τα διάφορα στάδια του κυτταρικού κύκλου; 206
  • 13. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης17. Τι είναι γενικά ο καρυότυπος; Ποια διαδικασία θα ακολουθούσατε για να παρατηρήσετε τα χρωμοσώματα ενός κυττάρου του ανθρώπου; Πώς οργανώνονται τα χρωμοσώματά μας;18. Τι γνωρίζετε για το γενετικό υλικό των μιτοχονδρίων και των χλωροπλαστών; Γιατί αυτά χαρακτηρίζονται ως ημιαυτόνομα οργανίδια;19. Τι ξέρετε για το γενετικό υλικό των ιών; 3
  • 14. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Συνδυαστικές Ερωτήσεις1. Να περιγράψεις ένα πείραμα που δείχνει ότι οι πρωτεΐνες δεν είναι το γενετικό υλικό.2. Σε τι διέφεραν τα βακτήρια που χρησιμοποίησε ο Griffith στα πειράματά του; Τι απέδειξε το πείραμα του Griffith;3. Αν στο θρεπτικό υλικό καλλιέργειας βακτηρίων προσθέσουμε ραδιενεργό θείο, ποιο βιολογικό μακρομόριο θα ιχνηθετηθεί;4. Το συνολικό DNA σε ζεύγη βάσεων στη Drosophila melanogaster (έντομο), στο Saccharomyces cerevisiae (ζύμη) και στην E.coli (βακτήριο) είναι 1,6Χ108, 1,4Χ107 και 4Χ106 αντίστοιχα. Τι συμπέρασμα βγάζετε;5. Τι δεσμοί υπάρχουν στο δίκλωνο μόριο του DNA ; Πώς σχηματίζονται;6. Γιατί η μελέτη των χρωμοσωμάτων γίνεται στο στάδιο της μετάφασης;7. Τι γνωρίζετε για τον 3’-5’ φωσφοδιεστερικό δεσμό; Ποιος ο ρόλος των δεσμών υδρογόνου στο μόριο του DNA;8. Τι σημαίνει 5’→3’ προσανατολισμός της πολυνουκλεοτιδικής αλυσίδας;9. Τι γίνεται στο κύτταρο κατά τη διάρκεια της μεσόφασης;10.Πώς οι MacLeod, Avery & McCarthy ερμήνευσαν το θάνατο ποντικών ύστερα από ένεση που τους έκαναν χρησιμοποιώντας μίγμα από νεκρούς πνευμονιόκοκκους με «κάλυμμα» και ζωντανούς πνευμονιόκοκκους χωρίς «κάλυμμα»;11. Πώς εξηγείται η πολλαπλή ανθεκτικότητα των βακτηρίων στα αντιβιοτικά;12. Ποιος είναι ο σκελετός της διπλής έλικας του DNA; Τι υποδηλώνει η συμπληρωματικότητα των αλυσίδων του μορίου του DNA;13. Να εξηγήσετε γιατί οι 2 αλυσίδες του DNA είναι αντιπαράλληλες και όχι παράλληλες.14. Ποια η σημασία των συμπληρωματικότητας των βάσεων;15. Σε τι διαφέρει το γενετικό υλικό των σωματικών κυττάρων από εκείνο των γεννητικών κυττάρων; 206
  • 15. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης16. Τι ονομάζεται γονιδίωμα; Τι ονομάζονται ομόλογα χρωμοσώματα; Σε τι διαφέρουν 2 μη ομόλογα μεταφασικά χρωμοσώματα;17. Στους ανώτερους οργανισμούς η προέλευση των μιτοχονδριακών γονιδίων είναι μητρική. Πού οφείλεται αυτό;18.Γιατί τα μιτοχόνδρια και οι χλωροπλάστες χαρακτηρίζονται ημιαυτόνομα οργανίδια;19. Να περιγράψεις ένα μεταφασικό χρωμόσωμα. Ποια είναι η χημική του σύσταση σε μακρομόρια;20. Πού βρίσκονται μόρια DNA τα οποία αντιγράφονται ανεξάρτητα από την αντιγραφή του κύριου μορίου DNA ενός κυττάρου; Πού υπάρχει DNA σε ένα ευκαρυωτικό κύτταρο;21. Γιατί το DNA ορισμένων πλασμιδίων πιθανόν να περιέχει γονίδια του κύριου μορίου DNA; Γιατί ο αριθμός των πλασμιδίων σε ένα βακτήριο συνήθως δεν είναι σταθερός;22.Να εξηγήσεις γιατί το ποσοστό των νουκλεοτιδίων που έχουν την αζωτούχο βάση γουανίνη και των νουκλεοτιδίων που έχουν την κυτοσίνη είναι μεγάλο στα κυανοφύκη (προκαρυωτικά) που βρίσκονται σε θερμές πηγές.23.Πόσα μόρια DNA βρίσκονται στον πυρήνα ενός ανθρώπινου σωματικού κυττάρου και ενός γαμέτη;24. Ποια είναι τα επίπεδα πακεταρίσματος του DNA στο μιτωτικό χρωμόσωμα;25.Τι είναι το νουκλεόσωμα και από τι αποτελείται;26. Γιατί είναι απαραίτητο το νουκλεόσωμα και σε ποια κύτταρα υπάρχει;27.Πού βρίσκονται οι πληροφορίες που καθορίζουν όλα τα χαρακτηριστικά ενός οργανισμού; Πώς εξασφαλίζεται η διατήρηση και η μεταβίβαση της γενετικής πληροφορίας από κύτταρο σε κύτταρο;28. Να αναφέρετε τις διαφορές που παρατηρούνται ανάμεσα: Α) στο χρωμόσωμα και στα ινίδια χρωματίνης, Β) στο γονίδιο και το νουκλεόσωμα (1 γονίδιο ≈ 1000bp)29. Τι έδειξαν τα πειράματα των Hershey & Chase;30.Σε τι διαφέρει το γονίδιο από το γονιδίωμα; 3
  • 16. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ31. Να αναφέρετε τις ιδιότητες του γενετικού υλικού;32.Εάν εργάζεστε στο κυτταρολογικό εργαστήριο ενός νοσοκομείου και σας ζητηθεί να απεικονίσετε τον καρυότυπο ενός ατόμου: Α) Ποια κύτταρα θα χρησιμοποιήσετε; Να αιτιολογήσετε την απάντησή σας. Β) Σε ποια φάση του κύκλου θα πρέπει να βρίσκονται τα κύτταρα αυτά; Να αιτιολογήσετε την απάντησή σας. Γ) Ποιες χημικές ουσίες θα χρησιμοποιήσετε κατά την πειραματική σας μελέτη; Ποιος ο ρόλος τους; Δ) Τι πληροφορίες θα σας προσφέρει ο καρυότυπος; Ε) Είναι δυνατόν να εντοπίσετε κληρονομικές ασθένειες με τον καρυότυπο; Αναφέρατε 2 από αυτές. 33. Να βάλετε «+» στο σωστό κουτάκι Πείραμα In vitro In vivo Griffith Anery Mc Leod Mac Garthy Hersey Chase Καλλιέργεια κυττάρων για καρυότυπο Απόδειξη ημισυντηριτικού τρόπου αντιγραφής 206
  • 17. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης 34.Να συμπληρώσετε το παρακάτω πινακάκι αρχή τέλος τέλος τέλος μεσόφασης μεσόφασης μετάφασης διαίρεσης Χρωματίδεςαδελφές χεωματίδες χρωμοσώματα κεντρομερίδια 3
  • 18. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝΚΕΦΑΛΑΙΟ 1 1. Οι αζωτούχες βάσεις είναι μεταξύ τους συμπληρωματικές. Δηλαδή, Α+Τ+ C+G ισοδυναμεί με 2A + 2C 2. Όταν μας ζητάνε να υπολογίσουμε τους δεσμούς υδρογόνου, αρχικά υπολογίζουμε τα ζευγάρια αδενίνης- θυμίνης και τα ζευγάρια γουανίνης- κυτοσίνης. Στη συνέχεια υπολογίζουμε τους δεσμούς υδρογόνου, λαμβάνοντας υπόψιν ότι σε ένα ζευγάρι αδενίνης- θυμίνης αναπτύσσονται 2 δεσμοί υδρογόνου, ενώ σε ένα ζευγάρι γουανίνης- κυτοσίνης αναπτύσσονται τρεις δεσμοί υδρογόνου. 3. Σε κάθε περίπτωση ο υπολογισμός των δεσμών υδρογόνου γίνεται σε δίκλωνο μόριο ή σε σχηματισμό τμήματος δίκλωνου. 4. Δεν μπορούμε να υπολογίσουμε δεσμούς υδρογόνου, σε μονόκλωνο μόριο. 5. Έστω ότι συμβολίσουμε με φ τον αριθμό των φωσφωδιεστερικών δεσμών σε ένα μόριο και με ν τον αριθμό των νουκλεοτιδίων. Τότε, ο αριθμός των φωσφωδιεστερικών δεσμών και ο αριθμός των μορίων νερού που αποβάλλονται, φαίνονται στο παρακάτω πινακάκι αριθμός αριθμός φωσφωδιεστερικών μόρια νερού που νουκλεοτιδίων δεσμών αποβάλλονται ν ν-1 ν-1 αν, έχουμε μονόκλωνο μόριο γραμμικό ν ν-2 ν-2 αν έχουμε δίκλωνο μόριο, γραμμικό ν ν ν αν έχουμε κυκλικό μόριο 206
  • 19. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης6. Όπως φαίνεται ο αριθμός των φσφωδιεστερικών δεσμών, είναι ίσος με τον αριθμό μορίων νερού που αποβάλλονται, αφού κατά τη δημιουργία ενός φωσφωδιεστερικού δεσμού αποβάλλεται και ένα μόριο νερου (δεσμός συμπύκνωσης)7. Γραμμικό δίκλωνο DNA μπορούμε να συνατήσουμε, στο ευκαρυωτικό πυρηνικό DNA Στο DNA ιών8. Κυκλικό δίκλωνο μόριο DNA μπορούμε να συναντήσουμε στα : προκαρυωτικά κύτταρα Στα πλασμίδια Στα μιτοχόνδρια/ χλωροπλάστες Στους DNA ιούς9. Οι ιοί ως γενετικό υλικό μπορούν να έχουν DNA (μονόκλωνο/ δίκλωνο, γραμμικό/ κυκλικό) με όλους τους δυνατούς συνδυασμόυς. Μπορούν επίσης να έχουν και RNA γραμμικό, μονόκλωνο ή δίκλωνο.10. Το βακτήριο έχει κυκλικό γενετικό υλικό. Ωστόσο, όταν αναφερόμαστε σε γονίδιο βακτηρίου, το θεωρούμε γραμμικό, αφού αυτό αποτελεί ένα τμήμα μόνο του DNA του.11. Όταν δεν αναφέρεται το είδος του DNA στην εκφώνηση της άσκησης εξετάζω τις περιπτώσεις να είναι • μονόκλωνο (γραμμικό ή κυκλικό) • Δίκλωνο (γραμμικό ή κυκλικό)12. Όταν στην εκφώνηση της άσκησης αναφέρεται ότι το DNA ανήκει σε ευκαρυωτικό οργανισμό, διακρίνουμε τις περιπτώσεις • Γραμμικό και δίκλωνο (πυρηνικό) • Κυκλικό και δίκλωνο (μιτοχονδριακό ή χλωροπλάστη)13. Το σύνολο των διαφορετικών συνδυασμών νουκλεοτιδίων σε μια πολυνουκλεοτιδική αλυσίδα, δίνεται από τον τύπο 3
  • 20. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ • 4ν αν πρόκειται για μονόκλωνο μόριο • 4ν/2 αν πρόκειται για δίκλωνο μόριο (αφού η αλληλουχία στη μια αλυσίδα, καθορίζει την αλληλουχία στην άλλη)14. Κάθε νουκλεόσωμα αποτελείται από DNA μήκους 146 ζευγών βάσεων και 8 ιστόνες.15. Η αναλογία Α+Τ/ C+G Είναι ίδια σε όλα τα κύτταρα ενός συγκεκριμένου οργανισμού Διαφέρει ανάμεσα στα διαφορετικά είδη οργανισμών16. Ο αριθμός των μορίων DNA σε κάθε φάση του κυτταρικού κύκλου και ανάλογα με τον κάθε κυτταρικό τύπο συνοψίζονται στο παρακάτω πινακάκι ΕΙΔΟΣ ΑΡΙΘΜΟΣ ΚΥΤΤΑΡΩΝ ΦΑΣΗ ΚΥΤ.ΚΥΚΛΟΥ ΜΟΡΙΩΝ DNA Γαμέτες 23 Σωματικά κύτταρα μεσόφαση (πριν την αντιγαρφή) 46 μεσόφαση (μετά την αντιγαρφή) 92 Σωματικά μίτωση (πρόφαση, μετάφαση, κύτταρα ανάφαση, τελόφαση) 92 206
  • 21. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης ΑΣΚΗΣΕΙΣ1. Κατά το σχηματισμό πλασμιδίου αφαιρούνται 22960 μόρια νερού και σχηματίζονται 28260 δεσμοί υδρογόνου.a) Ποια η μορφή του μορίου του πλασμιδίου;b) Από ποια νουκλεοτίδια σχηματίζεται και ποιος δεσμός είναι υπεύθυνος για το σχηματισμό αυτό;c) Να βρεις τον αριθμό των διαφορετικών νουκλεοτιδίων που περιέχει.2. Κατά τη δημιουργία ενός νουκλεϊκού οξέος αποσπάστηκαν 30000 μόρια νερού. Αν το ΜΒ του μορίου είναι 6Χ106 και τα ποσοστά των βάσεων είναι: Α=20%, Τ=30%, C=25%, G=25%, να βρεις από πού μπορεί να απομονώθηκε το μόριο αυτό, και να δικαιολογήσεις την απάντησή σου. (Θεωρείται το μέσο βάρος ενός νουκλεοτιδίου ίσο με 200).3. Μεσοφασικό ανθρώπινο χρωμόσωμα έχει 180Χ106 ζεύγη βάσεων. Αν το κομμάτι του DNA που συνδέει 2 νουκλεοσώματα έχει μήκος 34 ζεύγη βάσεων, να βρεις περίπου τον αριθμό των μορίων ιστονών που θα υπάρχουν στο στάδιο της μετάφασης αυτού του χρωμοσώματος. Να θεωρήσεις ότι στα άκρα του χρωμοσώματος βρίσκονται νουκλεοσώματα.4. Μιτοχονδριακό DNA του ανθρώπου βρέθηκε να έχει 16Χ103 ζεύγη βάσεων. Αν ισχύει ο λόγος Α/ C = 1/3, να βρεις: a) Τον ακριβή αριθμό των αζωτούχων βάσεων του μορίου b) Τα μόρια νερού που αποσπάστηκαν για τη δημιουργία του μορίου5. Πόσα νουκλεοσώματα θα μπορούσε να έχει το ανθρώπινο γονιδίωμα σε ένα απλοειδές κύτταρο, αν η απόσταση μεταξύ των νουκλεοσωμάτων ήταν 200 ζεύγη βάσεων; (Να θεωρήσεις ότι το γονιδίωμα είναι ένα ενιαίο μόριο DNA, και στα 2 άκρα βρίσκονται νουκλεοσώματα.)6. Κυκλικό δίκλωνο μόριο DNA περιέχει 10000 φωσφοδιεστερικούς δεσμούς και 13000 δεσμούς υδρογόνου. Ποιο είναι το ποσοστό (%) της καθεμιάς από τις 4 αζωτούχες βάσεις στο μόριο;7. Ένα τμήμα DNA έχει 10 φωσφοδιεστερικούς δεσμούς και 15 δεσμούς υδρογόνου. Πόσες Α, Τ, C και G περιέχει;8. Αν ο λόγος Α+G/Τ+C στη μια αλυσίδα του DNA είναι 7/10, πόσος είναι ο ίδιος λόγος: α) στη συμπληρωματική της αλυσίδα, β) στο μόριο;9. Αν ο λόγος Α+T/G+C στη μια αλυσίδα του DNA είναι 7/10, πόσος είναι ο ίδιος λόγος: α) στη συμπληρωματική της αλυσίδα, β) στο μόριο;10. Μια πλήρης στροφή της έλικας του DNA έχει μήκος 3,4nm και περιέχει 10 ζεύγη αζωτούχων συμπληρωματικών βάσεων. Αν ένα τμήμα DNA έχει μήκος 13600nm και το 30% των βάσεων είναι αδενίνες, να βρεθεί ο αριθμός: α) των υπολοίπων βάσεων, β) των φωσφοδιεστερικών δεσμών, γ) των δεσμών υδρογόνου στο μόριο. 3
  • 22. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ11. Σε τμήμα DNA που αποτελείται από 200 ζεύγη βάσεων βρέθηκε ότι υπάρχουν 110 βάσεις θυμίνης. Να βρεθεί ο αριθμός των βάσεων γουανίνης στο τμήμα αυτό του DNA.12. Στο DNA ενός νουκλεοσώματος βρέθηκε ότι η διαφορά των βάσεων αδενίνης και κυτοσίνης είναι 80. Να βρεθούν τα ποσοστά των βάσεων στο τμήμα αυτό του DNA.13. Μόριο DNA αποτελείται από 10000 νουκλεοτίδια. Το ποσοστό των βάσεων στη μία αλυσίδα είναι: 15% Α, 25% Τ, 40% G και 20% C. Πόσοι δεσμοί υδρογόνου συγκρατούν τις 2 πολυνουκλεοτιδικές αλυσίδες;14. Τμήμα DNA περιέχει 80 ζεύγη βάσεων και ο αριθμός δεσμών υδρογόνου στο τμήμα αυτό είναι 190. Να βρεις τα ποσοστά των αζωτούχων βάσεων του μορίου.15. Το συνολικό DNA της Drosophila melanogaster είναι 1,6Χ108 ζεύγη βάσεων. Πόσα περίπου μόρια ιστονών χρειάζονται για το πακετάρισμα αυτού του DNA; (Δίνεται ότι το κομμάτι DNA που ενώνει 2 νουκλεοσώματα έχει μήκος 54 ζεύγη βάσεων. Θεωρούμε ότι το γονιδίωμα είναι ένα ενιαίο μόριο DNA και στα άκρα βρίσκονται νουκλεοσώματα.)16. Σε 2 κύτταρα έγινε ανάλυση του γενετικού τους υλικού και βρέθηκε η παρακάτω % σύσταση σε αζωτούχες βάσεις. Τα κύτταρα 1,2 ανήκουν στο ίδιο ή σε διαφορετικά είδη οργανισμών; A T C G Κύτταρο 1 28 28 22 22 Κύτταρο 2 31 31 19 1917. Κατά τη χημική ανάλυση δειγμάτων γενετικού υλικού από διάφορους οργανισμούς καταγράφηκαν τα κατώτερα στοιχεία σχετικά με το πλήθος των αζωτούχων βάσεων και των φωσφοδιεστερικών δεσμών. Από πού μπορεί να προέρχονται τα δείγματα αυτά; 1ο δείγμα 2ο 3ο 4ο Α 1500 11800 714 555 Τ 1303 12710 386 555 C 1500 11800 714 554 G 1303 12710 368 554 Φωσφοδιεστερικοί 5606 49018 2182 2118 δεσμοί 206
  • 23. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης18. Από ανάλυση του γενετικού υλικού 2 οργανισμών διαπιστώθηκε η παρακάτω αναλογία αζωτούχων βάσεων: Οργανισμός Ι Οργανισμός ΙΙ A 12% 20% ΒΑΣΕΙΣ T 12% 0% C 38% 30% G 38% 30% U 0% 20%Α) Tι είδους γενετικό υλικό έχει ο καθένας τους;Β) Σε ποια κατηγορία μπορεί να ανήκει ο καθένας;Γ) Από αναλύσεις που έγιναν στη συνέχεια προστέθηκαν νέα δεδομένα: το γενετικό υλικό τουοργανισμού Ι περιέχει στον ένα κλώνο του 2500Α και 3356Τ, ενώ στον άλλο υπάρχουν 24399φωσφοδιεστερικοί δεσμοί. το γενετικό υλικό του οργανισμού ΙΙ περιέχει 3000 U, ενώ έχει 15000φωσφοδ.δεσμούς. Με βάση τα επιπλέον στοιχεία, ποια συμπεράσματα εξάγετε σχετικά με τη φύση τουγενετικού υλικού των 2 οργανισμών και την κατηγορία οργανισμού στην οποία ανήκουν;19. Ένα πυρηνικό μόριο ανθρώπινου DNA αποτελείται από 87016 νουκλεοτίδια και αναδιπλώνεται με 1760 μόρια ιστονών. Με δεδομένο ότι δεν υπάρχουν ακραία τμήματα DNA εκτός του πρώτου και του τελευταίου νουκλεοσώματος, και ότι η απόσταση μεταξύ διαδοχικών νουκλεοσωμάτων είναι σταθερή: α) πόσα νουκλεοσώματα θα μετρήσετε στο παραπάνω DNA; Β) να υπολογίσετε την απόσταση μεταξύ 2 διαδοχικών νουκλεοσωμάτων;20. Η δροσόφιλα έχει 8 χρωμοσώματα (2κ=8). Ένα διπλοειδές κύτταρο της δροσόφιλα υφίσταται μείωση. a. Πόσα ομόλογα χρωμοσώματα έχει και πόσα από αυτά είναι φυλετικά; b. Πόσα μη ομόλογα χρωμοσώματα βρίσκονται σε κύτταρα που προκύπτουν από την 1η μειωτική διαίρεση; c. Πόσες φυλετικές χρωματίδες περιέχονται σε ένα σπερματοζωάριο και πόσες σε ένα ωάριο; d. Πόσες μη ομόλογες αυτοσωμικές χρωματίδες βρίσκονται σε κάθε γαμέτη; e. Πόσοι γαμέτες διαφορετικής χρωμοσωμικής σύστασης μπορούν να παραχθούν; f. Τι μπορεί να συμβεί κατά τη γνώμη σας αν στη μειωτική διαίρεση παραχθούν γαμέτες με ένα παραπάνω ή ένα λιγότερο χρωμόσωμα; 21. Ένας ερευνητής μελετά τους καρυότυπους δυο αγνώστων πολυκύτταρων οργανισμών. Από αυτούς τους οργανισμούς ο ένας είναι απλοειδής και ο άλλος διπλοειδής. Ο αριθμός των χρωμοσωμάτων που απεικονίζονται στους δύο καρυότυπους είναι 30 και 41 αντίστοιχα. Μπορείτε να ξεχωρίσετε ποιος καρυότυπος αντιστοιχεί σε κάθε οργανισμό; 22. Από το φυτό Zea mays απομονώθηκαν τρία διαφορετικά φυσιολογικά κύτταρα, στα οποία μετρήσαμε την ποσότητα του γεννητικού υλικού σε ζεύγη βάσεων. Στο πρώτο κύτταρο βρέθηκαν ζεύγη βάσεων. Στο δεύτερο ζεύγη βάσεων και στο τρίτο ζεύγη βάσεων. Πώς μπορείτε να εξηγήσετε τα αποτελέσματα; 3
  • 24. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ23. Το πλασμίδιο ενός βακτηρίου έχει 900 νουκλεοτίδια και θυμίνη σε ποσοστό 14%.Ζητάμε: a. Το ποσοστό των άλλων βάσεων b. Το πλήθος των δεσμών υδρογόνου c. Το πλήθος των φωσφωδιεστερικών δεσμών d. Το πλήθος των δεοξυριβοζών24. Ένα μόριο νουκλεικού οξέος έχει 1000 νουκλεοτίδια. Πόσοι φωσφωδιεστερικοί δεσμοί σχηματίζονται αν a. Είναι μονόκλωνο μόριο DNA; b. Είναι δίκλωνο μόριο DNA; c. Μόριο RNA; d. Κυκλικό μόριο DNA; 206
  • 25. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΕρωτήσεις πολλαπλής επιλογήςΝα βάλετε σε κύκλο την σωστή απάντηση1. Η ποσότητα του DNAα. είναι ίδια σε όλους τους απλοειδείς οργανισμούςβ. είναι σταθερή σε όλους τους διπλοειδείς οργανισμούςγ. μεταβάλλεται στα κύτταρα των διαφόρων ιστών ενός οργανισμού δ. διαφέρει στα κύτταρα οργανισμών που ανήκουν σε διαφορετικά είδη.2. Στους διπλοειδείς οργανισμούςα. το γονιδίωμα των σωματικών κυττάρων υπάρχει σε ένα αντίγραφοβ. το γονιδίωμα των γαμετών υπάρχει σε δύο αντίγραφαγ. τα σωματικά κύτταρα περιέχουν διπλάσια ποσότητα DNA από τους γαμετεςδ. ισχύουν όλα όσα περιγράφονται στα α, β, γ.3. Το RNA αποτελείται απόα. πεπτίδια, που συνδέονται μεταξύ τους με πεπτιδικό δεσμόβ. αμινοξέα, που συνδέονται μεταξύ τους με πεπτιδικό δεσμόγ. νουκλεοτίδια, που συνδέονται με φωσφοδιεστερικό δεσμόδ. διαφορετικά μόρια πεντοζών, που συνδέονται με αζωτούχες βάσεις.4. Γονιδίωμα είναια. το σύνολο των αλληλομόρφων γονιδίων ενός απλοειδούς κυττάρουβ. το γενετικό υλικό των απλοειδών ή των διπλοειδών κυττάρωνγ. το μόριο του DNA ενός απλοειδούς κυττάρουδ. τμήμα ενός μορίου DNA με καθορισμένη ακολουθία νουκλεοτιδίων. 3
  • 26. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ5. Ο όρος αλληλουχία βάσεωνα. εκφράζει την ακολουθία των νουκλεοτιδίων σε ένα νουκλεϊκό οξύβ. εκφράζει την ακολουθία των πεντοζών μιας πολυνουκλεοτιδικής αλυσίδαςγ. αναφέρεται στον αριθμό φωσφοδιεστερικών δεσμώνδ. αναφέρεται στην ακολουθία των φωσφορικών ομάδων6. Οι γαμέτες είναι απλοειδή κύτταρα γιατία. το γενετικό τους υλικό υπάρχει σε ένα μόνο αντίγραφοβ. το γονιδίωμα τους είναι μονόκλωνογ. η δομή τους είναι όμοια με των προκαρυωτικών κυττάρωνδ. το γονιδίωμά τους υπάρχει σε δύο μόνο αντίγραφα.7. Το πλασμίδιο των βακτηρίων είναια. το γονιδίωμά τουςβ. ένα επί πλέον κυκλικό μόριο DNAγ. τμήμα του κυκλικού μορίου του DNAδ. κυκλικό DNA, μεγαλύτερο από το γονιδίωμα τους.8. Οι αδελφές χρωματίδεςα. ενώνονται στο κεντρομερίδιοβ. παράγονται στο στάδιο μεταγραφής του DNAγ. παραμένουν ενωμένες μετά τη διαίρεση του κυττάρου δ. συσπειρώνονται κατά το τέλος της μίτωσης για να αποκτήσουν τη μορφή των ινιδίων της χρωματίνης.9. Τα ινίδια χρωματίνηςα. είναι ορατά στο οπτικό μικροσκόπιο κατά τη μεσόφασηβ. αποτελούνται από DNA και πρωτεΐνεςγ. διπλασιάζονται κατά τη μετάφαση της μιτωτικής διαίρεσηςδ. αποτελούνται από δύο αδελφές χρωματίδες ενωμένες στο κεντρομερίδιο.10.Τα φυλετικά χρωμοσώματαα. εντοπίζονται μόνο στα γεννητικά κύτταρα των πολυκύτταρων οργανισμώνβ. διατάσσονται πάντοτε σε ζεύγη ομολόγων χρωμοσωμάτωνγ. είναι ορατά στα σωματικά κύτταρα κατά τη μεσόφασηδ. υπάρχουν τόσο στα σωματικά όσο και στα γεννητικά κύτταρα.11. Σε όλα τα σωματικά κύτταρα αυτό που ποσοτικά παραμένει σταθερό είναιa. Οι πρωτεΐνεςb. Τα λιπίδιαc. Το RNAd. Το DNA 12. Το νουκλεόσωμα αποτελεί βασική μονάδα συσπείρωσης της χρωματίνης a. Στους προκαρυωτικούς οργανισμούς 206
  • 27. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσηςb. Στους ευκαρυωτικούς οργανισμούςc. Στους ιούςd. Σε όλους τους οργανισμούς13.Οι αδερφές χρωματίδεςa. Προκύπτουν από την αντιγραφή του DNA.b. Συνδέονται στο κεντρομερίδιοc. Η κάθε μια αποτελείται από ένα μόριο DNA συνδεδεμένο με ιστόνεςd. Όλα τα παραπάνω αληθεύουν 14. Ένα φυσιολογικό ανθρώπινο σπερµατοζωάριο περιέχει: a. 22 ζεύγη αυτοσωµικών χρωµοσωµάτων και ένα Χ ή ένα Υ b. 23 χρωµοσώµατα c. 22 αυτοσωµικά οµόλογα χρωµοσώµατα και ένα ζεύγος φυλετικών d. 23 αυτοσωµικά χρωµοσώµατα και ένα Χ ή ένα Υ 15. Μετά τη µειωτική διαίρεση ενός άωρου γεννητικού κυττάρου στον άνθρωπο, κάθε θυγατρικό κύτταρο περιλαµβάνει: a. δύο µη αδελφές χρωµατίδες κάθε οµόλογου ζεύγους χρωµοσωµάτων b. ένα µόριο DNA κάθε χρωµοσώµατος c. 23 µόρια DNA d. κανένα από τα παραπάνω 16. Τα διπλασιασμένα χρωμοσώματα κατά το χρονικό διάστημα που είναι συνδεδεμένα στο κεντρομερίδιο περιγράφονται με τον όρο a. διπλοειδή, b. αδελφές χρωματίδες, c. απλοειδή, d. ζεύγη χρωμοσωμάτων 17. Τα χαρακτηριστικά ενός οργανισμού οργανώνονται σε λειτουργικές μονάδες που ονομάζονται a. DNA, b. εξώνια, c. χρωμοσώματα, d. γονίδια 18. Σε ένα δίκλωνο μόριο DNA δεν ισχύει πάντα η ισότητα: a. Α = Τ, b. Α + Τ = C + G, 3
  • 28. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥc. C = G,d. A + C = T + G.19. Τα κύτταρα στα οποία το γονιδίωμα υπάρχει σε ένα μόνο αντίγραφο, ονομάζονται;a. διπλοειδή,b. διαφοροποιημένα,c. απλοειδή,d. μοναδικά20. Η βασική πρωτεϊνική μονάδα οργάνωσης της χρωματίνης ονομάζεται:a. νουκλεοτίδιο,b. νουκλεόσωμα,c. ιστόνη,d. μη - ιστόνη21. Στο γονιδίωμα του απλοειδούς κυττάρου του Zea mays υπάρχουν 5 .109 ζεύγη βάσεων. Στο γονιδίωμα του σωματικού κυττάρου του Zea mays κατά τη μετάφαση της μίτωσης θα υπάρχουν:a. 5 .109 ζεύγη βάσεωνb. 10 .109 ζεύγη βάσεωνc. 15 .109 ζεύγη βάσεωνd. 20 .109 ζεύγη βάσεων.22. Ένα ευκαρυωτικό κύπαρο που διαιρείται μιτωτικά έχει στη μετάφαση 24 δίκλκωνα μόρια DNA. Στην απεικόνιση των μεταφασiκών χρωμοσωμάτων αυτού του κυττάρου θα μετρηθούν:a. 3 ζεύγη μεταφασικών χρωμοσωμάτωνb. 4 ζεύγη μεταφασικών χρωμοσωμάτωνc. 6 ζεύγη μεταφασικών χρωμοσωμάτωνd. 12 ζεύγη μεταφασικών χρωμοσωμάτων.23. Στον άνθρωπο, πόσα διαφορετικά χρωμοσώματα υπάρχουνa. 22b. 23c. 24d. 46 206
  • 29. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΝα χαρακτηρίσετε τις παρακάτω προτάσεις ως Σωστές ή Λανθασμένες.Για κάθε λανθασμένη απάντηση να επισημάνετε την σωστή διατύπωση.1. Στα ευκαρυωτικά κύτταρα η αντιγραφή του DNA γίνεται κατά ()τη μεσόφαση.2. Το γονιδίωμα περιέχει το σύνολο των γονιδίων ενός κυττάρου. ()3. Το γονιδίωμα των σωματικών κυττάρων του ανθρώπου αποτε- ()λείται από 46 μόρια DNA.4. Ένα γονίδιο αποτελείται από πολλά νουκλεοσώματα. ()5. Στα απλοειδή κύτταρα, τα ομόλογα χρωμοσώματα είναι μορφο- ()λογικά όμοια.6. Στους άνδρες τα φυλετικά χρωμοσώματα των σωματικών ()κυττά-ρων είναι ομόλογα.7. Με τον καρυότυπο μπορούμε να μελετήσουμε τη μορφή και τον ()αριθμό των χρωμοσωμάτων.8. Κατά τη μεσόφαση της μίτωσης οι αδερφές χρωματίδες είναι ()ορατές στο οπτικό μικροσκόπιο.9. Στα πλασμίδια εντοπίζονται γονίδια ανθεκτικότητας σε αντι- ()βιοτικά.10. Ένα μιτοχόνδριο περιέχει πολλά μόρια κυκλικού DNA. ()11. Η ποσότητα του DNA σε ένα κύτταρο είναι σταθερή. ()12. Το πλασμίδιο περιέχει γενετικό υλικό, που ρυθμίζει τις ()λειτουρ-γίες του DNA και δεν περιέχει γονίδια. 3
  • 30. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΚεφάλαιο : 2Αντιγραφή, Έκφραση και ρύθμιση της γενετικής πληροφορίας 206
  • 31. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΔιδακτικοί στόχοι • Να κάνεις ορθή ανάκληση των ορισμών και Διάκριση της χρήσης του κατάλληλου όρου σε ερωτήσεις πολλαπλής επιλογής • Να περιγράφεις τις διαδικασίες αντιγραφής, μεταγραφής μετάφρασης με χρήση διαγραμμάτων. (Ανάκληση εννοιών) • Αναφορά και Διαχωρισμός των ενζύμων, των παραγόντων και των ρυθμιστικών αλληλουχιών που χρειάζονται στις διαδικασίες αντιγραφής μεταγραφής και μετάφρασης. • Αναφορά και περιγραφή των χαρακτηριστικών του γενετικού κώδικα • Ομοιότητες και διαφορές στις διαδικασίες αντιγραφής- μεταγραφής- μετάφρασης (Συνδυαστική και κριτική ικανότητα) • Σύγκριση της ρύθμισης της έκφρασης της γενετικής πληροφορίας σε ευκαρυωτικούς και προκαρυωτικούς οργανισμούς. Γιατί άραγε οι προκαρυωτικοί και οι ευκαρυωτικοί οργανισμοί έχουν διαφορετικούς μηχανισμούς στην ρύθμιση της έκφρασης της γενετικής πληροφορίας; • Γιατί άραγε οι οργανισμοί έχουν πολλαπλά σημεία ελέγχου στην έκφραση της γενετικής πληροφορίας; Αυτό είναι ενεργειακά δαπανηρό ή όχι κατά την γνώμη σας; (Ικανότητα κατανόησης και σύνθεσης) • Να έχεις ικανότητα επίλυσης προβλημάτων που σχετίζονται με : τον προσανατολισμό των αλυσίδων: κωδική, μεταγραφόμενη, αλυσίδα m RNA πεπτιδικής αλυσίδας Την σχέση μεταξύ του αριθμού των βάσεων των κωδικονίων και των παραγόμενων αμινοξέων στην διαδικασία της μετάφρασης. 3
  • 32. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΕπισημάνσεις Θεωρίας Είναι γνωστό ότι η γενετική πληροφορία βρίσκεται πάνω στα γονίδια και ότι μεταφέρεται στα ριβοσώματα προκειμένου να εκφραστεί. Μια και τα γονίδια αποτελούνται από DNA, αναζητούμε σ’ αυτό το μόριο 1) τον τρόπο με τον οποίο είναι « γραμμένη » η γενετική πληροφορία 2) πώς μεταφέρεται στα ριβοσώματα 3) πώς μεταφέρεται στους απογόνους. Έχει βρεθεί τα τελευταία χρόνια ότι κάθε γονίδιο ευθύνεται για τη σύνθεση μιας πολυπεπτιδικής αλυσίδας και ότι περιέχει κωδικοποιημένη την πληροφορία αυτή με τη μορφή μιας συγκεκριμένης σειράς (ακολουθίας) νουκλεοτιδίων. Οι βάσεις των νουκλεοτιδίων ανά τρεις (τριπλέτα) ορίζουν ένα συγκεκριμένο αμινοξύ. Συνεπώς μια πεπτιδική αλυσίδα (πρωτεΐνη), που αποτελείται από 20 π.χ. αμινοξέα, κωδικοποιείται (ελέγχεται) από ένα γονίδιο που θα έχει 20x3=60 νουκλεοτίδια. Με τα δεδομένα αυτά, όταν μιλάμε για γενετικές ιδιότητες, π.χ. για το χρώμα του δέρματος ή για την ομάδα αίματος, πρέπει να σκεπτόμαστε ότι κάποιες πρωτεΐνες, άμεσα ή έμμεσα θα σχετίζονται με αυτές τις ιδιότητες και συνεπώς κάποια αντίστοιχα γονίδια θα είναι οι ρυθμιστές αυτών των ιδιοτήτων. Κεντρικό δόγμα της Βιολογίας μεταγραφή μετάφραση DNA RNA ΠΡΩΤΕΪΝΕΣ αντίστροφη μεταγραφή Το DNA αντιγράφεται, με μηχανισμό ημισυντηριτικό. Η διαδικασία της αντιγραφής επιτελείται στον πυρήνα, όταν αναφερόμαστε σε ευκαρυωτικό οργανισμό. Η μεταγραφόμενη αλυσίδα του DNA μεταγράφεται σε RNA. Με την διαδικασία της μεταγραφής παράγονται όλα τα είδη RNA και όχι μόνο το μεταφορικό. Η διαδικασία της μεταγραφής καθώς και της ωρίμανσης του m RNA επιτελείται στον πυρήνα. Στην μετάφραση το m RNA μεταφράζεται σε πεπτιδική αλυσίδα με προσανατολισμό 5- 3. Η διαδικασία της μετάφρασης επιτελείται στο κυτταρόπλασμα και είναι πολύ δαπανηρή ενεργειακά. Στους προκαρυωτικούς οργανισμούς οι διαδικασίες αντιγραφής μεταγραφής και μετάφρασης συμβαίνουν στο κυτταρόπλασμα, και άρα ενδεχομένως να μην διαχωρίζονται χρονικά. 206
  • 33. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΟι διαδικασίες της αντίστροφης μεταγραφής και της αντιγραφής του RNA επιτελούνται μόνοαπό τους ιούς. Απαραίτητα για την αντιγραφή 1.Ασυνεχής αλυσίδα,2.Συνεχής Αλυσίδα, 3.DNA Πολυμεράση (Polα), 4.DNA δεσμάση, 5.RNA πρωταρχικό τμήμα, 6.Πριμόσωμα, 7.Τμήμα Okazaki, 8.DNA πολυμεράση (Polδ), 9.DNA ελικάση, 10.Ελεύθερό τμήμα αλυσίδας,Πρωτεΐνες πρόσδεσης, 11.DNA ελικάση- Τοποϊσομεράση Εικόνα Περιγραφική εικόνα της αντιγραφής του γενετικού υλικού1. DNA2. DNA ελικάση3. Πριμόσωμα4. Πρωταρχικά τμήματα (ριβονουκλεοτίδια)5. DNA πολυμεράση (πολυμερίζει, διορθώνει)6. Δεσόξυριβονουκλεοτίδια7. DNA δεσμάση8. DNA επιδιορθωτικά ένζυμα9. ΑΤΡ (ενέρεγεια) 3
  • 34. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Απαραίτητα για την μεταγραφή1. Ελέυθερες ρυθμιστικές αλληλουχίες2. Μεταγραφικοί παράγοντες3. Πολυμεράση4. Ριβονουκλεοτίδια Απαραίτητα για την μετάφραση1. Ριβόσωμα2. RNA (m RNA, t- RNA, r- RNA)3. Αμινοξέα4. ΑΤΡ (ενέργεια) Εικόνα Σχηματική αναπαράσταση μεταγραφής και μετάφρασης 206
  • 35. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΟμοιότητες διαφορές Αντιγραφής- Μεταγραφής ΑΝΤΙΓΡΑΦΗ ΜΕΤΑΓΡΑΦΗ Εφαρμόζεται η συμπληρωματικότητα των βάσεων Ομοίως Γίνονται σε προσανατολισμό 5-3 Ομοίως Γίνονται στον πυρήνα Ομοίως Χρειάζονται ενέργεια Ομοίως Ενζυμική διαδικασία Ομοίως Τα ένζυμα που χρησιμοποιούνται είναι διαφορετικά Ομοίως Οι χρησιμοποιούμενες βάσεις είναι A,U, C, Οι χρησιμοποιούμενες βάσεις είναι A,T, C, G G1 Σχηματίζονται πρωταρχικά τμήματα ΌΧΙ Υπάρχουν επιδιορθωτικά ένζυμα ΌΧΙ Γίνεται μια φορά στον κυτταρικό κύκλο Γίνεται πολλές φορές στον κυτταρικό κύκλο Επιτελείται στην φάση S Επιτελείται στην φάση G1 Αντιγράφεται όλο το DNA Μεταγράφεται η μια αλυσίδα του γονιδίου Το μόριο του DNA ανοίγει σε πολλά σημεία Το μόριο του DNA ανοίγει σε ένα σημείο 3
  • 36. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Ερωτήσεις Θεωρίας1. Ο μηχανισμός αντιγραφής του DNA είναι τόσο απλός όσο τον φαντάστηκαν οι Watson και Crick; Εξηγείστε. Τι σημαίνει ημισυντηρητικός διπλασιασμός του DNA;2. Ποια τα πλεονεκτήματα του γονιδιώματος του βακτηρίου E.coli για τη μελέτη του μηχανισμού της αντιγραφής;3. Από πού αρχίζει και που ολοκληρώνεται η αντιγραφή Α) στα βακτήρια, β) στα ευκαρυωτικά κύτταρα; Εντοπίστε διαφορές στην αντιγραφή ευκαρυωτικών - προκαρυωτικών.4. Πώς δημιουργούνται οι «θηλιές» στο μόριο του DNA; Πώς μπορούμε να τις δούμε;5. Αναφέρετε με τη σειρά και αναλυτικά τα ένζυμα που συμμετέχουν στην αντιγραφή, πώς λειτουργεί το καθένα και πώς αντιγράφονται τελικά συγχρόνως οι 2 αντιπαράλληλες αλυσίδες.Σε ποιο στάδιο του κυτταρικού κύκλου γίνεται η αντιγραφή;6. Τι ονομάζουμε επιδιορθωτικά ένζυμα; Τι επιτυχία έχουν αυτά κατά την αντιγραφή στους ευκαρυωτικούς οργανισμούς; Αναφέρετε όσα ξέρετε ονομαστικά.7. Ποιο το πρώτο και ποιο το δεύτερο βήμα για την έκφραση της πληροφορίας που υπάρχει στο DNA;8. Ποιο το κεντρικό δόγμα της βιολογίας κατά τον Crick; Γιατί λέμε σήμερα ότι δεν ισχύει; Τι εννοούμε με τον όρο «γονιδιακή έκφραση»;9. Τι ονομάζουμε γονίδια;Σε ποιες κατηγορίες διακρίνονται; Πόσα περιέχει περίπου ένα σωματικό κύτταρο του ανθρώπου;10. Συνδυάστε κατάλληλα τους όρους: μεταγραφή- κυτταρική διαφοροποίηση, δίνοντας 2 χαρακτηριστικά παραδείγματα.11. Πόσα είδη RNA γνωρίζετε και ποιος ο ρόλος του καθενός; Ποιο είδος RNA και γιατί υπάρχει μόνο στους ευκαρυωτικούς;12. Από ποιο ένζυμο καταλύεται η μεταγραφή του DNA στους προκαρυωτικούς- ευκαρυωτικούς; Πόσα είδη αυτού του ενζύμου γνωρίζετε ότι υπάρχουν; Ποιο οι ρόλοι του στη διαδικασία αυτή;13. Πότε γίνεται η μεταγραφή του DNA; Ποιες άλλες περιοχές ή μόρια παίρνουν μέρος στη μεταγραφή; Που σταματάει η μεταγραφή και πώς;14. Διαφορές μεταγραφής ευκαρυωτικών- προκαρυωτικών (τουλάχιστον 3). 206
  • 37. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης15. Τι ονομάζουμε ασυνεχή ή διακεκομμένα γονίδια και πού τα συναντούμε; Περιγράψτε τη διαδικασία ωρίμανσης του μεταγραφόμενου RNA.16. Ποια η σχέση μεταξύ της μεταγραφόμενης αλυσίδας του DNA και της κωδικής;17. Τι είναι ο γενετικός κώδικας; Πώς κατέληξαν οι επιστήμονες ότι πρόκειται για κώδικα τριπλέτας; Ποια τα βασικά χαρακτηριστικά του και οι τυχόν εξαιρέσεις;18. Τι ονομάζουμε πλαίσιο ανάγνωσης, κωδικόνιο, αντικωδικόνιο;19. Περιγράψτε αναλυτικά τα στάδια της μετάφρασης του RNA σε πρωτεΐνες. Ποιο είναι το μεγαλύτερο χρονικά; Σε ποιο στάδιο του κυτταρικού κύκλου γίνεται η μετάφραση;20. Περιγράψτε τη δομή ενός ριβοσώματος. Πού το συναντάμε και από ποιο μακρομόριο αποτελείται; Τι ρόλο παίζει το ριβόσωμα στην παραπάνω διαδικασία; Τι ονομάζουμε σύμπλοκο έναρξης και τι πολύσωμα; Τι εξυπηρετεί η ταυτόχρονη μετάφραση του RNA από πολλά ριβοσώματα;21. Τι ονομάζουμε κυτταρική διαφοροποίηση, σε ποιους οργανισμούς παρατηρείται και ποιο το αποτέλεσμά της; Τι είδους γονιδιακή ρύθμιση απαιτεί η διαφοροποίηση αυτή;22. Τι είναι τα οπερόνια και που τα συναντούμε; Περιγράψτε τη δομή του οπερονίου της λακτόζης στο E.coli. Πότε βρίσκεται αυτό σε καταστολή και πώς επηρεάζει η καταστολή τη μεταγραφή;23. Ποιος είναι ο επαγωγέας στο οπερόνιο της λακτόζης, τι προκαλεί και τι συμβαίνει όταν σταματήσει να υπάρχει;24. Τι γνωρίζετε για τη γονιδιακή ρύθμιση στους ευκαρυωτικούς οργανισμούς;25. Ποιες διαφορές εντοπίζετε μεταξύ της ρύθμισης ευκαρυωτικών- προκαρυωτικών;26 Τι ορίζεται ως σύμπλοκο έναρξης; 3
  • 38. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Συνδυαστικές ερωτήσεις Θεωρίας1. Να διατυπώσετε (και σχηματικά) το κεντρικό δόγμα της Βιολογίας όπως το περίγραψε ο Crick και όπως περιγράφεται σήμερα.2. Πού βασίζεται το γεγονός ότι η ανθρώπινη ινσουλίνη μπορεί να παραχθεί in vitro και από βακτηριακά κύτταρα;3. Για ποιο σκοπό γίνεται: α) η αντιγραφή του DNA, β) η μεταγραφή και η μετάφραση της γενετικής πληροφορίας του DNA;4. Ποιες οι ιδιότητες και ο ρόλος της DNA-πολυμεράσης;5. Τι χρειάζεται για να γίνει η αντιγραφή του DNA;6. Να περιγράψετε συνοπτικά τη διαδικασία αντιγραφής του DNA στους προκαρυωτικούς οργανισμούς. Ποια ένζυμα συμμετέχουν και ποιος ο ρόλος τους;7. Σε ποιες λειτουργίες του κυττάρου εμφανίζεται η συμπληρωματικότητα των βάσεων;8. Γιατί ο μηχανισμός διπλασιασμού του DNA ονομάζεται ημισυντηρητικός; Ποιοι άλλοι μηχανισμοί έχουν αποκλειστεί;9. Τι αλληλουχίες περιέχουν τα γονίδια των ευκαρυωτικών οργανισμών;10.Ποια ένζυμα καταλύουν το σχηματισμό του 3’-5’ φωσφοδιεστερικού δεσμού; Ποια ένζυμα καταλύουν τη διάσπασή του;11. Με ποιο τρόπο αποφεύγονται τα λάθη κατά την αντιγραφή του DNA;12. Πώς εξασφαλίζεται η πιστότητα της αντιγραφής, της μεταγραφής και της μετάφρασης της γενετικής πληροφορίας;13. Γιατί και οι 2 αλυσίδες του DNA αντιγράφονται πάντα με προσανατολισμό 5’→3’;14. Για ποιους λόγους οι ερευνητές χρησιμοποιούν προκαρυωτικά κύτταρα για τη μελέτη της αντιγραφής του DNA;15. Να συγκρίνετε τις θέσεις έναρξης αντιγραφής στα ευκαρυωτικά και στα προκαρυωτικά κύτταρα. Ποια η σημασία των διαφορών, αν υπάρχουν; 206
  • 39. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης16.Ποιος είναι ο ρόλος του RNA στην αντιγραφή του DNA;17. Σε πόσες κατηγορίες διακρίνονται τα γονίδια;18. Πώς ονομάζεται το RNA που περιέχει τα εσώνια και τα εξώνια;19. Με ποια διαδικασία παράγεται το μικρό πυρηνικό snRNA και ποιος ο ρόλος του;20. Τι χρειάζεται για να γίνει η μεταγραφή; Σε τι διαφέρει το προϊόν της μεταγραφής ανάμεσα σε προκαρυωτικούς- ευκαρυωτικούς;21.Τι είναι ο υποκινητής και οι μεταγραφικοί παράγοντες και ποιος ο ρόλος τους; Σε ποιο βιομόριο και σε ποια κύτταρα εντοπίζονται;22. Ποιες κυτταρικές δομές αποτελούνται αποκλειστικά από νουκλεϊκό οξύ και πρωτεΐνες; Ποια νουκλεοπρωτεϊνικά σύμπλοκα σχηματίζονται στον πυρήνα ενός ευκαρυωτικού κυττάρου;23. Ποιες οι ιδιότητες και ο ρόλος της RNA-πολυμεράσης;24.Ποια είναι η κωδική και ποια η μη κωδική αλυσίδα του DNA;25.Ποια είδη νουκλεϊκών οξέων συναντάμε σε ένα μιτοχόνδριο;26. Ποιες αλληλουχίες του DNA, ενώ δεν μεταγράφονται, κατέχουν σημαντικό ρόλο στην έκφραση ενός γονιδίου;27.Ποια είναι τα μέρη του γονιδίου που δεν περιέχονται στο ώριμο mRNA;28. Ποιες περιοχές του γονιδιώματος ενός ευκαρυωτικού κυττάρου δε μεταφράζονται σε αμινοξέα; Ποιες περιοχές του γονιδιώματος δεν μεταγράφονται;29. Ποιους τύπους RNA γνωρίζετε και ποια η λειτουργία τους;30. Ποιος ο ρόλος του ριβοσώματος στο μηχανισμό της σύνθεσης πρωτεϊνών;31. Ποιες ειδικές θέσεις σύνδεσης φέρει το tRNA;32. Να αναφέρετε και να εξηγήσετε με λίγα λόγια τα βασικά χαρακτηριστικά του γενετικού κώδικα. Γιατί είναι αναγκαστικά «κώδικας τριπλέτας»;33.Η έναρξη της μετάφρασης γίνεται πάντα με την ίδια τριάδα βάσεων. Θα έπρεπε λοιπόν όλες οι πολυπεπτιδικές αλυσίδες να έχουν ίδιο το πρώτο αμινοξύ. Να εξηγήσετε γιατί δε συμβαίνει αυτό. 3
  • 40. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ34. Τι χρειάζεται για να γίνει η μετάφραση; Σε ποιο στάδιο του κυτταρικού κύκλου πραγματοποιείται; Γιατί η πρωτεϊνοσύνθεση χαρακτηρίζεται ως «οικονομική» διαδικασία;35. Τι είναι το κωδικόνιο και τι το αντικωδικόνιο;36. Τι δεσμοί σχηματίζονται κατά την επιμήκυνση της πολυπεπτιδικής αλυσίδας και μεταξύ ποιων βιομορίων;37. Τι περιοχές περιλαμβάνει το ώριμο mRNA και ποιος ο ρόλος τους;38. Η αλληλουχία των αμινοξέων σε μια πολυπεπτιδική αλυσίδα προσδιορίζει επακριβώς και την αλληλουχία των βάσεων του γονιδίου;39. Ποιος είναι ο ρόλος της ρύθμισης της έκφρασης της γενετικής πληροφορίας;40.Να εξηγήσετε το ρόλο των παρακάτω όρων στο οπερόνιο της λακτόζης: υποκινητής, ρυθμιστικό γονίδιο, χειριστής, πρωτεϊνη- καταστολέας.41. Γιατί η γονιδιακή ρύθμιση στους προκαρυωτικούς οργανισμούς είναι απλούστερη των πολυκύτταρων; Ποιες είναι οι βασικές διαφορές στη ρύθμιση;42. Τι ονομάζουμε κυτταρική διαφοροποίηση και πού βασίζεται;43. Εάν σε μια καλλιέργεια E.coli υπάρχει στο θρεπτικό υλικό ως πηγή άνθρακα: α) μόνο γλυκόζη ή β) μόνο λακτόζη, να αναφέρετε σε κάθε περίπτωση τις λειτουργίες του βακτηρίου που θα ενεργοποιηθούν για τη διάσπασή της.44.Ένας επιστήμονας που ερευνούσε τη δομή μιας πρωτεΐνης ανακάλυψε ότι τα αμινοξέα που την αποτελούσαν ήταν πολύ λιγότερα από τις τριπλέτες του γονιδίου που την κωδικοποιούσε. Είναι σωστή η ανακάλυψή του αυτή και γιατί;45. Σε τι συμπέρασμα νομίζεται ότι οδηγεί η παγκοσμιότητα του γενετικού κώδικα;46. Δίνεται το τμήμα του DNA ενός προκαρυωτικού κυττάρου: … GACGACGACGAC… … CTGCTGCTGCTG… Πόσα είναι τα είδη των κωδικονίων και των αμινοξέων αντίστοιχα που κωδικοποιούνται από το παραπάνω τμήμα του DNA; α. 2-1 β. 1-1 γ. 1-4 δ. 2-8 206
  • 41. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης 47. Έχει σημασία, για την πολυπεπτιδική αλυσίδα που θα προκύψει, αν μεταγραφεί η μία ή η άλλη αλυσίδα του DNA;47. Είναι υποχρεωτικό το μόριο του mRNA να βγει στο κυτταρόπλασμα προκειμένου να γίνει η πρωτεϊνοσύνθεση σε ένα ευκαρυωτικό κύτταρο; 49. Σε ποιες φάσεις και ποιες διαδικασίες του κυττάρου συναντούμε: α. μόρια DNA και RNA σε επαφή; β. μόρια RNA και RNA σε επαφή; 3
  • 42. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΑσκήσειςΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΣΤΗ ΜΕΤΑΦΡΑΣΗ 1. Η μετάφραση γίνεται στο κυτταρόπλασμα, στα ριβοσώματα. Το mRNA μεταφράζεται στο ριβόσωμα με τη συμμετοχή του tRNA σε πρωτείνη. Οι 5’ και 3’ περιοχές του mRNA δεν μεταφράζονται και χαρακτηρίζονται ως αμετάφραστες ενώ η περιοχή που μεταφράζεται με κατεύθυνση 5΄3΄ χαρακτηρίζεται ως ανοικτό πλαίσιο ανάγνωσης. Το ανοικτό πλαίσιο ανάγνωσης διαβάζεται από το ριβόσωμα, συνεχόμενα, μη επικαλυπτόμενα, και ανά τριπλέτα. 2. Ένα κωδικόνιο είναι μια τριπλέτα βάσεων που κωδικοποιεί για 1 αμινοξύ. 3. Στην μετάφραση το 1ο αμινοξύ είναι η μεθειονίνη, αλλά δεν έχουν όλες οι πρωτείνες 1 ο αμινοξύ την μεθειονίνη, γιατί μετά την μετάφρασή τους υπόκεινται σε μετα- μεταφραστικές τροποποιήσεις. 4. Όταν μας ζητείται να βρούμε τον αριθμό των αμινοξέων μιας πρωτείνης δεν λαμβάνουμε υπόψιν τις μετα- μεταφραστικές τροποιποιήσεις εκτός και αν η άσκηση δίνει κάποιο στοιχείο. 5. Η μετάφραση στηρίζεται στην συμπληρωματικότητα 6. Η 5΄ αμετάφραστη περιοχή του mRNA είναι συμπληρωματική με την μικρή υπομονάδα του ριβοσώματος Τα αντικωδικόντα του tRNA είναι συμπληρωματικά με τα κωδικόνια του mRNA Το mRNA είναι συμπληρωματικό με την μεταγραφόμενη αλυσίδα του DNA και άρα έχει ομόλογη αλληλουχία βάσων με την κωδική αλυσίδα του DNA 7. Μία πρωτεΐνη, μιας πολυπεπτιδικής αλυσίδας κωδικοποιείται από 1 γονίδιο 8. Μία πρωτεΐνη πολλών ίδιων πολυπεπτιδικών αλυσίδων κωδικοποιείται από 1 γονίδιο 9. Μία αλυσίδα, πολλών διαφορετικών πολυπεπτιδικών αλυσίδων κωδικοποιείται από πολλά γονίδια (όσα και οι πολυπεπτιδικές αλυσίδες) 10. Ο αριθμός των πεπτιδικών δεσμών μιας πολυπεπτιδικής αλυσίδας, ισούται με ν-1 του αριθμού των αμινοξέων. 11. Το μοριακό βάρος μιας πολυπετιδικής αλυσίδας που αποτελείται από ν αμινοξέα με ΜΒ*μ – (μ-1)-18, αφού σε κάθε πεπτιδικό δεσμό, αφαιρείται και ένα μόριο νερού. 206
  • 43. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης 1. Σε ένα μόριο DNA υπάρχουν 12.000 άτομα φωσφόρου. Το μόριο αυτό μεταφέρεται και διπλασιάζεται σε περιβάλλον ραδιενεργού φωσφόρου. Πόσα άτομα ραδιενεργού φωσφόρου θα υπάρχουν μετά τον πρώτο και μετά τον τρίτο διπλασιασμό; Αιτιολογήστε πλήρως την απάντησή σας. 2. Μια πολυπεπτιδική αλυσίδα του βακτηρίου Ε. coli έχει κατά τη σύνθεσή της 50 αμινοξέα. Πόσα νουκλεοτίδια θα έχει το τμήμα του DNA από το οποίο προήλθε; 3. Αλυσίδα του DNA αποτελείται κατά 20% από αδενίνη, 30% από γουανίνη και 20% από θυμίνη. Αν το μόριο αυτό έχει 4.000.000 νουκλεοτίδια, πόσοι δεσμοί υδρογόνου συγκρατούν ενωμένες τις δύο αλυσίδες του DNA; 4. Μόριο βακτηριακού DNA αποτελείται από 306 νουκλεοτίδια. Από πόσα κωδικόνια θα αποτελείται το mRNA που θα συντεθεί; 5. Μόριο DNA διπλασιάζεται σε περιβάλλον ραδιενεργού αζώτου. Πόσες αλυσίδες DNA με ραδιενεργό άζωτο θα υπάρχουν μετά τον πρώτο και πόσες μετά τον τέταρτο διπλασιασμό; 6. Μόριο mRNA που προέρχεται από τη μεταγραφή βακτηριακού DNA αποτελείται κατά 30% από αδενίνη, 30% G, 20% C. Ποια θα είναι η αναλογία των βάσεων στο μόριο από το οποίο προήλθε; 7. Από μια πολυπεπτιδική αλυσίδα ενός βακτηριακού κυττάρου απομακρύνθηκαν 2 αμινοξέα από το αμινικό της άκρο, ώστε τελικά αυτή να αποτελείται από 100 αμινοξέα. Πόσα νουκλεοτίδια θα έχει το τμήμα του DNA που καθόρισε την αλληλουχία των αμινοξέων στην αρχική πολυπεπτιδική αλυσίδα; 8. Δίνεται ένας κλώνος DNA με την εξής αλληλουχία βάσεων: …AAC-CCA-TAC-TTA-CGT…TTT-TTT-TTT-ACT-CCG-AGT-CAT… Να δοθεί ο ορισμός του γονιδίου και του mRNA. Να γράψετε και να αιτιολογήσετε το mRNA που προκύπτει από την παραπάνω αλληλουχία. (Γενικές εξετάσεις 1992) 9. Η κωδική αλυσίδα βακτηριακού DNA έχει την παρακάτω αλληλουχία βάσεων: 5’- ATG-CGT-ACG-…TTT-TAA-3’Α) Ποια είναι η αλληλουχία των βάσεων στη συμπληρωματική αλυσίδα;Β) Ποια είναι η αλληλουχία των κωδικονίων στο mRNA που θα προκύψει από τη μεταγραφόμενηαλυσίδα;Γ) Ποια είναι τα αντικωδικόνια που αντιστοιχούν στα κωδικόνια του mRNA; 3
  • 44. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ10. Το DNA ενός πλασμιδίου έχει 1,2Χ105 φωσφοδιεστ. δεσμούς. Πόσες πρωτεΐνες ΜΒ 40000 θα μπορούσαν να κωδικοποιηθούν; (Μέσο ΜΒ αμινοξέος: 100)11.Η αλληλουχία των αμινοξέων μιας πρωτεΐνης 2 διαφορετικών οργανισμών, που επιτελεί την ίδια λειτουργία και στους 2 οργανισμούς, βρέθηκε όμοια κατά 80%. Όμως τα αντίστοιχα γονίδια των οργανισμών βρέθηκαν να έχουν ομοιότητα κατά 40%. Να δώσεις μια εξήγηση για αυτή τη διαφορά ομοιότητας.12. Βακτηριακό mRNA που έχει 2999 φωσφοδιεστ. δεσμούς κατευθύνει τη σύνθεση πολυπεπτιδικής αλυσίδας που αποτελείται από 989 αμινοξέα. Ποιος ο αριθμός των νουκλεοτιδίων του mRNA που δεν κωδικοποιούν αμινοξέα;13. Ένα τμήμα ενός δίκλωνου DNA με την παρακάτω αλληλουχία παράγει ένα ολιγοπεπτίδιο με πέντε αμινοξέα. Ποιος κλώνος του DNA μεταγράφεται; AAATTGTACCATCTTTAAGGGACTGGGTTT TTTAACATGGTAGAAATTCCCTGACCCAAA14. Ποια πεπτίδια κωδικοποιούνται από το παρακάτω συνθετικό πολυνουκλεοτίδιο σε in vitro σύστημα μετάφρασης; … UUCUUCUUCUUC …(Συμβουλευτείτε το γενετικό κώδικα)15. Δίνεται το τμήμα του ώριμου mRNA που κωδικοποιεί τα πρώτα 5 αμινοξέα στη β- πολυπεπτιδική αλυσίδα της αιμοσφαιρίνης Α: … AGACACCAUGGUGCACCUGACUCC… Α) Να γράψεις τα αντικωδικόνια των tRNA με τη σειρά που συμμετέχουν στη μετάφραση του παραπάνω τμήματος. Β) Να γράψεις την αλληλουχία των νουκλεοτιδίων στο αντίστοιχο τμήμα του γονιδίου. Γ) Να σημειώσεις τα 5’ και 3’ άκρα στο mRNA και στο DNA. Δ) Πόσα νουκλεοτίδια περιλαμβάνονται στο ανοιχτό πλαίσιο ανάγνωσης του παραπάνω τμήματος mRNA; Ε) Ένας ερευνητής κάνοντας ανάλυση στην αλληλουχία των αμινοξέων της β- πολυπεπτιδικής αλυσίδας ποιο αμινοξύ θα βρει πρώτο; Αιτιολογήστε.16.Μια βακτηριακή πρωτεϊνη αποτελείται από 400 αμινοξέα και περιλαμβάνει 2 όμοιες πολυπεπτιδικές αλυσίδες. Α) Πόσα είδη είναι υπεύθυνα για τη σύνθεση της πρωτεΐνης; Β) Από πόσα νουκλεοτίδια αποτελείται το ανοιχτό πλαίσιο ανάγνωσης; Γ) Από πόσα νουκλεοτίδια αποτελείται το αντίστοιχο τμήμα στο γονίδιο;17. Δίνεται η κωδική αλυσίδα του βακτηριακού DNA: ACATCGTAACCG Να εξηγήσετε δίνοντας τα κατάλληλα σχήματα: α) Ποιο θα είναι το μόριο που θα προκύψει από την αντιγραφή του DNA. β) Ποιο θα είναι το mRNA που θα προκύψει. γ) Να γράψετε τα αντικωδικόνια που αντιστοιχούν σ΄αυτό το μόριο του DNA. 206
  • 45. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης 18. Δίνονται οι βάσεις από τα μόρια DNA, mRNA και αντικωδικόνια tRNA καθώς και τα αμονοξέα που αντιστοιχούν. Συμπληρώστε τον πίνακα και βρείτε ποια αντικωδικόνια αντιστοιχούν στα αμινοξέα σερίνη, και ιστιδίνη αντίστοιχα. Α) UGT, GTT B)CCA, UGG Γ) AGU, GUA Δ) AGU, GUU Δίκλωνο Τ μόριο G T A DNA mRNA C A C tRNA A C C G C A αμινοξέα σερίνη τρυπτοφάνη ιστιδίνη γλυκίνη 19. Ο παρακάτω πίνακας δείχνει την επί τοις εκατό αναλογία βάσεων, ανά αλυσίδα, σε μόριο DNA και στο mRNA που μεταγράφηκε από αυτό. Ποια από τις δύο αλυσίδες του DNA μεταγράφηκε; DNA A G C T U πρώτη αλυσίδα 17 27 32 24 δεύτερη αλυσίδα 24 32 27 17 mRNA 24 32 27 17 20.Μια πρωτεΐνη αποτελείται από 120 αμινοξέα και κωδικοποιείται από γονίδιο 1000 ζευγών βάσεων. Το σύνολο των νουκλεοτιδίων των 3΄ και 5΄ αμετάφραστων περιοχών είναι 54 και το γονίδιο αποτελείται από 27 εσώνια. Α) Να βρείτε το συνολικό μήκος των εσωνίων και των εξωνίων αντίστοιχα. Β) Πόσα μόρια νερού έχασε συνολικά το κύτταρο κατά τη διαδικασία της ωρίμανσης; γ) Ποιο ποσοστό του ώριμου mRNA αποτελεί το τμήμα που κωδικοποιεί αμινοξέα; 21. Δίνονται βάσεις από τα μόρια DNA, mRNA και αντικωδικόνια tRNA, καθώς και τα αμινοξέα που αντιστοιχούν. Συμπληρώστε τον πίνακα και βρείτε ποια αντικωδικόνια αντιστοιχούν στα αμινοξέα σερίνη και γλουταμίνη, αντίστοιχα. α. UGT, GTT β. CCA, UGG γ. AGU, GUA δ. AGU, GUA Δίκλωνο T μόριο G T A DNA mRNA C A C tRNA A C C C C Aαμινοξέα σερίνη τρυπτοφάνη γλουταμίνη γλυκίνη 3
  • 46. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΕρωτήσεις Πολλαπλής Επιλογής1. Η μεταγραφή του DNA στο ευκαρυωτικό κύτταρο γίνεται: α. στον πυρήνα β. στο μιτοχόνδριο γ. στο κυτταρόπλασμα δ. όπου υπάρχει DNA2. Στη μετάφραση δε χρειάζεται: α. το DNA β. τα ριβοσώματα γ. ένζυμα δ. tRNA3. Το snRNA το συναντούμε: α. στα ημιαυτόνομα οργανίδια β. στο κυτταρόπλασμα γ. στο προκαρυωτικό κύτταρο δ. στον πυρήνα4. Το κωδικόνιο το συναντούμε: α. στο rRNA β. στο tRNA γ. στο mRNA δ. σε όλα τα RNA5. Εκφυλισμός του γενετικού κώδικα σημαίνει ότι: α. είναι κοινός για όλους τους οργανισμούς β. κάθε κωδικόνιο κωδικοποιεί ένα ή περισσότερα αμινοξέα γ. κάθε αμινοξύ κωδικοποιείται από ένα ή περισσότερα κωδικόνια δ. κάθε οργανισμός έχει τις ίδιες κατηγορίες RNA6. Κατά την αντιγραφή: α. το DNA ανοίγει σε πολλά σημεία 206
  • 47. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης β. συμμετέχουν οι RNA πολυμεράσες γ. δεν απαιτείται ενέργεια δ. συντίθεται μία θυγατρική αλυσίδα για κάθε μόριο DNA7. Η μεταγραφή οδηγεί: α. στη σύνθεση μιας πολυπεπτιδικής αλυσίδας β. στο διπλασιασμό του γενετικού υλικού γ. στη σύνθεση γονιδίων δ. σε κανένα από τα παραπάνω8. Οι « υποκινητές » βρίσκονται: α. στο mRNA β. προσδεμένοι στους μεταγραφικούς παράγοντες γ. στο DNA δ. στα ριβοσώματα9. Ως πλαίσιο ανάγνωσης ορίζουμε: α. το μεταγραφόμενο τμήμα του DNA β. το RNA που προκύπτει από τη διαδικασία « ωρίμανσης » γ. το τμήμα του mRNA από το κωδικόνιο έναρξης έως το κωδικόνιο λήξης με βήμα τριπλέτας δ. όλα τα παραπάνω10.Πολύσωμα είναι: α. το οργανίδιο που συμμετέχει στην πρωτεϊνοσύνθεση β. ομάδα ριβοσωμάτων στο ενδοπλασματικό δίκτυο γ. το σύνολο των εξωνίων του μεταγραφόμενου DNA δ. το σύμπλεγμα των ριβοσωμάτων με το mRNA11. Το οπερόνιο είναι μια ομάδα γονιδίων που, εκτός από τα δομικά γονίδια, περιέ-χει α. τον υποκινητή και το ρυθμιστικό γονίδιο β. το χειριστή και το ρυθμιστικό γονίδιο γ. το ρυθμιστικό γονίδιο, τον υποκινητή και το χειριστή δ. τον υποκινητή και το χειριστή.12. Στο ρυθμιστικό μηχανισμό διάσπασης της λακτόζης ο καταστολέας του οπε-ρονίου τηςλακτόζης είναι 3
  • 48. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ α. μια αλληλουχία δεοξυριβονουκλεοτιδίων β. μια αλληλουχία αμινοξέων γ. το mRNA που προέρχεται από τη μεταγραφή του ρυθμιστικού γονιδίου δ. ο δισακχαρίτης λακτόζη.13. Ποιο από τα παρακάτω αποτελείται από DNA; α. οι μεταγραφικοί παράγοντες β. ο υποκινητής γ. το πριμόσωμα δ. η DNA πολυμεράση.14. Ποιο από τα παρακάτω αποτελείται από RNA; α. ο υποκινητής β. ο χειριστής γ. τα πρωταρχικά τμήματα δ. η RNA πολυμεράση.15. Η γενετική πληροφορία μεταφέρεται στα ριβοσώματα με: α. πρωτεΐνες β. DNA γ. RNA δ. λιπίδια.16. Τα μόρια με τα οποία μεταφέρονται οι γενετικές πληροφορίες από κύτταρο σε κύτταρο, σεέναν οργανισμό είναι: α. πρωτεΐνες β. DNA γ. RNA δ. τίποτε από τα πιο πάνω.17. Τα μόρια με τα οποία μεταφέρονται οι γενετικές πληροφορίες από ένα οργανισμό στουςαπογόνους του είναι: α. πρωτεΐνες β. DNA γ. RNA δ. λιπίδια και πολυσακχαρίτες.18. Ο τύπος του RNA, που βρίσκεται σε μεγαλύτερη συγκέντρωση στο κύτταρο, είναι το α. mRNA β. tRNA γ. rRNA δ. snRNA19. Στα προκαρυωτικά κύτταρα έχουν εντοπιστεί α. mRNA, snRNA, tRNA 206
  • 49. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης β. m RNA, rRNA, snRNA γ. tRNA, rRNA , mRNA δ. snRNA, tRNA, rRNA.20. Οι υποκινητές είναι ειδικές περιοχές του DNA, που α. γίνεται η πρόσδεση της DNA πολυμεράσης β. αποτελούν το σημείο έναρξης της αντιγραφής του DNA γ. γίνεται η πρόσδεση της RNA πολυμεράσης δ. βρίσκονται πριν από το ρυθμιστικό γονίδιο.21. Οι μεταγραφικοί παράγοντες α. είναι ρυθμιστικά στοιχεία αντιγραφής του DNA β. είναι ειδικές περιοχές του DNA που πρόκειται να γίνει η μεταγραφή γ. επιτρέπουν στην RNA πολυμεράση τη σωστή έναρξη της μεταγραφής δ. είναι πρωτεΐνες, οι οποίες ρυθμίζουν τη μεταγραφή του DNA.22. Ο όρος κωδικόνιο αναφέρεται α. σε μια τριάδα νουκλεοτιδίων του γονιδίου και του mRNA β. μόνο σε μια τριάδα νουκλεοτιδίων έναρξης ή λήξης του mRNA γ. στα συνώνυμα αμινοξέα του γονιδίου δ. στα αμινοξέα που κωδικοποιούνται από τρία νουκλεοτίδια του mRNA.23. Η πρώτη τριάδα των νουκλεοτιδίων του mRNA είναι η α. AGU β. AUG γ. UGA δ. UAG24. Στην πρώτη τριάδα των νουκλεοτιδίων του mRNA προσδένεται το μεταφορικό RNA, πουμεταφέρει την α. κυστεΐνη β. λευκίνη γ. αλανίνη δ. μεθειονίνη. 3
  • 50. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ25. Κατά την επιμήκυνση της πολυπεπτιδικής αλυσίδας τα διαδοχικά αμινοξέα συνδέονται μεταξύτους με α. πεπτιδικό δεσμό β. ιοντικούς δεσμούς γ. υδροφόβους δεσμούς δ. δυνάμεις Van der Waals.26. Κατά την πρωτεϊνοσύνθεση το ριβόσωμα μετακινείται από α. το 5΄ προς το 3΄ άκρο του mRNA β. το 3΄ προς το 5΄ άκρο του mRNA γ. το κωδικόνιο UAG προς το κωδικόνιο AUG του m RNA δ. το κωδικόνιο AGU προς το κωδικόνιο UAG του m RNA.27. Στο βακτήριο E. coli, επαγωγέας για τη μεταγραφή των γονιδίων που κωδι-κοποιούν τησύνθεση των ενζύμων για τη διάσπαση της λακτόζης, είναι α. η λακτόζη β. η πρωτεΐνη – καταστολέας γ. ο υποκινητής δ. ένα ρυθμιστικό γονίδιο.28. Στην E. coli, το mRNA, που προκύπτει κατά τη μεταγραφή του οπερονίου της λακτόζης, α. μεταφράζεται σε τρία ένζυμα απαραίτητα για τη διαδικασία αποικοδόμησης της β. μεταφράζεται σε πρωτεΐνη καταστολέα της λακτόζης γ. ενεργοποιείται από τον επαγωγέα του οπερονίου της λακτόζης δ. μεταφράζεται σε RNA πολυμεράση του οπερονίου της λακτόζης.29. Για να γίνει η μεταγραφή του οπερονίου της λακτόζης πρέπει να α. συνδεθεί ο επαγωγέας με την πρωτεΐνη καταστολέα β. διεγερθεί η ενζυμική αντίδραση της RNA πολυμεράσης στον υποκινητή γ. εισέλθει η λακτόζη στο κύτταρο της E. coli δ. συνδεθεί με τον καταστολέα το ρυθμιστικό γονίδιο.30. Ποια από τις παρακάτω φράσεις δεν ισχύει:α. Στα ευκαρυωτικά κύτταρα η γονιδιακή έκφραση ρυθμίζεται σε τέσσερα επίπεδα.β. Το DNA των ευαρυωτικών οργανισμών δεν οργανώνεται σε οπερόνια.γ. Η RNA πολυμεράση προσδένεται στον ρυθμιστή αναγνωρίζοντας ένα μοναδικό συνδυασμό μεταγραφικών παραγόντων.δ. Κάθε ευκαρυωτικό γονίδιο διαθέτει το δικό του υποκινητή.31. Κατά την μεταγραφή των γονιδίων του οπερονιού της λακτόζης, το μόριο της λακτόζης λειτουργεί ωςα. υποκινητής,β. καταστολέας,γ. επαγωγέας,δ. χειριστής 206
  • 51. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης32. Το σύμπλεγμα των ριβοσωμάτων με το mRNA κατά την πρωτεϊνοσύνθεση ονομάζεταια. σύμπλοκο έναρξης,β. σύμπλοκο λήξης, γ. πολυριβόσωμα,δ. πολύσωμα33. Κατά την αντιγραφή του DNA τα κομμάτια της ασυνεχούς αλυσίδας συνδέονται μεταξύ τους με τη βοήθεια του ενζύμουα. DNA πολυμεράση,β. επιδιορθωτικό ενζύμο,γ. DNA δεσμάση,δ. πριμόσωμα 34. Τα διπλασιασμένα χρωμοσώματα κατά το χρονικό διάστημα που είναι συνδεδεμένα στο κεντρομερίδιο περιγράφονται με τον όροα. διπλοειδή, β. αδελφές χρωματίδες,γ. απλοειδή, δ. ζεύγη χρωμοσωμάτων35. Ποια από τις παρακάτω προτάσεις δεν ισχύει για την RNA πολυμεράση;α. Αποτελείται από αμινοξέα.β. Αποτελείται από ριβονουκλεοτίδια.γ. Συντίθεται στα ριβοσώματα.δ. Η πληροφορία για τη σύνθεσή της βρίσκεται στο DNA.36. Τα μόρια t – RNA που χρησιμοποιούνται κατά τη μετάφραση:α. κατασκευάζονται στα ριβοσώματα αφού είναι ένζυμα,β. διαθέτουν μια τριάδα νουκλεοτιδίων, το κωδικόνιο, που συνδέεται με αντίστοιχη τριάδα νουκλεοτιδίων του m – RNA,γ. με τα αντικωδικόνια τους έρχονται σε συμπληρωματικότητα με τη μικρή υπομονάδα του ριβοσώματος,δ. περιέχουν την αντικωδική τριπλέτα με την οποία πρσδένονται στο αντίστοιχο κωδικόνιο του mRNA.37. Τα ένζυμα που ευθύνονται για το ξετύλιγμα του DNA στις θέσεις έναρξης της αντιγραφής ονομάζονται;α. DNA πολυμεράσες,β. RNA πολυμεράσες,γ. DNA δεσμάσες,δ. DNA ελικάσες.38. Η έναρξη της μετάφρασης ξεκινά από την τριπλέτα:α. AUG, 3
  • 52. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ β. AGU,γ. UAG,δ. UGA.39. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του mRNA στην μικρή υπομονάδα του ριβοσώματος και του tRNA, που μεταφέρει την μεθειονίνη, ονομάζεται:α. πολύσωμα,β. σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης,γ. σύμπλοκο λήξης της πρωτεϊνοσύνθεσης,δ. σύμπλοκο μετάφρασης. 206
  • 53. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΝα χαρακτηρίσετε τις παρακάτω προτάσεις ως Σωστές ή Λανθασμένες 3
  • 54. 1. Κάθε κωδικόνιο του tRNA έχει αντικωδικόνιο στο mRNA. ()2. Στα κωδικόνια λήξης αντιστοιχούν τα αμινοξέα Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ βαλίνη, αλανίνη ή μεθειονίνη. ()3. Στα προκαρυωτικά κύτταρα η έναρξη της σύνθεσης ενός δευτέρου μορίου () πρωτεΐνης μπορεί να αρχίσει πριν ολοκληρωθεί η σύνθεση του πρώτου μορίου της πρωτεΐνης.4. Στους ευκαρυωτικούς οργανισμούς το οπερόνιο της λακτόζης κωδι-κοποιεί τα () ένζυμα που συμμετέχουν στη διάσπαση της λακτόζης.5. Στο οπερόνιο της λακτόζης της E. coli περιλαμβάνονται τα δομι-κά γονίδια, το () ρυθμιστικό γονίδιο, ο υποκινητής και ο χειριστής.6. Στην E. coli το ρυθμιστικό γονίδιο του οπερονίου της λακτόζης, κωδικοποιεί τη () σύνθεση του καταστολέα της λακτόζης.7. Στην E. coli η μεταγραφή του οπερονίου της λακτόζης διακόπτε-ται όταν () διασπαστεί όλη η λακτόζη.8. Στα διαφοροποιημένα κύτταρα ενός πολυκύτταρου οργανισμού μεταγράφονται () διαφορετικά γονίδια.9. Στα προκαρυωτικά κύτταρα η πρωτεΐνη αρχίζει να μεταφράζεται πριν () ολοκληρωθεί η μεταγραφή του αντίστοιχου γονιδίου σε mRNA.10. Στα ευκαρυωτικά κύτταρα η ύπαρξη της πυρηνικής μεμβράνης έχει ως () συνέπεια να ολοκληρώνεται η μεταγραφή και η μεταφορά του m RNA στο κυτταρόπλασμα, πριν αρχίσει η διαδικασία της μετάφρασης.11. Το ποσό του RNA σε ένα κύτταρο είναι σταθερό γιατί σχηματίζε-ται από το () DNA. 20612. Κατά τον διπλασιασμό του DNA, η DNA πολυμεράση αναγνωρί-ζει και () τοποθετεί τα νουκλεοτίδια στη σωστή τους θέση.
  • 55. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης1. Τα κύρια ένζυμα που παίρνουν μέρος στην αντιγραφή του DNA είναι οι DNA πολυμεράσες.2. Αντίστροφη αντιγραφή λέγεται η διαδικασία που παρατηρείται σε κάποιους ιούς, οι οποίοι με καλούπι το RNA, που έχουν ως γενετικό υλικό, συνθέτουν DNA.3. Το mRNA είναι το περισσότερο άφθονο από τα είδη RNA του κυττάρου.4. Ο μηχανισμός της μεταγραφής διαφέρει στους ευκαρυωτικούς και προκαρυωτικούς οργανισμούς.5. Ο γενετικός κώδικας είναι μη επικαλυπτόμενος, δηλαδή κάθε νουκλεοτίδιο ανήκει σε ένα μόνο κωδικόνιο.6. Η αλυσίδα εκείνη του DNA που μεταγράφεται ονομάζεται κωδική.7. Μικρό πυρηνικό RNA ονομάζεται εκείνο το RNA το οποίο συνδέεται με πρωτεΐνες και συμμετέχει στην « ωρίμανση » του mRNA.8. Το snRNA το συναντούμε σε όλους τους οργανισμούς.9. Τα ριβονουκλεοπρωτεϊνικά σωματίδια αποτελούνται από snRNA και πρωτεΐνες και λειτουργούν ως ένζυμα.10. Λέγοντας ότι ο γενετικός κώδικας είναι εκφυλισμένος, εννοούμε ότι σε κάθε κωδικόνιο αντιστοιχούν περισσότερα του ενός αμινοξέα.11. Η διαδρομή με βήμα τριπλέτας από το κωδικόνιο έναρξης έως το κωδικόνιο λήξης ονομάζεται πλαίσιο ανάγνωσης. 3
  • 57. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΔιδακτικοί στόχοι • Να περιγράφεις τα στάδια παραγωγής μιας γονιδιωματικής βιβλιοθήκης και μιας c DNA βιβλιοθήκης • Να βρίσκεις ομοιότητες και διαφορές ανάμεσα στα είδη των δύο βιβλιοθηκών • Να επισημάνεις την χρήση της τεχνικής PCR σε σχέση με την χρήση των βιβλιοθηκών • Να αναφέρεις τον φυσιολογικό ρόλο των περιοριστικών ενδονουκλεασών και τον ρόλο τους στην τεχνολογία του ανασυνδυασμένου DNA. • Να διαχωρίζεις τους όρους σε ερωτήσεις πολλαπλής επιλογής • Να απαριθμείς τα απαραίτητα στοιχεία (ρυθμιστικές αλληλουχίες, ένζυμα, παράγοντες) προκειμένου μια ευκαρυωτική πρωτεΐνη να εκφράζεται σε βακτήριο. • Να βρίσκεις πλεονεκτήματα μειονεκτήματα στην χρήση πλασμιδίων και ιών ως φορείς κλωνοποίησης • Να αναφέρεις τις απαραίτητες αλληλουχίες ενός πλασμιδίου ώστε να είναι αποδοτικός φορέας κλωνοποίησης . • Να επιλύεις συνδυαστικά προβλήματα πέψης με περιοριστικές ενδονουκλεάσες και εύρεσης φωσφωδιεστερικών δεσμών και δεσμών υδρογόνου (Κεφάλαιο 1) 3
  • 58. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΕπισημάνσεις Θεωρίας Λόγω της συμπληρωματικότητας των αλυσίδων του DNA οι ενδονουκλεάσες περιορισμού κόβουν και τις δύο αλυσίδες. Οι νουκλεοτιδικές αλληλουχίες που αναγνωρίζονται είναι συνήθως παλίνδρομα, που σημαίνει ότι οι αλληλουχίες στις δύο αλυσίδες του DNA είναι οι ίδιες στο σημείο αναγνώρισης. Συχνά το σημείο αναγνώρισης είναι τέτοιο ώστε να δημιουργούνται μετά το κόψιμο μονόκλωνες συμπληρωματικές ουρές στο DNA. Στρατηγική κλωνοποίησης Σε μία διαδικασία κλωνοποίησης, υπάρχουν τρία βασικά βήματα: Επιλογή του υλικού που θέλουμε να κλωνοποιήσουμε. Π.χ. ανάλογα με το πρόβλημα πουεπιχειρούμε να λύσουμε, μπορούμε να κλωνοποιήσουμε χρωμοσωμικό DNA ή cDNA. Η βασικήδυσκολία που αντιμετωπίζει κανείς όταν θέλει να κλωνοποιήσει κάποιο γονίδιο απόχρωμοσωμικό DNA, είναι ότι ένα γονίδιο αντιπροσωπεύει συνήθως ένα ελάχιστο ποσοστό τουσυνολικού DNA. Στην περίπτωση αυτή είναι προτιμότερο να κλωνοποιήσει κανείς κατευθείαντα mRNA από κάποιον ιστό που να εκφράζει το γονίδιο που τον ενδιαφέρει.Παραγωγή υλικού και κατασκευή της κατάλληλης βιβλιοθήκης.Ανίχνευση μέσα από τη βιβλιοθήκη της αλληλουχίας που μας ενδιαφέρει. Όπως θα δούμε, ωςανιχνευτής μπορεί να χρησιμοποιηθεί ένα συμπληρωματικό νουκλεϊκό οξύ, του οποίου είτεγνωρίζουμε μέρος της αλληλουχίας είτε τη συμπεραίνουμε από την αμινοξική αλληλουχία τηςκαθαρής πρωτεΐνης. Υβριδοποίηση νουκλεϊκών οξέων Όταν ένα υδατικό διάλυμα DNA θερμανθεί στους 100οC ή εκτεθεί σε πολύ αλκαλικό pH (pH 13), σπάζουν οι υδρογονικοί δεσμοί ανάμεσα στις συμπληρωματικές βάσεις των δύο αλυσίδων και το DNA αποδιατάσσεται. Η αποδιάταξη, κάτω από ορισμένες συνθήκες, είναι φαινόμενο αντιστρεπτό. Αν π.χ. οι μονόκλωνες συμπληρωματικές αλυσίδες DNA μείνουν για αρκετό διάστημα στους 65οC παρουσία ρυθμιστικού διαλύματος που περιέχει αλάτι, επανασχηματίζονται διπλές έλικες με υβριδοποίηση (αναδιάταξη ή ανασύνδεση). Αντιδράσεις 206
  • 59. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης υβριδοποίησης μπορούν να συμβούν ανάμεσα σε οποιονδήποτε συνδυασμό δύο αλυσίδων νουκλεϊκών οξέων (DNA:DNA, RNA:RNA, DNA:RNA). Επειδή η ταχύτητα της υβριδοποίησης εξαρτάται από τη συχνότητα σύγκρουσης δύο συμπληρωματικών αλυσίδων, μπορούμε να μετρήσουμε τη συγκέντρωση των μορίων του DNA που περιέχουν μια συγκεκριμένη αλληλουχία από την ταχύτητα με την οποία αυτό το DNA υβριδοποιείται με κάποιο ραδιενεργό κλωνοποιημένο DNA που είναι συμπληρωματικό του και χρησιμοποιείται ως ανιχνευτής (probe). Με τον τρόπο αυτό μπορεί κανείς να ανιχνεύσει ακόμα και συμπληρωματικές αλληλουχίες που υπάρχουν σε συγκέντρωση του ενός μορίου ανά κύτταρο. Τέτοιου είδους μελέτες είναι που οδήγησαν στο συμπέρασμα ότι, ενώ οι περισσότερες αλληλουχίες υπάρχουν σε ένα ή λίγα αντίγραφα ανά απλοειδές γονιδίωμα, άλλες συναντώνται σε εκατοντάδες ή χιλιάδες αντίγραφα. Ομοιότητες – διαφορές γονιδιωματικής βιβλιοθήκης και c DNA βιβλιοθήκης. ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΒΙΒΛΙΟΘΗΚΗ c DNA ΒΙΒΛΙΟΘΗΚΗ Απομονώνεται το ολικό DNA του οργανισμού Απομονώνεται ολικό m RNA του οργανισμού από κύτταρο που εκφράζει την επιθυμητή πρωτεΐνηΠεριέχει όλη την ποσότητα του γενετικού υλικού Δεν περιέχει: γονίδια που δεν εκφράζονται ρυθμιστικές αλληλουχίες εσώνια γονίδια παράγουν r RNA t RNA junk DNAΧρησιμοποιείται για την αξιολόγηση αλληλουχιών Χρησιμοποιείται για την παραγωγή πρωτεϊνών Χρησιμοποιούνται: DNA δεσμάση Χρησιμοποιούνται: Αντίστροφη μεταγραφάση περιοριστική ενδονουκλεάση DNA δεσμάση πολυμεράση περιοριστική ενδονουκλεάση πολυμεράση 3
  • 60. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Ερωτήσεις Θεωρίας1. Ποια γεγονότα βοήθησαν τους ερευνητές στην ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA; Τι είναι και πού βρίσκει εφαρμογή;2. Τι ονομάζουμε Γενετική μηχανική και ποιους στόχους σκοπεύει να πετύχει;3. Ποια είναι αναλυτικά τα στάδια της τεχνολογίας του ανασυνδυασμένου DNA;4. Να δώσετε σύντομα τους παρακάτω ορισμούς: κλώνος, κλωνοποίηση, φορέας κλωνοποίησης, μετασχηματισμός.5. Τι γνωρίζετε για τις περιοριστικές ενδονουκλεάσες; Πώς δρουν στα πλασμίδια και πώς στο γονιδίωμα των ευκαρυωτικών οργανισμών; Δώστε ένα παράδειγμα ενδονουκλεάσης.6. Περιγράψτε τα στάδια δημιουργίας μιας γονιδιωματικής βιβλιοθήκης. Ποια βασικά ένζυμα συμμετέχουν κατά τη δημιουργία τέτοιων βιβλιοθηκών;7. Πώς μπορεί να γίνει επιλογή των επιθυμητών «μετασχηματισμένων» βακτηρίων; Πώς επιλέγεται στη συνέχεια ένας επιθυμητός κλώνος;8. Ποιους φορείς κλωνοποίησης γνωρίζετε και ποιες οι διαφορές τους;9. Περιγράψτε τα στάδια δημιουργίας μιας cDNA βιβλιοθήκης (και με σχήμα). Ποια βασικά ένζυμα συμμετέχουν στη δημιουργία τέτοιων βιβλιοθηκών;10. Ποιες οι διαφορές στα βήματα δημιουργίας της γονιδιωματικής με τη cDNA βιβλιοθήκη; 11.Τι είναι η μέθοδος PCR, ποιο το πρωτοποριακό της στοιχείο και ποιες οι εφαρμογές της; 12. Τι ορίζεται ως υβριδοποίηση και τι ως ιχνηθλετιση; 13.Ποιοι οι λόγοι δημιουργίας μιας γονιδιωματικής βιβλιοθήκης και ποιοι οι λόγοι δημιουργίας μιας c DNA βιβλιοθήκης; 206
  • 61. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΣυνδυαστικές Ερωτήσεις Θεωρίας 1. Πού βρίσκει εφαρμογές η ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA; 2. Γιατί χρησιμοποιούμε την ίδια περιοριστική ενδονουκλεάση για να κόψουμε το DNA του δότη και το DNA του πλασμιδίου-φορέα; 3. Ποιος ο ρόλος της DNA-δεσμάσης στη διαδικασία σχηματισμού του ανασυνδυασμένου DNA; 4. Από πού απομονώθηκε η EcoRI, και ποια ειδική αλληλουχία δίκλωνου DNA αναγνωρίζει; 5. Από όσα γνωρίζετε, ποιος νομίζετε ότι είναι ο φυσιολογικός ρόλος του πλασμιδίου σε ένα βακτήριο; 6. Δώστε τους ορισμούς: κλωνοποίηση, αποδιάταξη, υβριδοποίηση, μετασχηματισμός, ανασυνδυασμένο μόριο DNA. 7. Πώς θα μπορούσαμε να δούμε εάν ένα φυτό έχει μολυνθεί από ρετροϊό (RNA ιός); 8. Ποια τα στάδια παραγωγής του ανασυνδυασμένου DNA; 9. Γιατί πιστεύετε ότι η απομόνωση των περιοριστικών ενδονουκλεασών έχει συμβάλει μέγιστα στην ανάπτυξη της Γενετικής Μηχανικής; 10. Με ποιο τρόπο γίνεται ανίχνευση των κλώνων από γονιδιωματική βιβλιοθήκη; 11. Τι είδους βιβλιοθήκη θα κατασκευάσουμε για να μελετήσουμε τον υποκινητή ενός γονιδίου; Α) Να αιτιολογήσεις την απάντηση, Β) Πώς θα γίνει η επιλογή του βακτηριακού κλώνου που περιέχει τον υποκινητή; Γ) Πώς θα γίνει η απομόνωση του υποκινητή; 12.Γιατί κατά το σχηματισμό της γονιδιωματικής βιβλιοθήκης δεν απομονώνουμε mRNA, αλλά χρησιμοποιούμε το DNA των κυττάρων ενός οργανισμού; 13.Τι χρειάζεται για την κατασκευή μιας γονιδιωματικής βιβλιοθήκης; 14.Γιατί τα πλασμίδια φορείς του DNA του δότη εισάγονται σε βακτήρια-ξενιστές που δεν έχουν πλασμίδια και είναι ευαίσθητα σε αντιβιοτικά; 3
  • 62. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ15. Ένα γονίδιο ενσωματώθηκε σε ένα πλασμίδιο και με αυτό μετασχηματίστηκε ένα βακτήριο. Όμως το γονίδιο δεν εκφραζόταν. Μπορείτε να σκεφτείτε μερικούς λόγους γι’ αυτό;16. Να γράψετε 2 μεθόδους παραγωγής αντιγράφων μιας αλληλουχίας νουκλεοτιδίων ενός μορίου DNA. Σε τι πλεονεκτεί η μία έναντι της άλλης;17. Να περιγραφούν τα στάδια της κλωνοποίησης ανασυνδυασμένου DNA στο βακτηριοφάγο λ.18. Ποια είναι τα πλεονεκτήματα και ποια τα μειονεκτήματα της χρησιμοποίησης των πλασμιδίων στην τεχνολογία του ανασυνδυασμένου DNA;19. Ποια είναι τα πλεονεκτήματα και ποια τα μειονεκτήματα της χρησιμοποίησης των ιών στην τεχνολογία του ανασυνδυασμένου DNA;20. Σε ένα ευκαρυωτικό κύτταρο ένα γονίδιο είναι υπεύθυνο για την παραγωγή μιας πρωτεΐνης 148 αμινοξέων. Αν το ίδιο γονίδιο κλωνοποιηθεί σε ένα βακτηριακό πληθυσμό, θα παραχθεί η ακριβής πρωτεϊνη; Να αιτιολογήσετε τη απάντησή σας.21. Παρατηρήθηκε ότι οι κλώνοι ενός μορίου DNA αποχωρίζονται στη θερμοκρασία των 1000. Οι παρατηρήσεις έδειξαν ότι οι 2 κλώνοι παραμένουν ανέπαφοι. Αυτό το φαινόμενο ονομάστηκε αποδιάταξη της νουκλεοτιδικής αλυσίδας.A. Πώς δρα η θερμοκρασία στο DNA για να γίνει η αποδιάταξη των κλώνων;B. Σε ορισμένες περιπτώσεις παρατηρήθηκε ότι η αποδιάταξη είναι φαινόμενο αντιστρεπτό. Ποια σημαντική μέθοδος για τη σύγχρονη Βιολογία ανακαλύφθηκε, που βασίζεται αφενός στην ιδιότητα της αποδιάταξης των κλώνων και αφετέρου στην ιδιότητα της επανένωσής τους;22. Αν δυο μόρια DNA έχουν την αλληλουχία που φαίνεται παρακάτω να εξηγήσετε ποιο πιστεύετε ότι θα υποστεί πιο εύκολη αποδιάταξη. a. TTACATGTCAATGAA B. CACGGCGCCATCACG AATGTACAGTTACTT GTGCCGCGGTAGTGC23. Τι μας επιτρέπει η μέθοδος της αλυσιδωτής αντίδρασης πολυμεράσης και πού χρησιμοποιείται;24. Στην διαδικασία κατασκευής του ανασυνδυασμένου DNA ποιος είναι ο ρόλος των A. Πλασμιδίων B. Βακτηρίων C. Περιοριστικών ενδονουκλεασών D. Της DNA δεσμάσης25. Σε ένα μαμούθ ηλικίας 40.000 ετών βρέθηκε DNA. Ποια μέθοδος πιστεύετε ότι θα χρησιμοποιηθεί από τους ερευνητές προκειμένου να πολλαπλασιαστεί το DNA και να μελετηθεί από τους ερευνητές; 206
  • 63. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης 3
  • 64. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΕρωτήσεις πολλαπλής επιλογής 1. Η μέθοδος PCR είναι μία τεχνική με την οποία: α. πολλαπλασιάζεται ταχύτατα τμήμα DNA στο εργαστήριο β. υβριδοποιείται μόριο DNA γ. πολλαπλασιάζονται ταχύτατα βακτήρια δ. ολοκληρώνεται ο ανασυνδυασμός του DNA 2. Για να συνδεθεί το κομμάτι του DNA του δότη με τον φορέα κλωνοποίησης, χρησιμοποιείται το ένζυμο: α. περιοριστική ενδονουκλεάση β. αντίστροφη μεταγραφάση γ. DNA δεσμάση δ. DNA πολυμεράση3. Τα γονίδια των αλυσίδων των αιμοσφαιρινών εκφράζονται: α. στα λεμφοκύτταρα β. στα πρόδρομα ερυθροκύτταρα γ. στα κύτταρα του παγκρέατος δ. στα νευρικά κύτταρα 4. Το βασικό ένζυμο για τη σύνθεση του cDNA είναι: α. η περιοριστική ενδονουκλεάση β. η DNA δεσμάση γ. η αντίστροφη μεταγραφάση δ. η DNA ελικάση.5. Τμήμα νουκλεϊκού οξέος που χρησιμοποιείται για να γίνει επιλογή ενός βακτηριακού κλώνουπου περιέχει το επιθυμητό γονίδιο, ονομάζεται: α. φορέας κλωνοποίησης β. ανιχνευτής γ. υποκινητής δ. χειριστής. 206
  • 65. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης6. Για την αποδιάταξη των αλυσίδων του DNA χρησιμοποιούνται: α. υψηλές θερμοκρασίες β. αντίστροφη μεταγραφάση γ. DNA πολυμεράση δ. κατάλληλα ένζυμα7. Υβριδοποίηση είναι: α. η σύνδεση μονόκλωνων συμπληρωματικών αλυσίδων DNA β. η σύνδεση δίκλωνων αλυσίδων DNA γ. ο αποχωρισμός των δύο συμπληρωματικών αλυσίδων του DNA δ. η σύνθεση μιας συμπληρωματικής αλυσίδας DNA από cDNA.8. Για να εντοπίσουμε μια αλληλουχία DNA σε μια βιβλιοθήκη, χρησιμοποιούμε: α. mRNA β. την τεχνική του μετασχηματισμού γ. ειδικά ένζυμα δ. την τεχνική της υβριδοποίησης9.Ο βακτηριοφάγος λ πλεονεκτεί ως φορέας κλωνοποίησης από τα πλασμίδια της E.coli, γιατί: α. μπορεί να ενσωματώσει μεγάλα κομμάτια DNA που προκύπτουν από τη δράση των περιοριστικών ενδονουκλεασών β. προκαλεί πολύ ευκολότερα μετασχηματισμό των βακτηρίων, αφού διαθέτει δικό του μηχανισμό εισόδου σε αυτά γ. παρουσιάζει υψηλή αποτελεσματικότητα, αφού πολλαπλασιάζεται γρήγορα δημιουργώντας πολλούς νέους ιστούς. δ. όλα τα παραπάνω. 10. Ο φυσιολογικός ρόλος των περιοριστικών ενδονουκλεασών είναι: α. να απομακρύνουν εσώνια από το πρόδρομο mRNA β. να προστατεύουν τα βακτήρια από την εισβολή «ξένου» DNA γ. να απομακρύνουν εξώνια από το πρόδρομο mRNA δ. να περιορίζουν τη δράση των βακτηρίων 3
  • 66. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 11. Όταν υπάρχει ανάγκη ενσωμάτωσης μεγάλων κομματιών DNA, τότε ο πιο κατάλληλος φορέας κλωνοποίησης είναι: α. ο βακτηριοφάγος λ β. τα πλασμίδια γ. το κοσμίδιο δ. ο βακτηριοφάγος β 12. Πώς ονομάζονται τα κυκλικά μόρια DNA που αναπαράγονται ανεξαρτήτως; α. Διακεκομένα γονίδια β. Εσώνια γ. Ρυθμιστικά γονίδα δ. Πλασμίδια 13. Αποδιάταξη είναι το φαινόμενο κατά το οποίο α. ωριμάζει το πρόδρομο RNA β. μεταφράζεται το DNA γ. αποχωρίζονται μεταξύ τους οι αλυσίδες του DNA δ. συνδέονται μεταξύ τους οι κλώνοι του DNA 14. Πώς ονομάζονται τα βακτηριακά ένζυμα που τεμαχίζουν το DNA σε συγκε-κριμένες θέσεις; α. Πολυμεράσες β. Δεσμάσες γ. Περιοριστικές ενδοκλουνεάσες δ. Κινάσες 15. Οι περιοριστικές ενδονουκλεάσες α. κόβουν τους δεσμούς υδρογόνου μεταξύ των βάσεων Α και G β. κόβουν τις πολυνουκλεοτιδικές αλυσίδες του μορίου του DNA σε ειδικές θέσεις γ. ενώνουν τμήματα του ανασυνδυασμένου DNA με 3-8 νουκλεοτίδια δ. ενσωματώνουν το DNA του δότη σε ειδική θέση του φορέα κλωνοποίη-σης.16. Το ένζυμο ECοRI κόβει την αλυσίδα του γονιδιώματος ενός ευκαρυωτικού κυττάρου στιςθέσεις μεταξύ G και Α. Έτσι προκύπτουν α. χιλιάδες τμήματα του DNA με τον ίδιο αριθμό νουκλεοτιδίων, που μπο-ρούν να συνδεθούν με το πλασμίδιο φορέα β. πολλά τμήματα του DNA από τα οποία μόνο ένα μπορεί να συνδεθεί με το πλασμίδιο φορέα γ. πολλά διαφορετικά τμήματα του DNA που έχουν τη δυνατότητα να συν-δεθούν με το πλασμίδιο φορέα δ. δύο τμήματα του DNA με διαφορετικό αριθμό νουκλεοτιδίων από τα οποία μόνο το ένα μπορεί να συνδεθεί με το πλασμίδιο φορέα. 206
  • 67. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης17. Oι περιοριστικές ενδονουκλεάσες έχουν τη δυνατότητα να κόβουν: α. το πλασμίδιο σε κατάλληλη θέση β. το ανασυνδυασμένο DNA σε κατάλληλη θέση γ. το γονιδίωμα του ευκαρυωτικού κυττάρου σε κατάλληλη θέση δ. σε όλες τις θέσεις που περιγράφονται στα α, β, γ.18. Mερικά πλασμίδια φέρουν γονίδιο που σχετίζεται με την ευαισθησία των βα-κτηρίων σεκάποιο αντιβιοτικό. Αυτό εξυπηρετεί α. την κλωνοποίηση των βακτηρίων στα οποία έχει εισαχθεί αυτό το ανα-συνδυασμένο πλασμίδιο β. την καταστροφή του ανασυνδυασμένου πλασμιδίου πριν την εισαγωγή του στο βακτήριο ξενιστή γ. την κλωνοποίηση των βακτηρίων που δε φέρουν το πλασμίδιο δ. την αναπαραγωγή του ανασυνδυασμένου πλασμιδίου με τη μέθοδο της αλυσιδωτής αντίδρασης πολυμεράσης.19. Πώς ονομάζεται το μόριο του DNA που συντίθεται με μήτρα το mRNA και την παρουσία τηςαντίστροφης μεταγραφάσης; α. ανασυνδυασμένο DNA β. cDNA, γ. γονιδιωματικό DNA20. Οι περιοριστικές ενδονουκλεάσες α. περιορίζουν τη μεταγραφή γονιδίων β. είναι απαραίτητες για την έναρξη της αντιγραφής γ. μεταγράφουν το DNA των ιών σε RNA δ. κόβουν το DNA σε καθορισμένες θέσεις.21. Μια γονιδιωματική βιβλιοθήκη περιέχει α. αντίγραφα ενός μόνο ανασυνδυασμένου πλασμιδίου β. αντίγραφα του συνολικού γονιδιώματος ενός οργανισμού γ. αντίγραφα του mRNA του οργανισμού δότη δ. τα απαραίτητα ένζυμα για την παραγωγή ανασυνδυασμένου DNA.22. Η αποδιάταξη του DNA γίνεται με α. τη χρήση των περιοριστικών ενδονουκλεασών β. αύξηση της θερμοκρασίας γ. ραδιενεργά σημασμένα μόρια τους ανιχνευτές δ. το ένζυμο DNA δεσμάση. δ. χρωμοσωμικό DNA. 3
  • 68. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΑσκήσεις 1. Ένα πλασμίδιο που χρησιμοποιείται ως φορέας κλωνοποίησης για την κατασκευή μιας γονιδιωματικής βιβλιοθήκης διαθέτει το γονίδιο ανθεκτικότητας στην αμπικιλίνη και την τετρακυκλίνη. Η μοναδική θέση αναγνώρισης από την ECO RI εμπεριέχεται στο γονίδιο της τετρακυκλίνης, το οποίο κωδικοποιεί μια πρωτεΐνη η οποία είναι τοξική για το βακτήριο. Πώς μπορούμε να επιλέξουμε τα μετασχηματισμένα βακτήρια που δέχτηκαν το ανασυνδυασμένο πλασμίδιο; 2. Η περιοριστική ενδονουκλεάση Bam HI κόβει μεταξύ δύο G όταν συναντά την αλληλουχία 5’ GCATCC 3’ 3’ CCTAGG 5’ Ένα πλασμίδιο με μοριακό βάρος 100.000 και 120.000 δεσμούς υδρογόνου υποβάλλεται σε κατεργασία με το ένζυμο. Η ίδια περιοριστική ενδονουκλεάση επιδρά στο DNA και το κόβει σε 3 τμήματα. Το τμήμα που αξιοποιείται για την σύνθεση του ανασυνδυασμένου πλασμιδίου έχει μοριακό βάρος 10.000 και 14.000 δεσμούς υδρογόνου μετά την επεξεργασία του με την περιοριστική ενδονουκλεάση. Στη συνέχεια τα δύο τμήματα του DNA αναμιγνείονται και σχηματίζεται ανασυνδυασμένο πλασμίδιο. Να υπολογιστεί το συνολικό μοριακό βάρος και ο αριθμός των δεσμών Ηδρογόνου. 3. Το τμήμα του DNA που φαίνεται παρακάτω εισάγεται σε βακτήριο E. Coli 5’ GAAGAATTCGGCAATGAATTCAGTGAATTCAA 3’ 3’ CTTCTTAAGCCGTTACTTAAGTCACTTAAGTT 5’ a. Ποιο είναι το προϊόν της δράσης της ECORI ; b. Πόσοι φωσφωδιεστερικοί δεσμοί διασπάστηκαν και πόσοι δεσμοί Υδρογόνου καταστράφηκαν; c. Αν θέλουμε να κλωνοποιήσουμε τα παραγόμενα τμήματα DNA πόσα πλασμίδια πρέπει να χρησιμοποιήσουμε; 4. Σε ένα πείραμα PCR επιθυμούμε να κατασκευάσουμε 60 αντίγραφα ενός τμήματος DNA. Το τμήμα αυτό έχει μήκος 2000 ζεύγη βάσεων και κάθε αντιγραφή διαρκεί μια ώρα. A. Σε πόση ώρα θα έχουμε τον επιθυμητό αριθμό αντιγράφων; B. Πόσοι κλώνοι συντέθηκαν και πόσα νουκλεοτίδια χρησιμοποιήθηκαν; 206
  • 69. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης C. Πόσα μόρια DNA θα υπάρχουν μετά από 15 κύκλους αντιγραφής;5. Πόσα μόρια DNA θα προκύψουν από κόψιμο με ECOR I …A. Ενός δίκλωνου γραμμικού μορίου το οποίο φέρει μία θέση αναγνώρισης για το ένζυμο;B. Ενός δίκλωνου γραμμικού μορίου το οποίο φέρει δύο θέσεις αναγνώρισης για το ένζυμο;C. Ενός πλασμιδίου το οποίο φέρει μια θέση αναγνώρισης για το ένζυμο;D. Ενός πλασμιδίου το οποίο φέρει δύο θέσεις αναγνώρισης για το ένζυμο;6. Η περιοριστική ενδονουκλεάση MspI κόβει την αλληλουχία CCGG GGCCΜεταξύ των βάσεων C &CΕνώ η περιοριστική ενδονουκλεάση Taq I κόβει την αλληλουχία TCAGA AGTCTΜεταξύ των βάσεων T&CΘελουμε να κλωνοποιήσουμε το τμήμα του γονιδίου το οποίο βρίσκεται μέσα στο πλαίσιο.ATTCGAGCCCGGTTGATTAACTGACCGATATCGCGTCGACCGGTAAGCTCGGGCCAACTAATTGACTGGCTATAGCGCAGCTGGCC A. Ποια περιοριστική ενδονουκλεάση είναι κατάλληλη; B. Ποια αλληλουχία πρέπει να φέρει ο φορέας κλωνοποίησης; C. Πόσοι φωσφωδιεστερικοί δεσμοί θα υδρολυθούν και πόσοι δεσμοί υδρογόνου θα καταστραφούν στο δεδομένο τμήμα DNA; 3
  • 71. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΔιδακτικοί στόχοι • Να αποδίδεις ορθά τους όρους και να τους διακρίνεις σε ερωτήσεις πολλαπλής επιλογής • Να αναφέρεις τους νόμους του Mendel • Να περιγράφεις τα στάδια της μείωσης από τα οποία προκύπτουν οι νόμοι του Mendel. Μήπως μπορείς να συμπεράνεις τι θα συμβεί αν δεν ολοκληρωθεί με ακρίβεια η διαδικασία της μείωσης; Τι επιπτώσεις θα έχει αυτό για τους γαμέτες και τι για τους παραγόμενους οργανισμούς; • Να διακρίνεις τις περιπτώσεις στους οποίους οι νόμοι του Mendel δεν ισχύουν • Να επιλύεις προβλήματα • Να διακρίνεις τους πιθανούς γαμέτες που μπορεί ένας οργανισμός να παράγει • Να μπορείς από τον φαινότυπο να συμπεραίνεις για τον γονότυπο Πώς λέμε την διασταύρωση που κάνουμε στην περίπτωση αυτή; • Να επιλύεις ασκήσεις με γενεαλογικά δένδρα 3
  • 72. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΕπισημάνσεις Θεωρίας Ο Mendel οφείλει την επιτυχία των πειραμάτων του στο γεγονός ότι έκανε τις εξής επιλογές  Μελέτησε ξεχωριστά τον τρόπο κληρονομικότητας κάθε γνωρίσματος και δεν μελέτησε ταυτόχρονα όλες τις ιδιότητες μαζί  Χρησιμοποίησε για τις μελέτες του το μοσχομπίζελο , το οποίο αναπτύσσεται εύκολα και εμφανίζει μεγάλη ποικιλομορφία σε πολλές ιδιότητες ,  Χρησιμοποίησε για τα πειράματα του καθαρά στελέχη ( αμιγή ) με συγκεκριμένες ιδιότητες .Χαρακτηριστικά ενδεικνυόμενου πειραματόζωου • Αναπτύσσεται εύκολα • Έχει μικρό κύκλο ζωής • Οδηγεί στην παραγωγή μεγάλου αριθμού απογόνων, επιτρέπει την στατιστική ανάλυση των αποτελεσμάτων • Εμφανίζει μεγάλη ποικιλομορφία σε χαρακτηριστικά • Περιέχει τη δυνατότητα τεχνητής γονιμοποίησης • Περιέχει τη δυνατότητα αυτογονιμοποίησης, προς δημιουργία αμιγών στελεχώνΟρισμοίΑΜΙΓΗ ονομάζονται τα άτομα τα οποία όταν διασταυρώνονται μεταξύ τους , για πολλέςσυνεχείς γενεές δίνουν τα ίδια χαρακτηριστικά .Αυτό σημαίνει ότι τα αμιγή στελέχη είναι ομόζυγαΑΛΛΗΛΟΜΟΡΦΑ ΓΟΝΙΔΙΑ ονομάζονται οι διαφορετικές μορφές της ίδιας γονιδιακής θέσης ,δηλαδή τα γονίδια τα οποία βρίσκονται στην ίδια θέση στα ομόλογα χρωμοσώματα και ελέγχουντην ίδια ιδιότητα αλλά με διαφορετικό τρόπο .ΠΑΤΡΙΚΗ ΓΕΝΙΑ (Ρ) ονομάζονται τα αρχικά άτομα που διασταυρώνονται για να δώσουναπογόνους .ΠΡΩΤΗ ΘΥΓΑΤΡΙΚΗ ΓΕΝΙΑ (F1 ) ονομάζονται τα άτομα που προκύπτουν από την πατρικήγενιά .ΔΕΥΤΕΡΗ ΘΥΓΑΤΡΙΚΗ ΓΕΝΙΑ ( F2 ) ονομάζονται τα άτομα που προκύπτουν από την πρώτηθυγατρική γενιά .ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ονομάζεται η μελέτη του τρόπου κληρονομικότητας μιας ιδιότητας.ΔΙΥΒΡΙΔΙΣΜΟΣ ονομάζεται η μελέτη του τρόπου κληρονομικότητας δύο ιδιοτήτων . 206
  • 73. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης ΠΟΛΥ- ΥΒΡΙΔΙΣΜΟΣ ονομάζεται η μελέτη του τρόπου κληρονομικότητας πολλώνιδιοτήτων.ΕΠΙΚΡΑΤΕΣ ονομάζεται το γονίδιο του οποίου η έκφραση υπερισχύει αυτής του αλληλόμορφουγονιδίου , ( συνήθως συμβολίζεται με κεφαλαίο γράμμα ) . Εκδηλώνεται τόσο σε ομόζυγη όσο καισε ετερόζυγη κατάσταση .ΥΠΟΛΕΙΠΟΜΕΝΟ ονομάζεται το γονίδιο , το οποίο δεν υπερισχύει του αντίστοιχουεπικρατούς αλληλόμορφου , συμβολίζεται με μικρό γράμμα και εκφράζεται μόνο σε ομόζυγηκατάσταση .ΓΟΝΟΤΥΠΟΣ ονομάζεται το σύνολο των γονιδίων που βρίσκονται σε κάθε σωματικό κύτταροενός οργανισμού ( περιγράφει δηλαδή τα αλληλόμορφα γονίδια ενός οργανισμού ) .ΦΑΙΝΟΤΥΠΟΣ ονομάζεται το σύνολο των γνωρισμάτων ενός οργανισμού ( δηλαδή περιγράφειτην που δημιουργείται από το συνδυασμό των αλληλομόρφων γονιδίων στο συγκεκριμένοπεριβάλλον ) .ΠΟΛΥΓΟΝΙΔΙΑΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ονομάζεται το φαινόμενο κατά το οποίο διάφοροικληρονομικοί χαρακτήρες από περισσότερα του ενός αλληλόμορφα γονίδια διαφορετικών όμωςγενετικών θέσεωνΟΡΘΟΓΩΝΙΟ ΤΟΥ PUNNETT ( ΑΒΑΚΙΟ ) είναι ένας πίνακας στον οποίο προσδιορίζεταιη αναλογία των δημιουργούμενων γονοτύπων σε μια διασταύρωση. Από αυτό μπορούμε νασυμπεράνουμε την αναλογία των φαινοτύπωνΔΙΑΣΤΑΥΡΩΣΗ ΕΛΕΓΧΟΥ ονομάζεται η διασταύρωση ενός ατόμου με άγνωστο γονότυπο ,μεένα άτομο ομόζυγο για το υπολειπόμενο γονίδιο . ΠΡΩΤΟΣ ΝΟΜΟΣ ΤΟΥ MENDEL ( ΝΟΜΟΣ ΤΗΣ ΟΜΟΙΟΜΟΡΦΙΑΣ ) Ο νόμος αυτός αναφέρει πως όταν διασταυρώνονται μεταξύ τους αμιγή στελέχη , τότε όλοι οιαπόγονοι στην F1 γενιά είναι ομοιόμορφοι μεταξύ τους . ΔΕΥΤΕΡΟΣ ΝΟΜΟΣ ΤΟΥ MENDEL ( ΝΟΜΟΣ ΤΗΣ ΑΝΕΞΑΡΤΗΤΗΣ ΜΕΤΑΒΙΒΑΣΗΣ ΤΩΝ ΑΛΛΗΛΟΜΟΡΦΩΝ ) Ο νόμος αυτός αναφέρει ότι τα γονίδια που καθορίζουν διαφορετικά χαρακτηριστικάκληρονομούνται ανεξάρτητα το ένα από το άλλο . ( Ο νόμος αυτό ισχύει μόνο για τα γονίδια πουβρίσκονται σε διαφορετικά , μη ομόλογα , χρωμοσώματα .)ΑΝΕΞΑΡΤΗΤΑ ΓΟΝΙΔΙΑ ονομάζονται τα γονίδια το οποία βρίσκονται σε διαφορετικάχρωμοσώματα .ΣΥΝΔΕΔΕΜΕΝΑ ΓΟΝΙΔΙΑ ονομάζονται τα γονίδια που βρίσκονται στο ίδιο χρωμόσωμα . 3
  • 74. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΑΤΕΛΩΣ ΕΠΙΚΡΑΤΗ ΓΟΝΙΔΙΑ ονομάζονται τα γονίδια τα οποία όταν συνυπάρχουν σεένα άτομο δίνουν ένα ενδιάμεσο φαινότυπο .ΣΥΝΕΠΙΚΡΑΤΗ ΓΟΝΙΔΙΑ ονομάζονται τα γονίδια εκείνα στα οποία εκφράζονται και τα δύοαλληλόμορφα στο φαινότυπο ανεξάρτητα το ένα από το άλλο και χωρίς ο φαινότυπος να είναιενδιάμεσος .ΘΝΗΣΙΓΟΝΑ ΓΟΝΙΔΙΑ ονομάζονται τα γονίδια εκείνα τα οποία δημιουργούν πρόβλημα απότην αρχή της εμβρυϊκής ανάπτυξης και οδηγούν συνήθως στο θάνατοτου ατόμου .ΠΟΛΛΑΠΛΑ ΑΛΛΗΛΟΜΟΡΦΑ ονομάζονται τα γονίδια έχουν περισσότερα από δύοαλληλόμορφα για μια γενετική θέση . Αυτά δημιουργούνται από μεταλλάξεις στην αλληλουχίαβάσεων του DNA .ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΤΡΑ είναι διαγραμματικές απεικονίσεις των μελών μιας οικογένειας καισε αυτά περιγράφονται οι διασταυρώσεις που έχουν γίνει από γενιά σε γενιά . Σε ένα γενεαλογικόδέντρο φαίνεται η σειρά των γεννήσεων , το φύλο των ατόμων και ο φαινότυπος τους σε σχέσημε κάποιο συγκεκριμένο χαρακτήρα που μελετάμε . ΦΥΛΟΣΥΝΔΕΤΑ ΓΟΝΙΔΙΑ ονομάζονται τα γονίδια τα οποία βρίσκονται στο Χχρωμόσωμα και δεν έχουν αλληλόμορφα στο Υ χρωμόσωμα . ΠΕΡΙΠΤΩΣΕΙΣ ΣΤΙΣ ΟΠΟΙΕΣ ΟΙ ΦΑΙΝΟΤΥΠΙΚΕΣ ΑΝΑΛΟΓΙΕΣ ΤΩΝ ΑΠΟΓΟΝΩΝ ΔΕΝ ΕΙΝΑΙ ΑΥΤΕΣ ΠΟΥ ΑΝΑΜΕΝΟΝΤΑΙ ΑΠΟ ΤΟΥΣ ΝΟΜΟΥΣ ΤΟΥ MENDELΟρισμένες περιπτώσεις δεν εμφανίζουν τις αναλογίες που δίνουν οι νόμοι του Mendel Αυτές οιπεριπτώσεις είναι οι εξής :  Στους απλοειδείς οργανισμούς  Όταν μιλάμε για γονίδια που βρίσκονται στο μιτοχονδριακό DNA  Όταν η έκφραση των γονιδίων επηρεάζεται από το περιβάλλον  Όταν μελετάμε πολυγονιδιακές ιδιότητες (π.χ. συμπεριφορά)  Όταν έχουμε φυλοσύνδετα γονίδια  Όταν έχουμε πολλαπλά αλληλόμορφα γονίδια 206
  • 75. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης • Συνεπικρατή γονίδια • Ισοεπικαρατή γονίδια • Θνησιγόνα γονίδια ΦΥΛΟΣΥΝΔΕΤΑ ΓΟΝΙΔΙΑ Παρατηρούμε ότι οι φυλοσύνδετες ασθένειες για να εκδηλωθούν στα θηλυκά άτομα πρέπειαυτά να είναι ομόζυγα για το υπολειπόμενο γονίδιο , δηλαδή πρέπει να υπάρχει και στα δύο Χχρωμοσώματα . Αντίθετα στα αρσενικά άτομα αν το υπολειπόμενο γονίδιο υπάρχει στο Χχρωμόσωμα , τότε το άτομο πάσχει από την ασθένεια .Δηλαδή ισχύουν τα εξής : ΑΡΣΕΝΙΚΟ ΧΒΥ ΦΥΣΙΟΛΟΓΙΚΟ ΑΡΣΕΝΙΚΟ ΧβΥ ΠΑΘΟΛΟΓΙΚΟ ΘΗΛΥΚΟ ΧΒΧΒ ΦΥΣΙΟΛΟΓΙΚΟ ΘΗΛΥΚΟ ΧΒΧβ ΦΥΣΙΟΛΟΓΙΚΟ ΘΗΛΥΚΟ ΧβΧβ ΠΑΘΟΛΟΓΙΚΟΣΗΜΕΙΩΣΗΣτα πτηνά και στα λεπιδόπτερα το αρσενικό είναι το ΧΧ και το θηλυκό είναι το ΧΥ . ΓΟΝΙΔΙΑ ΠΟΥ ΠΡΕΠΕΙ ΝΑ ΓΝΩΡΙΖΟΥΜΕ 1) Χρώμα φυτού στο σκυλάκι (Antirhinnum ) Ατελώς επικρατές 2) Ομάδες αίματος ΑΒΟ Συνεπικρατή - πολλαπλά αλληλόμορφα 3) Γραμμή τριχοφυιας με κορυφή Αυτοσωμικό επικρατές 4) Προσκολλημένοι λοβοί αυτιών Αυτοσωμικό υπολειπόμενο 5) Οικογενής υπερχοληστερολαιμία Αυτοσωμικό επικρατές 6) Δρεπανοκυτταρική αναιμία Αυτοσωμικό υπολειπόμενο 7)β-θαλασσαιμία Αυτοσωμικό υπολειπόμενο 8) κυστική ίνωση Αυτοσωμικό υπολειπόμενο 9)Αλφισμός Αυτοσωμικό υπολειπόμενο 10) Φαινυλκετονουρία Αυτοσωμικό υπολειπόμενο 11)Μερική αχρωματοψία στο κυανό Αυτοσωμικό υπολειπόμενο 12) Μερική αχρωματοψία στο κόκκινο πράσινο Φυλοσύνδετο υπολειπόμενο 13)Αιμορροφιλία Α και Β Φυλοσύνδετο υπολειπόμενο 14) Αχονδροπλασία Αυτοσωμικό επικρατές 3
  • 76. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΕρωτήσεις1. Πού οφείλεται η επιτυχία των πειραμάτων του Μέντελ; Γιατί θεωρείται ο πατέρας τηςΓενετικής;2. Ποια τα πλεονεκτήματα του μοσχομπίζελου για τη μελέτη της κληρονομικότητας;3. Ορισμοί: πατρική γενιά, F1 γενιά, F2 γενιά, αμιγή άτομα, αλληλόμορφα γονίδια, επικρατές-υπολειπόμενο αλληλόμορφο, ομόζυγο- ετερόζυγο άτομο, γονότυπος- φαινότυπος.4. Διατυπώστε τον 1ο νόμο του Μέντελ. Με ποιες διασταυρώσεις κατέληξε σ’ αυτόν καιποια συμπεράσματα έβγαλε;5. Ορισμοί: μονοϋβριδισμός, διυβριδισμός, διασταύρωση ελέγχου, τετράγωνο του Punnett. Σετι χρησιμεύουν τα δύο τελευταία;6. Τι εννοούμε όταν λέμε ότι «οι απόγονοι προκύπτουν απ’ τον τυχαίο συνδυασμό τωνγαμετών»;7. Διατυπώστε το 2ο νόμο του Μέντελ. Πότε ισχύει και πώς κατέληξε σ’ αυτόν οΜέντελ;8. Τι είναι ατελής επικράτεια και τι συνεπικράτεια; Δώστε 1 παράδειγμα γονοτύπων καιφαινοτύπων για κάθε περίπτωση. Γράψτε για κάθε περίπτωση μια διασταύρωση από την Ρ έωςτην F2 γενιά.9. Τι είναι τα θνησιγόνα αλληλόμορφα; Τι προκαλούν και πώς κληρονομούνται συνήθως;10. Τι ονομάζουμε πολλαπλά αλληλόμορφα; Δώστε 2 παραδείγματα στον άνθρωπο. Γιατίμπορούν να αλλάξουν τις φαινοτυπικές αναλογίες των νόμων του Μέντελ;11. Γιατί ο άνθρωπος είναι κακό πειραματικό υλικό (δηλ. γιατί η μελέτη του τρόπουμεταβίβασης των κληρονομικών χαρακτηριστικών εμφανίζει πολλές δυσκολίες);12. Ορισμοί: μονογονιδιακοί χαρακτήρες, τύπος κληρονομικότητας, γενεαλογικό δένδρο, φορείς.13. Σχεδιάστε ένα απλό γενεαλογικό δένδρο όπου να φαίνεται: α) μια αυτοσωμικήεπικρατής ασθένεια, β) μια αυτοσωμική υπολειπόμενη ασθένεια, γ) μια φυλοσύνδετηυπολειπόμενη ασθένεια; Δώστε όσα παραδείγματα ασθενειών για κάθε περίπτωση ξέρετε. 206
  • 77. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης14. Τι είναι τα φυλοσύνδετα γονίδια; Γιατί τα υπολειπόμενα φυλοσύνδετα χαρακτηριστικάεκφράζονται συνηθέστερα στα αρσενικά άτομα και πάρα πολύ σπάνια στα θηλυκά άτομα;15. Ποιοι οι πιθανοί γονότυποι και φαινότυποι ενός άνδρα και μιας γυναίκας σχετικά με τηναιμορροφιλία;Συνδυαστικές ερωτήσεις Θεωρίας1. Τι είναι γονότυπος; Πώς μπορούμε να βρούμε το γονότυπο ενός ατόμου;2. Τι ονομάζεται φαινότυπος; Να εξηγήσεις με ένα παράδειγμα πώς ο φαινότυπος ενός ατόμου αποτελεί έκφραση του γονοτύπου.3. Πότε εκφράζεται στο φαινότυπο ένα υπολειπόμενο αλληλόμορφο γονίδιο;4. Με ποιο τρόπο ο Μέντελ δημιούργησε αμιγή στελέχη μοσχομπίζελου;5. Σε τι διαφέρουν τα ετερόζυγα επικρατή άτομα από τα ετερόζυγα ατελώς επικρατή;6. Γιατί στο διυβριδισμό στην F2 γενιά, εκτός από τα άτομα της πατρικής εμφανίζονται και άτομα με νέους φαινοτύπους και γονοτύπους;7. Ποιες ιδιότητες πρέπει να έχουν οι οργανισμοί ώστε να είναι κατάλληλοι για πειραματικές διασταυρώσεις;8. Ποια διασταύρωση ελέγχου πραγματοποίησε ο Μέντελ για να μελετήσει το ύψος του μοσχομπίζελου;9. Πόσοι γονότυποι και ποιοι αντιστοιχούν σε ένα άτομο που εκδηλώνει στο φαινότυπό του 2 επικρατείς χαρακτήρες Α και Β;10. Πόσα είδη γαμετών και ποιους μπορεί να σχηματίζει ένα άτομο που φέρει 2 επικρατείς χαρακτήρες στο φαινότυπό του;11. Αν οι απόγονοι μιας διασταύρωσης εκφράζουν άλλοι τον επικρατή και άλλοι τον υπολειπόμενο φαινότυπο, τι φαινότυπο θα έχουν οι 2 γονείς;12. Γιατί δεν ισχύει ο 2ος νόμος του Μέντελ για τα φυλοσύνδετα γονίδια;13.Σε ποιου τύπου διασταυρώσεις οι γονοτυπικές και φαινοτυπικές αναλογίες είναι ίδιες; Γιατί συμβαίνει αυτό;14. Γιατί κάθε φορά που εμφανίζεται μια γενετικά θνησιγόνος αυτοσωμική επικρατής ασθένεια, αυτή οφείλεται σε μετάλλαξη; 3
  • 78. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ15. Να εξηγήσετε γιατί οι φυλοσύνδετοι χαρακτήρες που εμφανίζονται στο γιο δεν εμφανίζονται πάντοτε και στη μητέρα.16. Ποια γονίδια καθορίζουν τον τύπο των ομάδων αίματος ΑΒΟ του ανθρώπου και ποια η σχέση μεταξύ τους;17. Ποιες πληροφορίες μπορεί να μας δώσει η μελέτη του γενεαλογικού δένδρου μιας οικογένειας;18. Γιατί στον άνθρωπο η μελέτη του τρόπου μεταβίβασης των κληρονομικών χαρακτήρων εμφανίζει πολλές δυσκολίες; Πώς γίνεται η μελέτη αυτή;19. Να κατασκευάσετε το τετράγωνο του Punnett στο οποίο θα φαίνονται οι πιθανοί γενετικοί συνδυασμοί στην μερική αχρωματοψία στο πράσινο, όταν ο πατέρας είναι φυσιολογικός και η μητέρα φορέας.20.Όταν ένας αιμορροφιλικός άνδρας παντρευτεί μια φυσιολογική γυναίκα, όλοι οι θηλυκοί απόγονοί τους θα είναι υποχρεωτικά φορείς. Πώς αιτιολογείται αυτό;21. Για ποια περίπτωση γονιδίων μπορούμε να πούμε ότι τα μέλη μιας οικογένειας που είναι φυσιολογικά έχουν μόνο φυσιολογικούς απογόνους;22. Υπάρχει περίπτωση από γονείς που εκδηλώνουν υπολειπόμενο γνώρισμα να προκύψει παιδί με το επικρατές γνώρισμα;23. Για ποιο λόγο τα ομόζυγα υπολειπόμενα άτομα για θνησιγόνα γονίδια δεν επιβιώνουν μέχρι τη γέννηση;24.Σε ποιες περιπτώσεις γονιδίων, ενώ ισχύουν οι νόμοι του Μέντελ, οι φαινοτυπικές αναλογίες των απογόνων δεν είναι οι αναμενόμενες;25.Η πιθανότητα και οι 2 σύζυγοι να είναι φορείς της ίδιας ασθένειας που κληρονομείται με αυτοσωμικό υπολειπόμενο τρόπο είναι πολύ μικρή. Αυξάνεται όμως σε περίπτωση που οι 2 σύζυγοι είναι στενοί συγγενείς, όπως αδέρφια ή ξαδέρφια. Γιατί συμβαίνει αυτό; Πώς συμβολίζεται σε ένα γενεαλογικό δένδρο;26.Που οφείλεται η διαφορετική φαινοτυπική εκδήλωση της β-θαλασσαιμίας στον άνθρωπο;27. Υπάρχει περίπτωση μια διασταύρωση ετερόζυγων ατόμων ως προς μία ιδιότητα να δώσει απογόνους με αναλογία διαφορετική της 3:1 ή 1:2:1;28. Ένας διπλοειδής οργανισμός έχει γονότυπο ΑαΒβΓγδδ (4 ζεύγη ανεξάρτητων γονιδίων). Πόσα είδη γαμετών θα σχηματίσει και ποια;Παρατήρηση: Ο αριθμός των διαφορετικών γαμετών δίνεται από τον τύπο 2ν όπου ν= ο αριθμόςτων ζευγών με διαφορετικά αλληλόμορφα. Έτσι, για το παράδειγμα αυτό ν=3 και ο αριθμός τωνδιαφορετικών γαμετών είναι 23=8. 206
  • 79. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης29. Ένας διπλοειδής οργανισμός με 5 ζεύγη ανεξάρτητων γονιδίων έχει γονότυπο ΑαΒΒΓγδδΕε. Πόσα είδη γαμετών θα σχηματίσει και ποια;30. Να συμπληρώσετε το παρακάτω πινακάκι ΤΡΟΠΟΣ ΑΝΑΛΟΓΙΑ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑΣ 3:1 9:3:3:1 1:2:1 1:1: 3
  • 80. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΜεθοδολογία στην Επίλυση Ασκήσεων1. Σωστή κατανόηση της άσκησης, δηλ. προσεκτικό και επανειλημμένο διάβασμα.2. Ανάλογα με τον αριθμό των ιδιοτήτων που αναφέρονται ή με τη φαινοτυπική αναλογία ή από τον αριθμό των φαινοτύπων, καταλαβαίνουμε αν πρόκειται για μονοϋβριδισμό ή διυβριδισμό.3. Ανάλογα με τον αριθμό και το είδος των φαινοτύπων καθώς και τη φαινοτυπική αναλογία, είναι πιθανό να καταλάβουμε τη σχέση των αλληλομόρφων, δηλ. επικρατή- υπολειπόμενου ή ατελώς επικρατή ή συνεπικρατή.Θυμάμαι ότι: Φ.Α. Μονοϋβριδισμού: 3:1 (Επικρατές- υπολειπόμενο) 1:2:1 (Ατελώς επικρατή γονίδια) 1:1 (Επικρατές- υπολειπόμενο/ διασταύρωση ελέγχου) Φ.Α. Διϋβριδισμού: 9:3:3:1 (Επικρατές- υπολειπόμενο/ μη συνδεδεμένα γονίδια) 3:1 1:2:1 ► Συνδεδεμένα γονίδια 1:1Δηλ. αν έχουμε διϋβριδισμό και οι Φ.Α. είναι αυτές του μονοϋβριδισμού, τότε τα γονίδια είναισυνδεδεμένα.4. Από τα δεδομένα της άσκησης πρέπει να προσδιορίσουμε το είδος και τη θέση των γονιδίων (Αυτοσωμικά- Φυλοσύνδετα- Θνησιγόνα- Πολλαπλά αλληλόμορφα).5. Αν η φαινοτυπική αναλογία δίνεται για κάθε φύλο ξεχωριστά ή αν έχουμε διαφορετικό ποσοστό εμφάνισης μιας ιδιότητας στα δύο φύλα, τότε το πιθανότερο είναι το γονίδιο να είναι φυλοσύνδετο. Αν η φαινοτ. αναλογία για μια ιδιότητα είναι ίδια και στα 2 φύλα, τότε το πιθανότερο είναι το γονίδιο να είναι αυτοσωμικό.6. Τα φυλοσύνδετα γονίδια δεν υπακούουν στους νόμους του Mendel, αφού 2 ομόζυγοι γονείς (ο ένας για το επικρατές αλληλόμορφο και ο άλλος για το υπολειπόμενο) δίνουν απογόνους και με τα 2 γνωρίσματα.7. Αν προκύψουν λιγότερα άτομα από την προβλεπόμενη αναλογία, τότε υπάρχει μάλλον θνησιγόνο γονίδιο.8. Ανάλογα με τη σχέση και το είδος των γονιδίων πρέπει να κάνουμε το σωστό συμβολισμό.9. Από τη φαινοτυπική αναλογία στο διυβριδισμό καταλαβαίνουμε αν τα γονίδια είναι συνδεδεμένα ή όχι, αφού για τα συνδεδεμένα δεν ισχύουν οι κλασσικές αναλογίες. 206
  • 81. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης10. Στα γενεαλογικά δένδρα ψάχνω να βρω μια χαρακτηριστική διασταύρωση για να ξεκινήσω να ερμηνεύω το δένδρο. Δεν είναι απαραίτητο να το φτιάξω ή να το ερμηνεύσω από πάνω προς τα κάτω.11. Εάν φυσιολογικοί γονείς κάνουν παιδιά και των δύο φύλων που πάσχουν, τότε το γνώρισμα που ζητάμε οφείλεται σε αυτοσωμικό υπολειπόμενο γονίδιο.12. Εάν γονείς που πάσχουν κάνουν φυσιολογικά παιδιά και των δύο φύλων, τότε το γνώρισμα οφείλεται σε αυτοσωμικό επικρατές γονίδιο, και οι γονείς είναι ετερόζυγοι.13. Για τη λύση των ασκήσεων εφαρμόζουμε τους νόμους της βιολογίας, εκμεταλλευόμενοι σωστά τα δεδομένα. Στο κεφάλαιο αυτό δίνονται προβλήματα στα οποία συνήθως ζητείται: Να γίνουν διασταυρώσεις μονοϋβριδισμού Να γίνουν διασταυρώσεις διϋβριδισμού Να γίνουν διασταυρώσεις ελέγχου Να βρεθούν οι φαινότυποι ή οι γονότυποι των απογόνων Να βρεθούν οι φαινότυποι ή οι γονότυποι των γονέων Να υπολογιστούν οι φαινοτυπικές ή γονοτυπικές αναλογίες Να κατασκευαστεί γενεαλογικό δένδρο Να αναλυθεί γενεαλογικό δένδρο Τα βήματα που ακολουθούμε για την επίλυση των προβλημάτων είναι:1. Αρχικά συμβολίζουμε τα γονίδια:  Τα επικρατή με κεφαλαίο, τα υπολειπόμενα με μικρό γράμμα  Τα φυλοσύνδετα (επικρατή ή υπολειπόμενα) ως εκθέτες στο Χ χρωμόσωμα  Τα ατελώς επικρατή με διαφορετικά κεφαλαία γράμματα (πχ. Κ,Λ) ή με τα ίδια κεφαλαία αλλά με διαφορετικό εκθέτη (πχ. Κ , Κ ) 1 2  Τα συνεπικρατή με το ίδιο κεφαλαίο γράμμα αλλά με διαφορετικό εκθέτη (πχ. Ι Α , Ι) Β  Χρησιμοποιούμε 2 γράμματα για συμβολισμό γονοτύπου διπλοειδών οργανισμών (πχ. ΑΑ ή Αα) και ένα γράμμα για συμβολισμό απλοειδών γαμετών (πχ. Α,α)2. Στη συνέχεια, αν δίνονται γονότυποι ή φαινότυποι, μπορούμε να κατασκευάσουμε πίνακα όπου να φαίνεται ο φαινότυπος που αντιστοιχεί σε κάθε γονότυπο (βλέπε Πιν. 5.2.- σελ.80)3. Πραγματοποιούμε τη διασταύρωση (χρησιμοποιώντας το τετράγωνο του Punnett) αρχίζοντας από την Ρ γενιά και συνεχίζοντας, αν ζητείται, με τη διασταύρωση της F1. Στη διασταύρωση δε ξεχνάμε να γράψουμε τους γαμέτες, για την παραγωγή των οποίων τα ανεξάρτητα γονίδια μπορεί να συνδυαστούν με οποιονδήποτε τρόπο. 3
  • 82. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ4. Όταν πρέπει να κατασκευαστεί γενεαλογικό δένδρο, αξιοποιούμε τα δεδομένα με τρόπο ανάλογο με όσα ήδη έχουν αναφερθεί και προχωράμε στην κατασκευή του γενεαλογικού δένδρου, χρησιμοποιώντας τα σύμβολα που αναφέρονται στο σχολικό βιβλίο.5. Όταν δίνεται ένα γενεαλογικό δένδρο και ζητείται ανάλυσή του, διατυπώνουμε μια υπόθεση για το χαρακτήρα που αναπαριστά (πχ. αυτοσωμικός επικρατής), και έπειτα εξετάζουμε αν οι φαινότυποι που δίνονται στο δένδρο επιβεβαιώνουν την υπόθεσή μας. Αν έστω και ένας φαινότυπος δεν είναι σύμφωνος, απορρίπτουμε την υπόθεση και διατυπώνουμε άλλη.6. Όταν δίνονται οι φαινότυποι των απογόνων, μπορούμε να καταλήξουμε σε ορισμένα συμπεράσματα με βάση τις φαινοτυπικές αναλογίες:  Στις διασταυρώσεις κατά Μέντελ, όταν όλοι οι απόγονοι είναι ομοιόμορφοι, τότε και οι 2 γονείς είναι ομόζυγοι ή ο ένας είναι ομόζυγος για το επικρατές αλληλόμορφο και ο άλλος ετερόζυγος.  Στις διασταυρώσεις κατά Μέντελ, όταν η φαινοτυπική αναλογία των απογόνων είναι 3:1, τότε έχουμε διασταύρωση ετερόζυγων ατόμων.  Στις διασταυρώσεις κατά Μέντελ, όταν η φαινοτυπική αναλογία των απογόνων είναι 1:1, τότε έχουμε διασταύρωση ετερόζυγου ατόμου με άτομο ομόζυγο για το υπολειπόμενο.  Σε διασταύρωση διυβριδισμού, κάθε γονέας μπορεί να παράγει 4 είδη γαμετών και η αναλογία των απογόνων είναι 9:3:3:1.  Όταν η φαινοτυπική αναλογία των απογόνων είναι 1:2:1, τότε τα γονίδια μπορεί να είναι ατελώς επικρατή ή συνεπικρατή.  Αν η φαινοτυπική αναλογία των απογόνων δεν είναι καμία από τις παραπάνω, εξετάζουμε το ενδεχόμενο το γονίδιο να είναι φυλοσύνδετο ή θνησιγόνο.  Στο μονοϋβριδισμό, αν στους φαινοτύπους εμφανίζονται 2 χαρακτηριστικά, τα γονίδια είναι επικρατή- υπολειπόμενα, αν εμφανίζεται και τρίτο (ενδιάμεσο) είναι ατελώς επικρατή, αν εμφανίζεται και τρίτο (μίγμα και των 2 χαρακτηριστικών) είναι συνεπικρατή. 206
  • 83. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης Προβλήματα1. Η ασθένεια του Huntington είναι μια ασθένεια του κεντρικού νευρικού συστήματος που κληρονομείται με αυτοσωμικό επικρατή τρόπο, και τα συμπτώματά της εμφανίζονται σε ηλικία 35-45 ετών. Ποια η πιθανότητα ένα άτομο που πάσχει να μεταδώσει την ασθένεια στο παιδί του και ποια στον εγγονό του;2. Γονείς με καστανά μαλλιά αποκτούν παιδί με ξανθά. Εξηγήστε το μηχανισμό κληρονόμησης αυτού του γνωρίσματος.3. Από το γάμο ατόμων με καστανά μάτια και κανονική όραση γεννήθηκε αγόρι με γαλανά μάτια και δαλτονικό (με μερική αχρωματοψία). Να βρεθούν οι γονότυποι. (Διασταυρώστε).4. Ζευγάρι υγιών γονέων αποκτά παιδί με κυστική ίνωση, μια αυτοσωμική υπολειπόμενη ασθένεια. Από τη γυναίκα απομακρύνονται ωάρια τα οποία γονιμοποιούνται in vitro από το σπέρμα του συζύγου της. Από αυτά που γονιμοποιήθηκαν δημιουργήθηκαν 16 ζυγωτά, τα οποία ελέγχονται για την ύπαρξη του γονιδίου για την κυστική ίνωση. Σε πόσα από τα ζυγωτά με βάση τον 1ο Νόμο του Mendel περιμένετε να υπάρχουν 2 αντίγραφα αυτού του γονιδίου; Σε πόσα θα υπάρχει ένα αντίγραφο του γονιδίου για την κυστική ίνωση και ένα φυσιολογικό γονίδιο;5. Το παρακάτω γενεαλογικό δένδρο αναπαριστά τον τρόπο κληρονόμησης της φαινυλκετονουρίας (PKU) οικογένεια: Α) Η PKU οφείλεται σε επικρατές ή υπολειπόμενο γονίδιο; Κληρονομείται ως αυτοσωμικός ή φυλοσύνδετος χαρακτήρας; Β) Προσδιορίστε τους γονοτύπους των μελών της οικογένειας και αιτιολογήστε την απάντησή σας. Γ) Ποια η πιθανότητα ένα 4ο παιδί των γονέων 5 & 6 να πάσχει από PKU; Δώστε μια ερμηνεία. Ι ΙΙ ΙΙΙ ?6. Ο Γιώργος και η Ελένη είναι υγιείς αλλά ξέρουν ότι είναι φορείς μιας αυτοσωμικής υπολειπόμενης ασθένειας. Εάν τα 3 πρώτα παιδιά τους είναι υγιή, ποια η πιθανότητα το 4ο παιδί τους να κληρονομήσει την ασθένεια;7. Διασταυρώνοντας δύο άγνωστα φυτά πήραμε στην F2 γενιά 89 φυτά με άσπρα άνθη και 273 φυτά με κόκκινα άνθη. Να βρεθεί το χρώμα των άνθεων της F1 και της Ρ γενιάς.8. Διασταυρώνουμε δύο φυτά από τα οποία το ένα έχει κόκκινα άνθη (επικρατής χαρακτήρας) και σφαιρικούς καρπούς (υπολειπόμενος χαρακτήρας) και το άλλο κίτρινα άνθη και καρπούς 3
  • 84. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ επιμήκεις. Αν τα φυτά της Ρ γενιάς είναι ομόζυγα, να βρεθεί πόσα φυτά με κόκκινα άνθη και πόσα με σφαιρικούς καρπούς θα προκύψουν στην F2 γενιά.9. Να βρεθεί η φαινοτυπική (Φ.Α.) και η γονοτυπική αναλογία (Γ.Α.) στην F2 γενιά που θα προκύψει από τη διασταύρωση ραπανιών με επίμηκες σχήμα και κόκκινο χρώμα με ραπάνια με σφαιρικό σχήμα και λευκό χρώμα (εννοείται ότι οι γονείς είναι ομόζυγοι). Τα γονίδια ανήκουν σε διαφορετικά χρωμοσώματα (δεν είναι συνδεδεμένα) και είναι ισοεπικρατή.10. Είστε στην Πάρνηθα και προσέξατε ένα όμορφο κυκλάμινο με λευκό άνθος αντί για τα συνηθισμένα κόκκινα. Αν δεχθούμε ότι αυτό οφείλεται σε ένα γονίδιο, περιγράψτε ακριβώς τι θα κάνατε για να βρείτε αν το αλληλόμορφο που προκαλεί το λευκό χρώμα στα άνθη είναι επικρατές ή υπολειπόμενο.11. Ένας καφέ ποντικός διασταυρώνεται πολλές φορές με ένα λευκό και όλοι οι απόγονοί του είναι καφέ. Α) Εάν διασταυρωθούν 2 από τους καφέ ποντικούς της F1, ποιο ποσοστό από τους ποντικούς της F2 γενιάς θα είναι καφέ; Β) Πώς μπορείτε να διαπιστώσετε εάν ένας καφέ ποντικός είναι ομόζυγος ή ετερόζυγος;12. Δύο μαύρα θηλυκά ποντίκια διασταυρώνονται με ένα αρσενικό. Σε διαδοχικές γεννήσεις το ένα θηλυκό αποκτά 18 μαύρους και 5 καστανούς απογόνους και το άλλο 25 μαύρους. Συμπεράνετε τον τρόπο κληρονόμησης του χαρακτηριστικού αυτού και γράψτε τους γονότυπους των ατόμων.13. Διασταυρώνουμε δύο ποντίκια από καθαρές γενιές. Το ένα έχει μαύρο χρώμα, που επικρατεί έναντι του άσπρου τριχώματος. Πώς θα προσδιορίσετε πειραματικά αν το γονίδιο είναι αυτοσωμικό ή φυλοσύνδετο;14. Να βρεθεί η Φ.Α. και η Γ.Α. που προκύπτει στην F2 γενιά από τη διασταύρωση ινδικών χοιριδίων, ομόζυγων, που έχουν μαύρο και κοντό τρίχωμα με άτομα που έχουν άσπρο και μακρύ τρίχωμα. Μαύρο και κοντό είναι επικρατή, και τα γονίδια είναι αυτοσωμικά και ανεξάρτητα μεταξύ τους.15. Στις γάτες τα αρσενικά έχουν μαύρο ή κίτρινο τρίχωμα και τα θηλυκά μαύρο κίτρινο ή μαυροκίτρινο. Το γονίδιο είναι φυλοσύνδετο. Τι καταλαβαίνετε για τον τρόπο έκφρασης των αλληλομόρφων αυτών; Τι άτομα προκύπτουν εάν ζευγαρώσει γάτα μαύρη με γάτο κίτρινο;16. Από τη διασταύρωση ποντικών γεννήθηκαν 20 άτομα με λείο και κοντό τρίχωμα και 22 με λείο και μακρύ. Να βρεθούν οι γονότυποι που εξηγούν το αποτέλεσμα και να γίνουν οι διασταυρώσεις. Δίνεται ότι τα γονίδια είναι ανεξάρτητα αυτοσωμικά και το λείο επικρατεί στο σγουρό και το κοντό στο μακρύ.17. Η απουσία ποδιών στα βοοειδή (ακρωτηριασμένα) οφείλεται σε ένα υπολειπόμενο θνησιγόνο γονίδιο. Ένας κανονικός ταύρος και μια κανονική αγελάδα δίνουν έναν ακρωτηριασμένο απόγονο (συνήθως νεκρό όταν γεννιέται). Οι ίδιοι γονείς διασταυρώνονται ξανά. Α)Ποια η πιθανότητα και ο επόμενος απόγονος να είναι ακρωτηριασμένος; Β)Ποια η πιθανότητα και οι δύο επόμενοι απόγονοι να είναι ακρωτηριασμένοι; 206
  • 85. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης18. Από ένα γόνιμο ζευγάρι ποντικών δε γεννιέται κανένα αρσενικό άτομο. Ποια εξήγηση μπορείτε να δώσετε; ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻19. Ποια αναλογία φύλου θα προκύψει από τη διασταύρωση κανονικής αρσενικής δροσόφιλας με θηλυκό ετερόζυγο ως προς ένα φυλοσύνδετο υπολειπόμενο γονίδιο;20. Στη δροσόφιλα το γονίδιο για το κίτρινο σώμα είναι υπολειπόμενο φυλοσύνδετο, ενώ το αλληλόμορφο επικρατές δίνει κανονικό χρώμα σώματος. Ποιες αναλογίες θα προκύψουν απ’ τη διασταύρωση: α) Θηλ. κίτρινο με αρσ. κίτρινο, β) Θηλ. κίτρινο με αρσ. κανονικό, γ) Θηλ. κανονικό με αρσ. κίτρινο.21. Να βρεθεί η Φ.Α. που προκύπτει στην F2 γενιά από τη διασταύρωση ομόζυγων ατόμων δροσόφιλας που έχουν κανονικά φτερά και άσπρα μάτια με αρσενικά με ζαρωμένα φτερά και κόκκινα μάτια. (Για τα φτερά ισχύει ότι το γονίδιο είναι αυτοσωμικό και τα κανονικά επικρατούν, ενώ το γονίδιο για τα κόκκινα μάτια είναι επικρατές φυλοσύνδετο).22. Από τη διασταύρωση 2 ατόμων δροσόφιλας γεννήθηκαν 180 θηλυκά και 95 αρσενικά. Ποιο πιθανό γεγονός μπορεί να εξηγήσει το αποτέλεσμα;23. Από η διασταύρωση ετερόζυγων ατόμων δροσόφιλας με κανονικές φτερούγες και κανονικές σμήριγγες με άτομα που έχουν ζαρωμένες φτερούγες και καψαλισμένες σμήριγγες γεννήθηκαν 480 άτομα. Να βρεθεί ο φαινότυπος και ο αριθμός των απογόνων. Τα γονίδια είναι ανεξάρτητα και τα κανονικά επικρατούν.24. Μια δροσόφιλα με ατροφικές σμήριγγες διασταυρώνεται με αρσενικό που έχει κανονικές σμήριγγες. Όλα τα άτομα της F1 έχουν κανονικές σμήριγγες. Από τη διασταύρωση των ατόμων της F1 πήραμε τους εξής απογόνους: 200 αρσενικά και 205 θηλυκά με κανονικές σμήριγγες και 68 αρσενικά και 65 θηλυκά με ατροφικές σμήριγγες. Να εξηγηθεί το αποτέλεσμα. Ποιον τύπο κληρονομικότητας παρουσιάζει το γνώρισμα αυτό; ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻25. Σε κάποιο μαιευτήριο γεννήθηκαν την ίδια μέρα 4 παιδιά ομάδων αίματος Α, 0, ΑΒ και Β αντίστοιχα, αλλά δε σημειώθηκαν αμέσως τα ονόματα των μητέρων τους. Να βρείτε τους γονείς κάθε παιδιού, αν ξέρετε ότι τα ζευγάρια ανήκουν στις εξής ομάδες αίματος: 1 ο ζευγάρι: Β*Β, 2ο ζευγάρι: 0*0, 3ο ζευγάρι: Α*Β, 4ο ζευγάρι:ΑΒ*0. 3
  • 86. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ26. Από το γάμο ατόμων της ίδιας ομάδας αίματος γεννήθηκαν ένα παιδί Α ομάδας και αλφικό (υπολειπ. αυτοσωμικός) και ένα άλλο 0 ομάδας και κανονικό. Αν τα γονίδια είναι ανεξάρτητα ποιοι οι γονότυποι των γονέων;27. Μια γυναίκα έχει σύνδρομο Turner και βλέπει κανονικά τα χρώματα, ενώ η μητέρα της είχε μερική αχρωματοψία. Πόσα αυτοσωμικά και πόσα φυλετικά χρωμοσώματα έχει η γυναίκα αυτή στα σωματικά της κύτταρα; Πώς δημιουργήθηκαν οι γαμέτες για να γεννηθεί αυτό το άτομο;28. Να βρεθεί τι παιδιά θα γεννηθούν από το γάμο μιας κανονικής γυναίκας, της οποίας ο πατέρας ήταν αιμορροφιλικός με μερική αχρωματοψία (δαλτονισμό), με άνδρα κανονικό ως προς την πήξη του αίματος αλλά με δαλτονισμό.29. Από το γάμο κανονικών ατόμων Β ομάδας αίματος γεννήθηκε ένα κορίτσι κανονικό 0 ομάδας και ένα αγόρι Β ομάδας αιμορροφιλικό. Ποιοι οι γονότυποι γονέων και παιδιών; Να γίνει η διασταύρωση.30. Ένα ζευγάρι με φυσιολογική όραση αποκτά ένα κορίτσι και ένα αγόρι. Δεδομένου ότι και οι 2 παππούδες πάσχουν από μερική αχρωματοψία στο κόκκινο, το ζευγάρι υποψιάζεται ότι και τα παιδιά τους μπορεί να πάσχουν. Να δικαιολογήσετε εάν είναι βάσιμες οι υποψίες τους.31. Άνδρας ομάδας ΑΒ Ρέζους (+), του οποίου η μητέρα ήταν Ρέζους(-) παντρεύεται γυναίκα ομάδας Β Ρέζους (-). Ποιες οι πιθανές ομάδες αίματος και παράγοντες ρέζους των παιδιών που θα γεννηθούν; (Ο παράγοντας Ρέζους ελέγχεται ανεξάρτητα απ’ τις ομάδες αίματος και το Ρέζους (-) οφείλεται σε αυτοσωμ. υπολειπόμενο γονίδιο r.)32. Σε μια οικογένεια ο πατέρας ανήκει στην ομάδα αίματος Α και η μητέρα στην ΑΒ. Ποιοι οι πιθανοί γονότυποι και φαινότυποι των παιδιών τους;33. Από τα τρία παιδιά ενός ζευγαριού το ένα είναι υιοθετημένο και το άλλο προέρχεται από τον πρώτο γάμο της γυναίκας. Δεδομένου ότι η ομάδα αίματος της γυναίκας είναι 0, του άντρα της ΑΒ και των τριών παιδιών της ΑΒ, Β και 0, να βρεθεί ποιο παιδί είναι υιοθετημένο, ποιο είναι αποκλειστικά δικό τους και ποιο από τον προηγούμενο γάμο.34. Από τη διασταύρωση ενός άνδρα με ομάδα αίματος Α και μιας γυναίκας ομάδας αίματος Β γεννιέται ένα παιδί ομάδας 0. Ποια η πιθανή ομάδα αίματος του επόμενου παιδιού που σκέφτονται να αποκτήσουν; ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻41. Ένας άνδρας απέκτησε από τους 2 γάμους του 6 αγόρια. Από τον πρώτο, το ένα ήταν αιμορροφιλικό και τα άλλα δύο με μερική αχρωματοψία. Από το δεύτερο γάμο, τα δύο αγόρια ήταν φυσιολογικά και το ένα με αιμορροφιλία και μερική αχρωματοψία. Ποιοι οι πιθανοί γονότυποι των 206
  • 87. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης γυναικών του; (ΠΡΟΣΟΧΗ: και τα δύο ζεύγη γονιδίων είναι φυλοσύνδετα, άρα στο ίδιο ζεύγος χρωμοσωμάτων- ΣΥΝΔΕΔΕΜΕΝΑ).42. Είναι δυνατόν ένα υπολειπόμενο γονίδιο του ανθρώπου να βρίσκεται στο Χ χρωμόσωμα, εάν μια γυναίκα που παρουσιάζει το γνώρισμα και ένας φυσιολογικός άνδρας είχαν κανονικό γιο; Να εξηγήσετε την απάντησή σας.43. Ένας φυσιολογικός άνδρας, του οποίου ο πατέρας έπασχε από ολική αχρωματοψία, παντρεύεται κανονική γυναίκα, της οποίας ο πατέρας ήταν αιμορροφιλικός και με ολική αχρωματοψία. Τι παιδιά θα γεννηθούν απ’ αυτό το γάμο;44. Δύο άντρες εργάζονται σε κέντρο πυρηνικών ερευνών. Ο πρώτος αποκτά αιμορροφιλικό αγόρι και ο δεύτερος αγόρι με επικρατή αυτοσωμική ασθένεια. Και οι 2 ζητούν αποζημίωση με τον ισχυρισμό ότι οι ακτινοβολίες προκάλεσαν τις επιβλαβείς μεταλλάξεις. Αν οι μητέρες των παιδιών είναι φυσιολογικές, να εξετασθεί αν είναι βάσιμοι οι ισχυρισμοί των 2 ανδρών.45. Ο Γιάννης και ο παππούς του, από τη μητέρα, είναι αιμορροφιλικοί και πάσχουν από αιμορροφιλία Α. Ο Γιάννης και η Μαρία έχουν ένα γιο, το Γρηγόρη, και 2 κόρες, τη Χαρά και την Περσεφόνη, που πάσχουν όλοι από αιμορροφιλία. Έχουν επίσης και μια κόρη την Ελένη που δεν πάσχει. (Υποθέτουμε ότι τα θηλυκά άτομα με αιμορροφιλία επιζούν, κάτι που δε συμβαίνει στην πραγματικότητα.) Α) Σχεδιάστε το γενεαλογικό δένδρο. Β) Γιατί η Χαρά και η Περσεφόνη πάσχουν; Γ) Ποια η πιθανότητα ένας γιος της Χαράς να είναι αιμορροφιλικός; Δ) Ποια η πιθανότητα ένας γιος της Ελένης να είναι αιμορροφιλικός; Ε) Ποια η πιθανότητα μια κόρη της Ελένης να είναι αιμορροφιλική; ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻ ☻46. Η φαινυλκετονουρία είναι μια εκ γενετής διαταραχή του μεταβολισμού του αμινοξέος φαινυλαλανίνης. Το ακόλουθο γενεαλογικό δένδρο είναι μιας προσβεβλημένης οικογένειας: Α) Ποιος είναι ο τρόπος κληρονόμησης της ΡΚU; Β) Ποια άτομα είναι ετερόζυγα για τη ασθένεια; Γ) Ποια πιθανότητα έχει το άτομο ΙΙΙ-2 να είναι ετερόζυγο; Δ) Αν τα άτομα ΙΙΙ-3 και ΙΙΙ-4 παντρευτούν, ποια η πιθανότητα το πρώτο τους παιδί να πάσχει; Ι ΙΙ ΙΙΙ 3
  • 88. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ47. Το χαρακτηριστικό που αντιπροσωπεύεται από τα μαυρισμένα σύμβολα στο παρακάτω δένδρο είναι δυνατό να καθορίζεται από: Α) ένα αυτοσωμικό επικρατές Β) ένα αυτοσωμικό υπολειπόμενο Γ) ένα φυλοσύνδετο επικρατές ή Δ) ένα φυλοσύνδετο υπολειπόμενο γονίδιο; Να δικαιολογήσετε γιατί απορρίπτετε τα τρία από τα παραπάνω. 51. Στο παρακάτω γενεαλογικό δένδρο τα σκιασμένα σύμβολα παριστάνουν άτομα με δρεπανοκυτταρική αναιμία. Πώς καταλαβαίνετε ότι κληρονομείται η ασθένεια αυτή; Να προσδιορίσετε τους πιθανούς γονότυπους όλων των ατόμων.48. Από τη μελέτη του παρακάτω δένδρου, μπορείτε να πείτε ότι τα φαινοτυπικά αποτελέσματα οφείλονται σε υπολειπόμενο παθολογικό φυλοσύνδετο γονίδιο; 206
  • 89. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης49. Το χαρακτηριστικό που φαίνεται στο παρακάτω δέντρο με μαυρισμένα σύμβολα θα μπορούσε να οφείλεται σε: επικρατές φυλοσύνδετο, υπολειπ. φυλοσύνδετο, ατελώς φυλοσύνδετο, επικρατές αυτοσωμικό, υπολειπ. αυτοσωμικό ή ολανδρικό;50. Το παρακάτω γενεαλογικό δένδρο δείχνει πώς κληρονομείται το γνώρισμα «γαμψή μύτη» σε μια οικογένεια (μαυρισμένα σύμβολα). Να προσδιορίσετε εάν το γνώρισμα οφείλεται σε επικρατές ή υπολειπόμενο αυτοσωμικό γονίδιο. Ποια η πιθανότητα να εμφανιστεί το γνώρισμα στους απογόνους αν παντρευτούν τα ξαδέρφια ΙΙΙ-1 και ΙΙΙ-3, και ΙΙΙ-2 και ΙΙΙ-4;51. Σε ένα απομονωμένο χωριό ορισμένα άτομα παρουσιάζουν έλλειψη του ενζύμου αφυδρογονάση ΙΙ. Η κατανομή αυτού του χαρακτηριστικού είναι: μια φυσιολογική γυναίκα παντρεύεται έναν άνδρα που πάσχει και κάνουν 3 φυσιολ. κορίτσια, 1 φυσιολ. αγόρι και 1 αγόρι που πάσχει. Το τελευταίο παντρεύεται φυσιολ. γυναίκα και κάνουν 3 φυσιολ. κορίτσια. Ένα από αυτά παντρεύεται άνδρα που πάσχει και κάνουν 2 αγόρια και 1 κορίτσι που πάσχει και 1 αγόρι και 1 κορίτσι που δεν πάσχουν. Ένα από τα φυσιολογικά που γεννήθηκαν από το γάμο Ι παντρεύεται φυσιολ. άνδρα και κάνουν 2 αγόρια και 2 κορίτσια φυσιολογικά. Το ένα από αυτά τα κορίτσια παντρεύτηκε φυσιολ. άνδρα και 3
  • 90. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ γέννησε 1 φυσιολ. κορίτσι και 1 που έπασχε. Γράψτε το γενεαλογικό δένδρο και τους γονότυπους των ατόμων. Σε τι γονίδιο οφείλεται η πάθηση αυτή;52. Από φυσιολογικούς γονείς γεννιέται παιδί που ο οργανισμός του αδυνατεί να συνθέσει λειτουργική αιμοσφαιρίνη. Με ποιους δυνατούς τρόπους θα μπορούσε να εξηγηθεί αυτό;53. Πώς επηρεάζεται η φαινοτυπική αναλογία 9(ΑΒ): 3(αΒ): 3(Αβ): 1(αβ) όταν: Α) το γονίδιο α είναι θνησιγόνο; Β) τα γονίδια α και β είναι θνησιγόνα; Γ) τα γονίδια Β και β είναι ατελώς επικρατή;54. Δύο μεσαίου αναστήματος γονείς αποκτούν ένα πολύ ψηλό παιδί. Πώς εξηγείται;55. Στις κότες το γονίδιο για το στικτό πτέρωμα είναι επικρατές φυλοσύνδετο. Να βρεθούν οι απόγονοι της F2 γενιάς, που προκύπτουν απ’ τη διασταύρωση κανονικού ατόμου με αρσενικό που έχει στικτό πτέρωμα. (Στα πτηνά τα θηλυκά έχουν ΧΨ φυλετικά χρωμοσώματα και τα αρσενικά ΧΧ!)56. Στην κότα το χρώμα του πτερώματος ελέγχεται από τα αλληλόμορφα μαύρο- άσπρο που είναι ατελώς επικρατή, ενώ το χρώμα ματιών από τα φυλοσύνδετα αλληλόμορφα Κ (κόκκινο) και κ (άσπρο). Να βρεθούν οι απόγονοι της F2 γενιάς από το ζευγάρωμα κότας με μαύρο πτέρωμα και κόκκινα μάτια με κόκορα που έχει άσπρο πτέρωμα και άσπρα μάτια.57. Στα περιστέρια μια ασθένεια οφείλεται στο υπολειπόμενο φυλοσύνδετο γονίδιο δ. Ποια η Φ.Α. στην F2 γενιά από τη διασταύρωση θηλυκού κανονικού με αρσενικό που πάσχει;58. Τα δύο πρώτα παιδιά μιας οικογένειας ανήκουν στην ομάδα ΑΒ .Το τρίτο παιδί είναι αγόρι και έχει ομάδα αίματος Ο. Είναι σωστό να θεωρήσουμε ότι ο πατέρας έχει ομάδα αίματος Α και η μητέρα ομάδα αίματος Β ; 206
  • 91. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΕρωτήσεις Πολλαπλής Επιλογής1. Ένας από τους λόγους που τα πειράματα του Mendel ήταν επιτυχή ήταν ότια. χρησιμοποίησε αμιγή στελέχη μοσχομπίζελων για την ιδιότητα που μελετούσεβ. μελέτησε ταυτόχρονα πολλές ιδιότητες του μοσχομπίζελουγ. περιέγραψε τον τρόπο κληρονόμισης ενός γονιδίουδ. περιέγραψε τον τρόπο κληρονόμισης δύο γονιδίων.2. Όταν δύο αλληλόμορφα γονίδια εκφράζονται στο φαινότυπο των ετερόζυγων ατόμωνονομάζονταια. επικρατήβ. πολλαπλά αλληλόμορφαγ. συνεπικρατήδ. ατελώς επικρατή.3. Η μερική αχρωματοψία στο πράσινο είναι μία ασθένεια που ελέγχεται απόα. ατελώς επικρατή γονίδιαβ. υπολειπόμενα φυλοσύνδετα γονίδιαγ. δύο αλληλόμορφα γονίδιαδ. πολλαπλά αλληλόμορφα γονίδια.4. Στα ομόλογα χρωμοσώματα, αλληλόμορφα λέγονται τα γονίδια πουα. καλύπτουν την έκφραση άλλων γονιδίωνβ. βρίσκονται στην ίδια θέση και ελέγχουν την ίδια ιδιότηταγ. προκαλούν πρόωρο θάνατοδ. βρίσκονται στην ίδια θέση και ελέγχουν διαφορετική ιδιότητα. 3
  • 92. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ5. Ένα άτομο χαρακτηρίζεται ως ομόζυγο επικρατές όταν, για μια συγκεκριμένη ιδιότητα, έχεια. δύο επικρατή αλληλόμορφαβ. δύο υπολειπόμενα αλληλόμορφαγ. ένα επικρατές και ένα υπολειπόμενο αλληλόμορφοδ. δύο συνεπικρατή αλληλόμορφα.6. Η β-θαλασσαιμία είναι μία ασθένεια που ελέγχεται απόα. υπολειπόμενα φυλοσύνδετα γονίδιαβ. πολλαπλά αλληλόμορφα γονίδιαγ. δύο αλληλόμορφα γονίδιαδ. ατελώς επικρατή γονίδια.7. Τα γονίδια που βρίσκονται στο Χ χρωμόσωμα και δεν έχουν αλληλόμορφο στο Υ ονομάζονταια. θνησιγόναβ. φυλοσύνδεταγ. υπολειπόμεναδ. φυλετικά.8. Η αιμορροφιλία και η αχρωματοψία είναι ασθένειες οι οποίες εμφανίζονταια. συχνότερα στα αρσενικά άτομαβ. μόνο στα θηλυκά άτομαγ. σε όλους τους απογόνους ανεξαρτήτως φύλουδ. μόνο στα αρσενικά άτομα.9. Κατά τη διασταύρωση ελέγχου ένα άτομο άγνωστου γονότυπου διασταυρώ-νεται με ένα άτομοα. ομόζυγο για το επικρατές αλληλόμορφο γονίδιοβ. ετερόζυγο για το υπολειπόμενο αλληλόμορφο γονίδιογ. ετερόζυγο για το επικρατές αλληλόμορφο γονίδιοδ. ομόζυγο για το υπολειπόμενο αλληλόμορφο γονίδιο.10. Τα φυλοσύνδετα γονίδια βρίσκονται στοΑ. Χ χρωμόσωμα και δεν έχουν αλληλόμορφα στο Ψ.Β. ψ χρωμόσωμα και είναι θνησιγόναΓ. ψ χρωμόσωμα και τα αλληλόμορφά τους βρίσκονται στο Χ χρωμόσωμα 206
  • 93. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΚΕΦΑΛΑΙΟ 6ΜΕΤΑΛΛΑΞΕΙΣ 3
  • 94. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥΔιδακτικοί Στόχοι • Να κάνεις ταξινόμηση των μεταλλαγών ανάλογα με την έκτασή τους • Να ταξινομείς γονιδιακές μεταλλάξεις • Να διακρίνεις τις επιπτώσεις μιας μεταλλαγής στον φαινότυπο • Να περιγράφεις τα αίτια που οδηγούν σε αιμοσφαιρινοπάθειες καθώς και τα συμπτώματά τους • Να διαχωρίζεις τις γενετικές ασθένειες ανάλογα με τα μοριακά αίτια, τα κλινικά συμπτώματα και τον τρόπο κληρονόμησης • Να διαχωρίζεις τις τεχνικές με τις οποίες γίνεται προγεννητικός έλεγχος • Να περιγράφεις τα στάδια μετασχηματισμού ενός κυττάρου σε καρκινικό • Να λύνεις προβλήματα στα οποία θα μπορείς να βρίσκεις τους πιθανούς γαμέτες • Τις φάσεις τις μειωτικής διαίρεσης που πιθανά να έγινε μη διαχωρισμός • Τις θέσεις πιθανών σημειακών μεταλλαγών ανάλογα με τις επιπτώσεις τους στον φαινότυπο. 206
  • 95. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΕπισημάνσεις θεωρίαςΜΕΤΑΛΛΑΓΕΣ ΟΙ ΟΠΟΙΕΣ ΔΕΝ ΕΠΗΡΕΑΖΟΥΝ ΤΟΝ ΦΑΙΝΟΤΥΠΟ 1. Άωρα γεννητικά κύτταρα 2. Μεμονωμένα κύτταρα που δεν πολλαπλασιάζονται (νευρικά κύτταρα) 3. Περιοχές του DNA που δεν αντιστοιχούν σε γονίδια (εσώνια) 4. Να συμβεί σε μη ενεργό γονίδιο (το γονίδιο να μην εκφράζεται στον συγκεκριμένο ιστό και η έκφρασή το να επικαλύπτεται από την έκφραση κάποιου άλλου γονιδίου) 5. Δημιουργία σιωπηλής μεταλλαγής (συνώνυμο αμνοξύ) 6. Δημιουργία διαφορετικού κωδικονίου λήξης στην ίδια θέση 7. Την τοποθέτηση διαφορετικού αμινοξέος το οποίο όμως έχει παρόμοιες φυσικοχημικές ιδιότητες (Ουδέτερη μεταλλαγή) 8. Δομική χρωμοσωμική ανωμαλία που δεν επηρεάζει τον φαινότυπο ΠΑΡΑΤΗΡΗΣΕΙΣ ΜΕΤΑΛΛΑΓΕΣ ΣΥΜΒΑΙΝΟΥΝ ΣΕ ΟΛΑ ΤΑ ΚΥΤΤΑΡΑ ΤΟΣΟ ΤΑ ΣΩΜΑΤΙΚΑ ΟΣΟ ΚΑΙ ΤΑ ΓΑΜΕΤΙΚΑ ΟΙ ΜΕΤΑΛΛΑΓΕΣ ΚΛΗΡΟΝΟΜΟΥΝΤΑΙ ΜΟΝΟ ΟΤΑΝ ΣΥΜΒΟΥΝ ΣΤΑ ΓΑΜΕΤΙΚΑ ΚΥΤΤΑΡΑ ΣΕ ΠΕΡΙΠΤΩΣΗ ΠΟΥ ΕΝΑΣ ΑΝΙΣΟΡΩΠΟΣ ΓΑΜΕΤΗΣ ΓΙΝΙΜΟΠΟΙΗΘΕΙ ΟΔΗΓΕΙ ΣΤΟΝ ΣΧΗΜΑΤΙΣΜΟ ΕΝΟΣ ΟΡΓΑΝΙΣΜΟΥ ΜΕ ΑΝΕΥΠΛΟΕΙΔΙΑ Η ΠΟΛΥΠΛΟΕΙΔΙΑ ΟΙ ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ ΠΡΟΚΥΠΤΟΥΝ ΑΠΟ ΤΟΝ ΣΧΗΜΑΤΙΣΜΟ ΑΝΙΣΟΡΡΟΠΩΝ ΓΑΜΕΤΩΝ ΕΠΕΙΔΗ ΕΓΙΝΕ ΜΗ ΔΙΑΧΩΡΙΣΜΟΣ ΤΩΝ ΟΜΟΛΟΓΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ ΣΤΗ ΜΕΙΩΣΗ Ι ΜΗ ΔΙΑΧΩΡΙΣΜΟΣ ΤΩΝ ΑΔΕΡΦΩΝ ΧΡΩΜΑΤΙΔΩΝ ΣΤΗ ΜΕΙΩΣΗ ΙΙ 3
  • 96. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία του DNA και οι οποίες δημιουργούνσυνήθως έναν διαφορετικό φαινότυπο ( όχι όμως πάντα ) ΜΕΤΑΛΛΑΞΕΙΣ ΓΟΝΙΔΙΑΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣΓονιδιακή μετάλλαξη έχουμε όταν συμβαίνει αλλαγή σε έναν μικρό αριθμό βάσεων είτε μεαντικατάσταση , είτε με προσθήκη είτε με έλλειψη .Χρωμοσωμική ανωμαλία έχουμε όταν συμβαίνουν αλλαγές σε μεγαλύτερο τμήμα τουχρωμοσώματος . ΠΑΡΑΔΕΙΓΜΑ ΓΟΝΙΔΙΑΚΗΣ ΜΕΤΑΛΛΑΞΗΣ ΔΡΕΠΑΝΟΚΥΤΤΑΡΙΚΗ ΑΝΑΙΜΙΑ Στην ασθένεια αυτή τα ερυθροκύτταρα ενός πάσχοντος ατόμου έχουν δρεπανοειδές σχήμα .Αυτό οφείλεται στο γεγονός ότι στο έκτο αμινοξύ της β- πολυπεπτιδικής αλυσίδας τογλουταμινικό οξύ αντικαθίσταται από βαλίνη. Η αλλαγή αυτή οφείλεται σε μια γονιδιακήμετάλλαξη στην τριπλέτα που κωδικοποιεί το γλουταμινικό οξύ . Συγκεκριμένα στην κωδικήαλυσίδα του DNA στο κωδικόνιο GAG αλλάζει η Αδενίνη από την Θυμίνη οπότε το κωδικόνιογίνεται GTG. Οπότε τελικά κωδικοποιείται το αμινοξύ Βαλίνη. Η μεταλλαγμένη αιμοσφαιρίνησυμβολίζεται ως ΗbS.Οι γονιδιακές μεταλλάξεις διακρίνονται σε :Α) Σημειακές μεταλλάξεις : Είναι μεταλλάξεις ενός σημείου , δηλαδή συμβαίνει αλλαγή σε μια μόνο βάση μεΑΝΤΙΚΑΤΑΣΤΑΣΗ . Μπορεί όμως η νέα τριπλέτα που θα σχηματιστεί να οδηγεί στηνκωδικοποίηση του ίδιου αμινοξέος με την αρχική οπότε στην περίπτωση αυτή δεν έχουμεαλλαγές στην πρωτεϊνη που θα σχηματιστεί Αυτή η μετάλλαξη ονομάζεται ΣΙΩΠΗΛΗΜΕΤΑΛΛΑΓΗ. 206
  • 97. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΕάν η νέα τριπλέτα οδηγεί στον σχηματισμό κωδικωνίου ΛΗΞΗΣ τότε τερματίζεται πρόωρα οσχηματισμός της πρωτεϊνης . Εάν η νέα τριπλέτα ορίσει ένα νέο αμινοξύ ενώ πριν ήταν κωδικόνιολήξης τότε θα συνεχιστεί η παραγωγή πρωτεϊνικού προϊόντος .Β) Προσθήκη – έλλειψη νουκλεοτιδίου . Εδώ έχουμε προσθήκη ή έλλειψη ενός ή περισσοτέρων βάσεων . Εάν πρόκειται για προσθήκη ήέλλειψη τριών ή πολλαπλάσιων του τρία βάσεων τότε θα έχουμε προσθήκη ή έλλειψη ενός ήπερισσοτέρων αμινοξέων .ΠΡΟΣΟΧΗ : Όταν έχουμε προσθήκη ή έλλειψη αριθμού βάσεων διαφορετικού από τρία τότεαλλάζει το πλαίσιο ανάγνωσης . ΠΑΡΑΓΟΝΤΕΣ ΜΕΤΑΛΛΑΞΕΩΝ Α) ΑΥΤΟΜΑΤΕΣ ΜΕΤΑΛΛΑΞΕΙΣ Β) ΜΕΤΑΛΛΑΞΟΓΟΝΟΙ ΠΑΡΑΓΟΝΤΕΣΕΡΩΤΗΣΗ :Πως τα κύτταρα προστατεύονται από τους μεταλλαξογόνους παράγοντες ; Τα κύτταρα μπορούν να προστατεύονται από τους μεταλλαξογόνους παράγοντες διότι διαθέτουνένζυμα τα οποία μπορούν και αναγνωρίζουν τις αλλαγές και τις επιδιορθώνουν . ΑΙΜΟΣΦΑΙΡΙΝΕΣΑΙΜΟΣΦΑΙΡΙΝΗ Α (ΗbA ) : Αποτελείται από δύο α και δύο β πολυπεπτιδικές αλυσίδες . ( α 2β2 ) . Το γονίδιο αβρίσκεται στο χρωμόσωμα 16 και το γονίδιο β στο χρωμόσωμα 11. Κάθε μια από τις 4 αυτέςαλυσίδες είναι συνδεδεμένη με ένα μόριο αίμης.ΑΙΜΟΣΦΑΙΡΙΝΗ Α2 ( ΗbA2 ) : Αποτελείται από δύο α και δύο δ αλυσίδες.Το γονίδιο δ βρίσκεται στο χρωμόσωμα 11. ( α2δ2).ΕΜΒΡΥΪΚΗ ΑΙΜΟΣΦΑΙΡΙΝΗ (HbF ) : Είναι η κύρια αιμοσφαιρίνη του ανθρώπου κατά την εμβρυϊκή ζωή και αποτελείται από δύο ακαι δύο γ αλυσίδες . Το γονίδιο γ βρίσκεται στοχρωμόσωμα 11. (α2γ2 ) . 3
  • 98. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΙΜΟΣΦΑΙΡΙΝΟΠΑΘΕΙΕΣ Τα γονίδια των πολυπεπτιδικών αλυσίδων των αιμοσφαιρινών μπορεί να εμφανίσουν πολλέςμεταλλάξεις. Οι μεταλλάξεις αυτές οδηγούν στην δημιουργία των αιμοσφαιρινοπαθειών . Η β-θαλασσαιμία προκύπτει από πολλά είδη μεταλλάξεων(αντικαταστάσεις, ελλείψεις και προσθήκες βάσεων) . Τα ομόζυγα άτομα για την β-θαλασσαιμίαέχουν σοβαρό πρόβλημα αναιμίας γι’ αυτό και κάνουν πολύ συχνά μεταγγίσεις αίματος . Γιανα αντιμετωπίσουν όμως το πρόβλημα υπερφόρτωσης σιδήρουπου τους δημιουργούν οι πολλές μεταγγίσεις ακολουθούν αυστηρή φαρμακευτική αγωγή( αποσιδήρωση ). Τα άτομα αυτά προσπαθώντας να καλύψουν μερικώςτην λειτουργία της HbA αυξάνουν την σύνθεση της εμβρυϊκής αιμοσφαιρίνης ΗbF. Tα ετερόζυγα άτομα εμφανίζουν αύξηση της αιμοσφαιρίνης ΗbA2 (διαγνωστικόςδείκτης ) .ΠΡΟΣΟΧΗ: Τα άτομα που είναι ετερόζυγα για την β- θαλασσαιμία ( φορείς ) εμφανίζουν μιασημαντική ανθεκτικότητα απέναντι στην ασθένεια της Ελονοσίας η οποία προκαλείται από έναπρωτόζωο που ονομάζεται ΠΛΑΣΜΩΔΙΟ. Η α- θαλασσαιμία είναι η αιμοσφαιρινοπάθεια που δημιουργείται από την εμφάνιση μεταλλάξεωνστα γονίδια που κωδικοποιούν την α πολυπεπτιδική αλυσίδα (τα οποία είναι διπλά δηλαδήυπάρχουν δύο γονίδια α σε κάθε ένα από τα ομόλογα χρωμοσώματα ) . Τα γονίδια της ααλυσίδας είναι 4 και μπορούν να εμφανιστούν μεταλλάξεις σε ένα , δύο , τρία ή και στατέσσερα γονίδια . Όσο περισσότερες είναι οι μεταλλάξεις που συμβαίνουν τόσο πιο βαριά θα είναιτα συμπτώματα της ασθένειας . Επειδή η α πολυπεπτιδική αλυσίδα αποτελεί συστατικό όλωντωναιμοσφαιρινών , γι’ αυτό οι μεταλλάξεις στα α γονίδια δημιουργούν πρόβλημα σε όλες τιςαιμοσφαιρίνες . ΦΑΙΝΥΛΚΕΤΟΝΟΥΡΙΑ Είναι μια κληρονομική ασθένεια που οφείλεται σε ένα υπολειπόμενο γονίδιο το οποίο είναιαυτοσωμικό Η ασθένεια δημιουργείται λόγω της απουσίας του ενζύμου το οποίο σταφυσιολογικά άτομα μετατρέπει το αμινοξύ φαινυλαλανίνη σε τυροσίνη . Στα ομόζυγα για τουπολειπόμενο μεταλλαγμένο γονίδιο άτομα δημιουργείται διανοητική καθυστέρηση γιατίπαρεμποδίζεται η φυσιολογική ανάπτυξη και λειτουργία των εγκεφαλικών κυττάρων . 206
  • 99. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης ΑΛΦΙΣΜΟΣ Είναι μια κληρονομική ασθένεια που οφείλεται σε ένα υπολειπόμενο αυτοσωμικό γονίδιο . Οαλφισμός δημιουργείται λόγω της έλλειψης ενός ενζύμου που χρειάζεται για τον σχηματισμότης χρωστικής μελανίνης.( Να σημειώσουμε ότι άλλα άτομα μπορεί να έχουν παντελή έλλειψη ενεργότητας του ενζύμου,ενώ άλλα άτομα .έχουν μειωμένη ενεργότητα του ενζύμου . 3
  • 100. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣΕδώ έχουμε δύο μεγάλες κατηγορίες : ΑΡΙΘΜΗΤΙΚΕΣ και ΔΟΜΙΚΕΣ ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ Οι αριθμητικές χρωμοσωμικές ανωμαλίες εμφανίζονται όταν συμβαίνουν αλλαγές στονΑΡΙΘΜΟ των χρωμοσωμάτων . Όταν έχουμε περίσσεια ή έλλειψη μικρού αριθμού χρωμοσωμάτων από τον κανονικό αριθμότότε η κατάσταση αυτή ονομάζεται ΑΝΕΥΠΛΟΕΙΔΙΑ . Όταν έχουμε ένα περισσότερο χρωμόσωμα από το κανονικό τότε η κατάσταση αυτή ονομάζεταιΤΡΙΣΩΜΙΑ , ενώ όταν έχουμε ένα χρωμόσωμα λιγότερο από το κανονικό τότε η κατάστασηαυτή ονομάζεται ΜΟΝΟΣΩΜΙΑ.Όταν όμως έχουμε διπλασιασμό ή πολλαπλασιασμό του συνόλου των χρωμοσωμάτων ηκατάσταση αυτή ονομάζεται ΠΟΛΥΠΛΟΕΙΔΙΑΟι καταστάσεις αυτές οφείλονται σε μη διαχωρισμό των ομόλογων χρωμοσωμάτων στην μείωση Ιή στον μη διαχωρισμό των αδερφών χρωματίδων στη μείωση ΙΙ. Εικόνα Μη διαχωρισμός στις μειωτικές διαιρέσεις 206
  • 101. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ Εδώ έχουμε αλλαγή στην δομή των χρωμοσωμάτων. Οι μεταλλάξεις αυτές έχουν ωςαποτέλεσμα αλλαγή στην ποσότητα και στη διάταξη της γενετικής πληροφορίας . Διακρίνουμε τιςεξής κατηγορίες δομικών χρωμοσωμικών ανωμαλιών :  Έλλειψη ( Όταν κάποιο τμήμα του χρωμοσώματος χαθεί )  Διπλασιασμός (Όταν διπλασιαστεί κάποιο τμήμα ενός χρωμοσώματος)  Αναστροφή (Όταν σπάσει κάποιο τμήμα ενός χρωμοσώματος, αναστραφεί και ενωθεί ξανά )  Μετατόπιση (Όταν έχουμε σπάσιμο κάποιου τμήματος ενός χρωμοσώματος και στην συνέχεια μεταφορά και ένωση του τμήματος αυτού με ένα άλλο ΜΗ ομόλογο χρωμόσωμα) . 3
  • 103. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης Α. ΤΡΙΣΩΜΙΑ 21 (ΣΥΝΔΡΟΜΟ DOWN ) Χαρακτηριστική περίπτωση τρισωμίας που συναντάμε στονάνθρωπο είναι η τρισωμία 21 ( Σύνδρομο Down ). Στονκαρυότυπο αυτών των ατόμων εμφανίζονται στο 21ο ζεύγοςχρωμοσωμάτων , τρία χρωμοσώματα αντί για δύο που είναι τοκανονικό . Τα άτομα αυτά πάσχουν από διανοητική καθυστέρηση ,έχουν μογγολοειδές πρόσωπο και είναι στείρα.. Η ύπαρξη τουεπιπλέον χρωμοσώματος οφείλεται σε μη διαχωρισμό τωνχρωμοσωμάτων του 21ου ζεύγους κατά τον σχηματισμό τωνγαμετών στη μείωση. Σημαντική πιθανότητα να γεννήσει παιδί που να πάσχει από τοσύνδρομο αυτό έχει μια γυναίκα που έχει περάσει τα 45 χρόνια ζωής. Β. ΤΡΙΣΩΜΙΑ 13 - ΤΡΙΣΩΜΙΑ 18 Πρόκειταιγια αριθμητικές χρωμοσωμικές ανωμαλίες που αφορούν τα αυτοσωμικά χρωμοσώματα 13 και 18. Αυτές είναι βαρύτερες ανωμαλίες από την τρισωμία 21 , διότι τα χρωμοσώματα αυτά είναιμεγαλύτερα σε μέγεθος και περιέχουν περισσότερα γονίδια . ΑΡΙΘΜΗΤΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ ΣΕ ΦΥΛΕΤΙΚΑ ΧΡΩΜΟΣΩΜΑΤΑΑ. ΣΥΝΔΡΟΜΟ KLEINEFELTER Tα άτομα που πάσχουν από το σύνδρομο αυτό έχουν τον κανονικό αριθμό αυτοσωμικώνχρωμοσωμάτων, αλλά έχουν τρία φυλετικά χρωμοσώματα αντί για δύο που είναι το φυσιολογικό .Τα φυλετικά τους χρωμοσώματα είναι ΧΧΥ αντί για ΧΥ . Τα άτομα αυτά έχουν εξωτερικάχαρακτηριστικά αρσενικού ατόμου αλλά είναι στείρα .Β. ΣΥΝΔΡΟΜΟ TURNER Tα άτομα αυτά έχουν τον κανονικό αριθμό αυτοσωμικών χρωμοσωμάτων, αλλά έχουν σταφυλετικά χρωμοσώματα μόνο ένα χρωμόσωμα Χ και τα συμβολίζουμε ως ΧΟ. Πρόκειται για τηνμοναδική μονοσωμία που συναντάμε στον άνθρωπο .Τα άτομα αυτά είναι θηλυκά αλλά δενεμφανίζουν δευτερογενή χαρακτηριστικά φύλου και είναι στείρα . ΔΟΜΙΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ ΑΝΩΜΑΛΙΕΣ Οι ανωμαλίες αυτές είναι η έλλειψη , ο διπλασιασμός , η αναστροφή και η μετατόπιση . 3
  • 104. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Η Έλλειψη είναι απώλεια γενετικού υλικού . Δηλαδή μπορεί ένα τμήμα ενός χρωμοσώματος νασπάσει και να χαθεί .Παράδειγμα έλλειψης είναι το σύνδρομο φωνή της γάτας , η οποία οφείλεταιστην έλλειψη ενός μεγάλου τμήματος του μικρού βραχίονα από το χρωμόσωμα 5. Ονομάστηκεέτσι γιατί το κλάμα των νεογέννητων που πάσχουν από την ασθένεια αυτή μοιάζει με το κλάματης γάτας. Τα άτομα που πάσχουν έχουν διανοητική καθυστέρηση.Ο Διπλασιασμός συμβαίνει όταν διπλασιαστεί κάποιο τμήμα ενός χρωμοσώματος.Η Αναστροφή γίνεται όταν σπάσει κάποιο τμήμα ενός χρωμοσώματος, αναστραφεί καιεπανακολλήσει στο ίδιο σημείο του χρωμοσώματος.Η Μετατόπιση συμβαίνει όταν έχουμε θραύση ενός τμήματος ενός χρωμοσώματος ,το οποίο στηνσυνέχεια μεταφέρεται και ενώνεται σε ένα άλλο μη ομόλογο χρωμόσωμα . Μπορεί να έχουμε καιαμοιβαία μετατόπιση χρωμοσωμικών τμημάτων μεταξύ δύο μη ομολόγων χρωμοσωμάτων. ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Προγεννητικός έλεγχος μπορεί να γίνει για όλες σχεδόν τις ασθένειες που οφείλονται σεγνωστές μεταλλάξεις . Ακολουθούμε την εξής μεθοδολογία : ΛΗΨΗ ΑΜΝΙΑΚΟΥ ΥΓΡΟΥ ΛΗΨΗ ΧΟΡΙΑΚΩΝ ΛΑΓΝΩΝΑΠΟΜΟΝΩΣΗ DNA KAΛΛΙΕΡΓΕΙΑ ΒΙΟΧΗΜΙΚΗ ΚΥΤΤΑΡΩΝ ΑΝΑΛΥΣΗΑΝΑΛΥΣΗ DNA ΚΑΡΥΟΤΥΠΟΣ 206
  • 105. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΓΕΝΕΤΙΚΗ ΚΑΘΟΔΗΓΗΣΗ Πρόκειται για μια πληροφόρηση των ατόμων για τις πιθανότητες που έχουν να εμφανίσουν μιαγενετική ασθένεια . Τα άτομα που αφορά είναι κατά κύριο λόγο τα εξής: 1) Άτομα με οικογενειακό ιστορικό γενετικών ασθενειών 2) Άτομα που είναι φορείς γενετικών ανωμαλιών . 3) Γυναίκες ηλικίας άνω των 35 ετών οι οποίες θέλουν να αποκτήσουν παιδί 4) Γυναίκες με πολλές αποβολές . ΟΓΚΟΓΟΝΙΔΙΑ Προέρχονται από τα πρωτοογκογονίδια τα οποία είναι γονίδια που παίζουν ρόλο στονκυτταρικό,πολλαπλασιασμό .Αν κάποιο πρωτοογκογονίδιο υποστεί μετάλλαξη τότε μπορεί ναμετατραπεί σε ογκογονίδιο, το οποίο θα οδηγήσει το κύτταρο σε ανεξέλεγκτο πολλαπλασιασμόοπότε θα δημιουργηθεί καρκίνος. ΚΑΡΚΙΝΟΣ Πρόκειται για μια γενετική ασθένεια που μπορεί να είναι κληρονομική , αλλά μπορεί και όχι .Νασημειωθεί ότι οι κληρονομικές μορφές καρκίκου δεν κληρονομούνται πάντα με μενδελικό τρόπο .Ο καρκίνος προκαλείται :Α) από διάφορες μεταλλάξεις που συμβαίνουν σε κάποια γονίδια όπως είναι ταπρώτοογκογονίδια , τα ογκοκατασταλτικά γονίδια και τα γονίδια επιδιόρθωσης βλαβών .Β) από επίδραση μεταλλάξεων αλλά και επίδραση περιβαλλοντικών συνθηκών π.χ. χημικέςουσίες.Γ) από επίδραση διαφόρων ιών ΟΓΚΟΚΑΤΑΣΤΑΛΤΙΚΑ ΓΟΝΙΔΙΑΤα γονίδια αυτά οδηγούν στην καταστολή της κυτταρικής διαίρεσης . Αν συμβεί κάποιαμετάλλαξη σε τέτοια γονίδια τότε αυτά τα γονίδια χάνουν την ικανότητα που έχουν να 3
  • 106. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥκαταστέλλουν την κυτταρική διαίρεση οπότε τα κύτταρα εμφανίζουν ανεξέλεγκτοπολλαπλασιασμό και άρα καρκίνο. 206
  • 107. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης Πινακάκι Αθενειών 3
  • 108. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Ερωτήσεις Θεωρίας ΤΥΠΟΣ ΑΣΘΕΝΕΙΑ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑΣ ΜΟΡΙΑΚΟ ΑΙΤΙΟ ΣΥΜΠΤΩΜΑΤΑ δρεπανοκυτταρική αναιμία αυτοσωμικός υπολειπόμενος αλλαγή της βάσης Α σε Τ δρεπάνωση αντικατάσταση του γλουταμικού από ατελής κυκλοφορία βαλίνη αίματος δυσλειτουργία αιμοσφαιρίνης αναιμία προβλήματα σε ζωτικά όργανα πνεύμονες, σπλήνας Β- μεσογειακή αναιμία αυτοσωμικός υπολειπόμενος ελλείψεις σοβαρή αναιμία αντικαταστάσεις λιγότερο σοβαρή αναιμία προσθήκες βάσεων β γονιδίων αιμοσφαιρίνης Α- μεσογειακή αναιμία αυτοσωμικός υπολειπόμενος έλλειψη ολόκληρου του γονιδίου σοβαρή αναιμία που κωδικοποιεί για την α- αλυσίδα μη συμβατή με τη ζωή η έλλειψη και των 4 αλυσίδων μη φυσιολογική Φαινυλκετονουρία αυτοσωμικός υπολειπόμενος έλλειψη ενζύμου ανάπτυξη που μεταβολίζει την φαινυλαλανίνη σε τυροσίνη εγκεφάλου νοητική στέρηση έλλειψη ενζύμου που οδηγεί στην Αλφισμός αυτοσωμικός υπολειπόμενος παραγωγή έλλειψη χρωστικής από μελανίνης δερμα μαλλιά ίριδα Εμφάνιση ετερογένειας Καθυστέρηση στην Σύνδρομο Down μη διαχωρισμός ομόλογων τρισωμία 21 ανάπτυξη χρωμοσωμάτων 21 νοητική στέρηση δυσμορφίες στο κατά τη μείωση πρόσωπο φαινότυπος αρσενικού Σύνδρομο Kleinefeler μη διαχωρισμός φυλετικών γονότυπος ΧΧψ ατόμου χρωμοσωμάτων στείρα άτομα κατά τη μείωση φαινότυπος θηλυκού Σύνδρομο Turner μη διαχωρισμός φυλετικών γονότυπος Χ 0 ατόμου χρωμοσωμάτων στείρα άτομα κατά τη μείωση έλλειψη τμήματος Σύνδρομο φωνής γάτας χρωμοσώματος 5 φωνή γάτας νοητική στέρηση μεταλλαγές σε επιδιορθωτικάΜελαχρωματική ξηροδερμία ένζυμα προδιάθεση για καρκίνο του DNA γενετική αστάθεια καρκίνος Ρετινοβλάστωμα συσσώρευση μεταλλαγών σε αμφιβληστροειδούς ογκοκατασταλτικό γονίδιο φυλοσύνδετα υπολειπόμενα έλλειψη παράγοντα πήξης 8 αιμορροφιλία αιμορροφιλία ΑΔαλτωνισμός στο πράσινο και το κόκκινο φυλοσύνδετα υπολειπόμενα 206
  • 109. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης1. Τι είναι οι μεταλλάξεις και σε ποιες κατηγορίες διακρίνονται σύμφωνα με την έκτασή τους;Ποια είναι σε γενικές γραμμές τα αποτελέσματά τους;2. Τι γνωρίζετε για τη δρεπανοκυτταρική αναιμία; (ανακάλυψη, αιτία, φορείς, συμπτώματα)3. Ποιοι οι διαφορετικοί τύποι γονιδιακών μεταλλάξεων και ποιες οι συνέπειές τους;4. Πού γίνονται οι μεταλλάξεις; Είναι πάντα βλαβερές για τον οργανισμό;5. Ποιοι παράγοντες προκαλούν μεταλλάξεις και πώς λέγονται; Πώς το κύτταρο περιορίζει τηδράση τους;6. Τι γνωρίζετε για τις αιμοσφαιρίνες; (μόριο, τύποι, αλυσίδες) Ποιες οι κατηγορίες τωναιμοσφαιρινοπαθειών και τι γνωρίζετε για την καθεμιά; Ποιου τύπου μεταλλάξεις προκαλούν τηνα- και ποιου την β- θαλασσαιμία;7. Ποιες διαταραχές του μεταβολισμού σχετίζονται με μεταλλάξεις;8. Ποιες οι κατηγορίες των χρωμοσωμικών ανωμαλιών και πού οφείλεται η καθεμιά;9. Δώστε ορισμούς: ανευπλοειδία, τρισωμία, μονοσωμία. Πόσα χρωμοσώματα έχει έναμονοσωμικό και ένα τρισωμικό κύτταρο του ανθρώπου;10. Τι γνωρίζετε για τις αριθμητικές χρωμοσωμικές ανωμαλίες στον άνθρωπο; Γιατί οι τρισωμίεςπου παρατηρούνται με μεγαλύτερη συχνότητα αφορούν τα χρωμοσώματα 13, 18, 21;11. Τι γνωρίζετε για τις κατηγορίες των δομικών χρωμοσωμικών ανωμαλιών; Ποιες απόαυτές έχουν αποτέλεσμα τη μεταβολή της ποσότητας του γενετικού υλικού; Ποιες είναι οιεπιπτώσεις των δομικών χρωμοσωμικών ανωμαλιών;12. Σε τι μας βοηθά η διάγνωση των γενετικών ασθενειών και με ποιες μεθόδους γίνεται;Αναφέρετε 2 παραδείγματα εφαρμογής της μεθοδολογίας αυτής.13. Τι ονομάζουμε γενετική καθοδήγηση και σε ποιες περιπτώσεις είναι απαραίτητη;14. Ποιες οι σημερινές μέθοδοι προγεννητικού ελέγχου και ποια τα πλεονεκτήματα της καθεμιάς;15. Δώστε ορισμούς: ογκογονίδια, πρωτο-ογκογονίδια, ογκοκατασταλτικά γονίδια. Τι γνωρίζετεγια τη σχέση τους με τον καρκίνο;16. Γιατί ο καρκίνος θεωρείται εξαιρετικά πολύπλοκη ασθένεια; Από τι προκαλείται τελικά;17.Σε τι οφείλεται η μελαγχρωματική ξηροδερμία;Συνδυαστικές Ερωτήσεις Θεωρίας 3
  • 110. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ1. Γιατί η μονοσωμία είναι συνήθως θανατηφόρος για τον οργανισμό; Ποια μονοσωμία γνωρίζετε στον άνθρωπο;2. Ποια διαφορά εντοπίζεται ανάμεσα στα άτομα που πάσχουν από δρεπανοκυτταρική αναιμία και στα φυσιολογικά;3. Γιατί στα ομόζυγα άτομα με β-θαλασσαιμία εμφανίζεται αύξηση της HbF;4. Πώς δημιουργούνται γαμέτες με αριθμό χρωμοσωμάτων μικρότερο ή μεγαλύτερο του φυσιολογικού; (σχήμα)5. Σε ποια περίπτωση η HbΑ2 αποτελεί διαγνωστικό δείκτη;6. Ποια είναι η δομή ενός μορίου αιμοσφαιρίνης;7. Σε τι διαφέρει η δρεπανοκυτταρική αναιμία από τη β-θαλασσαιμία;8. Να αναφέρετε 2 ασθένειες που οφείλονται σε μεταλλάξεις και κληρονομούνται με αυτοσωμικό υπολειπόμενο τρόπο.9. Τι ονομάζουμε σιωπηλές μεταλλάξεις;10.Γιατί τα άτομα με μελαγχρωματική ξηροδερμία εμφανίζουν πολλαπλάσια συχνότητα καρκίνων του δέρματος;11. Ποιες διαγνωστικές μεθόδους θα χρησιμοποιούσατε προκειμένου να διαγνώσετε τη φαινυλκετονουρία και τη δρεπανοκυτταρική αναιμία σε ένα έμβρυο, ένα βρέφος και μια έγκυο γυναίκα; Να αιτιολογήσετε την απάντησή σας.12. Γιατί μια μετάλλαξη, που μπορεί να συμβεί στο ενεργό κέντρο ενός ενζύμου, έχει σαν αποτέλεσμα τη μεταβολή της ενεργότητάς του;13. Με ποια μέθοδο γίνεται η διάγνωση της φαινυλκετονουρίας, της β- θαλασσαιμίας, της τρισωμίας 21 και της δρεπανοκυτταρικής αναιμίας;14. Να εξηγήσετε γιατί τα άτομα που είναι φορείς αμοιβαίων μετατοπίσεων στο γενετικό τους υλικό, εμφανίζουν κίνδυνο απόκτησης απογόνων με χρωμοσωμικές ανωμαλίες.15. Σε κάποιες περιοχές, όπου εμφανιζόταν παλιότερα η ελονοσία, η συχνότητα ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία και β- θαλασσαιμία είναι αυξημένη. Γιατί συμβαίνει αυτό;16.Πώς γίνεται η ενεργοποίηση των ογκογονιδίων και πώς η απενεργοποίηση των ογκοκατασταλτικών γονιδίων; Ποιες είναι οι συνέπειες σε κάθε περίπτωση;17. Σε μια αναστροφή όλα τα γονίδια είναι παρόντα (δεν έχουμε αλλαγή στην ποσότητα του γενετικού υλικού). Γιατί η αλλαγή αυτή θεωρείται μετάλλαξη; 206
  • 111. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης Εκπαίδευσης18. Πώς μπορεί να προκύψει άτομο ΧΧΥ και πώς άτομο ΧΟ και ποιο το φύλο τους;19. Σε ποιες περιπτώσεις μεταλλάξεων δεν παρατηρείται αλλαγή στον αριθμό των βάσεων του γονιδιώματος;20. Να αναφέρεις σε ποιες περιπτώσεις παρατηρείται λανθασμένη ποσότητα του γενετικού υλικού σε ένα άτομο.21.Η γάτα έχει 2n =38 χρωμοσώματα. Πόσα έχει ένα γατάκι με μονοσωμία ή τρισωμία;22. Ένας οργανισμός έχει 2n =8 χρωμοσώματα. Ποιος είναι ο αριθμός των χρωμοσωμάτων στους γαμέτες, αν δε γίνει φυσιολογικά ο διαχωρισμός ενός ζεύγους ομόλογων χρωμοσωμάτων;23.Γιατί η ομόζυγη β-θαλασσαιμία δεν είναι εμφανής κατά τη γέννηση του πάσχοντος ατόμου, αλλά εκδηλώνει τα συμπτώματά της κατά τη διάρκεια του πρώτου έτους της ζωής;24. Ποια είναι η επίδραση προσθήκης ή έλλειψης βάσεων στην αλληλουχία των αμινοξέων της παραγόμενης πρωτεΐνης; 3
  • 112. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Μεθοδολογία ασκήσεων  Για την επίλυση των ασκήσεων και των προβλημάτων αυτού του κεφαλαίου θα πρέπει να έχουμε υπόψη μας τα είδη των μεταλλάξεων: ΜΕΤΑΛΛΑΞΕΙΣ ΓΟΝΙΔΙΑΚΕΣ ΧΡΩΜΟΣΩΜΙΚΕΣ (ανωμαλίες) (επιβλαβείς, ουδέτερες, σιωπηλές) Αντικατάσταση έλλειψη προσθήκη αριθμητικές δομικές Βάσεων βάσεων βάσεων (ανευπλοειδίες) - Μονοσωμία - έλλειψη -Τρισωμία - διπλασιασμός - αναστροφή - μετατόπιση  Τα προβλήματα συνήθως αφορούν: Α) τους τύπους και τις επιπτώσεις των γονιδιακών μεταλλάξεων στην πολυπεπτιδική αλυσίδα που κωδικοποιείται από ένα τμήμα γενετικού υλικού, Β) τον τρόπο με τον οποίο δημιουργούνται γαμέτες με χρωμοσωμικές ανωμαλίες, Γ) διασταυρώσεις ατόμων με χρωμοσωμικές ανωμαλίες, Δ) διασταυρώσεις ατόμων με γονιδιακές μεταλλάξεις.  Πιο αναλυτικά: Α) Όταν το πρόβλημα δίνει μια γονιδιακή μετάλλαξη, πρέπει να εξετάζουμε: - αν είναι σιωπηλή (καμία επίπτωση στην πολυπεπτιδική αλυσίδα), - αν είναι ουδέτερη (αλλαγή αμινοξέος χωρίς επιπτώσεις στη λειτουργικότητα της πρωτεΐνης), - αν είναι επιβλαβής. Στην περίπτωση αυτή μπορεί: να καταστρέφεται το κωδικόνιο έναρξης, να καταστρέφεται το κωδικόνιο λήξης, να δημιουργείται κωδικόνιο λήξης, να αλλάζουν ένα ή περισσότερα αμινοξέα. Β) Όταν το πρόβλημα ζητάει τον τρόπο με τον οποίο δημιουργήθηκαν μη φυσιολογικοί γαμέτες, πρέπει να εξετάσουμε την περίπτωση το λάθος να έχει συμβεί στην 1 η ή στη 2η μειωτική διαίρεση ή και στις 2. Αυτό προϋποθέτει να γνωρίζουμε καλά το σχήμα του βιβλίου για τον μη διαχωρισμό (σελ.95). 206
  • 113. Παναγιώτα Γκογκόση, Εκπαιδευτικός Μέσης ΕκπαίδευσηςΑσκήσεις1. Υπήρξε μια πολύ σπάνια περίπτωση κατά την οποία ο πατέρας ομάδας αίματος Ο και η μητέρα ομάδας ΑΒ γέννησαν παιδί ομάδας Ο. Να εξηγηθεί το γεγονός γνωρίζοντας ότι ο υποτιθέμενος πατέρας (μετά από τεστ πατρότητας) ήταν και ο πραγματικός.2. Δύο φυσιολογικοί γονείς γεννούν παιδί που πάσχει από τρισωμία 21. Να εξηγηθεί το γεγονός με διασταυρώσεις.3. Οι ανωμαλίες στον αριθμό των χρωμοσωμάτων επιφέρουν παθήσεις. Πώς μπορούν να συμβούν αυτές οι παρεκκλίσεις (ή ανωμαλίες) των χρωμοσωμάτων;4. Να αιτιολογήσετε 2 πιθανούς τρόπους με τους οποίους μπορεί να δημιουργηθεί ένα ανθρώπινο ζυγωτό με φυλετική χρωμοσωμική σύνθεση ΧΧΧΥ.5. Να εξηγήσετε την εμφάνιση ατόμου που πάσχει από σύνδρομο Turner και Down ενώ οι γονείς του είναι φυσιολογικοί.6. Πώς οι χρωμοσωμικές αποκλίσεις επιδρούν στον καθορισμό του φύλου στους ανθρώπους;7. Ένα κανονικό ζευγάρι κάνει κορίτσι με αχρωματοψία. Σε ποιον από τους 2 γονείς συνέβη ο μη-αποχωρισμός;8. Έστω χρωμόσωμα με την ακόλουθη σειρά γονιδίων: ΑΒΓΔΕΖΗΘ. Τι είδους μετάλλαξη έχει συμβεί ώστε να προκύψουν χρωμοσώματα με τις εξής σειρές γονιδίων: Α) ΑΒΓΔΕΘΗΖ Β) ΑΒΓΔΕΖ Γ) ΑΒΓΔΕΔΕΖΗΘ9. Αν υποθέσουμε ότι τα άτομα με σύνδρομο Kleinefelter είναι γόνιμα, να δείξετε με διασταυρώσεις τι απογόνους θα δώσει ένα τέτοιο άτομο αν διασταυρωθεί: Α) με φυσιολογικό άτομο Β) με άτομο που πάσχει από το σύνδρομο τριπλού-Χ10. Να δικαιολογήσετε εάν: Α) από ζευγάρι με φυσιολογική πήξη αίματος μπορεί να γεννηθεί κορίτσι με αιμορροφιλία και σύνδρομο Turner, Β) από άνδρα φυσιολογικό και γυναίκα με δαλτωνισμό, μπορεί να προκύψει παιδί με Kleinefelter και δαλτωνισμό. 11. Ο καθορισμός του φύλου στις γάτες γίνεται όπως και στον άνθρωπο. Το καστανόμαυρο χρώμα οφείλεται στην παρουσία και των δύο αλληλομόρφων ενός φυλοσύνδετου γονιδίου. Βρέθηκε στικτός και στείρος γάτος. Να εξηγήσετε την εμφάνισή του. 12. Μια γυναίκα έχει σύνδρομο Tumer και διακρίνει κανονικά τα χρώματα, ενώ η 3
  • 114. ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥμητέρα της είχε μερική αχρωματοψία στο κόκκινο. Πόσα αυτοσωμικά και πόσαφυλετικά χρωμοσώματα έχει η γυναίκα στα σωματικά της κύτταρα; Εξηγείστε πωςδημιουργήθηκαν οι γαμέτες για να γεννηθεί αυτό το άτομο 206
  • 115. 13. Από φυσιολογικούς γονείς γεννιούνται τα εξής 3 παιδιά:α) γιος με σύνδρομο Kleinefelter και μερική αχρωματοψία στο πράσινοβ) γιος με σύνδρομο Κleinefelter και φυσιολογική όρασηγ) κόρη με φυσιολογική χρωμοσωμική σύσταση και μερική αχρωματοψία στοπράσινο.Εξηγείστε με ποιο τρόπο έγινε δυνατή η γέννηση των παιδιών αυτών.14. H αλληλουχία αμινοξέων val-lys-ala-ala αποτελεί τμήμα φυσιολογικήςπρωτεΐνης. Να προσδιορίσεις τον τύπο της μετάλλαξης ο οποίος έχει ωςαποτέλεσμα την αλλαγή της αλληλουχίας ή του αριθμού των αμινοξέων σεκαθεμιά από τις παρακάτω μεταλλαγμένες πρωτεΐνης. (Συμβουλευτείτε τογενετικό κώδικα.) Φυσιολογική αλληλουχία val-lys-ala-ala Μεταλλαγμένη Α val Μεταλλαγμένη Β val-arg-leu Μεταλλαγμένη Γ val-lys-gly-cys Μεταλλαγμένη Δ val-glu-ala-ala15. To γονίδιο για ένα ένζυμο αποτελείται από 3 εξώνια. Παρακάτω φαίνεται η αλληλουχία της κωδικής αλυσίδας για τα 2 πρώτα εξώνια (κεφαλαία γράμματα) και ακόμη κάποιο μέρος της αλληλουχίας (μικρά γράμματα) γύρω από αυτά τα εξώνια: 5’…accggcagtagATATCAGACCATGCTAATCGCTCCCCGACgtaagtt… …3’ 14 26…ggctGGGTAGTTT…3’Α) Πόσα αμινοξέα κωδικοποιούνται από το πρώτο εξώνιο;Β) Ποιο είναι το αποτέλεσμα στην έκφραση του γονιδίου αυτού, αν η βάση μεαριθμό 14 στο πρώτο εξώνιο αλλάξει από C σε T; (Συμβουλευτείτε τογενετικό κώδικα.)Γ) Σε ποιο εξώνιο βρίσκεται το κωδικόνιο λήξης;Δ) Ποιο είναι το αποτέλεσμα στην έκφραση του γονιδίου αυτού, αν η βάση μεαριθμό 26 στο πρώτο εξώνιο αλλάξει από C σε T; (Συμβουλευτείτε τογενετικό κώδικα.)16. H αλληλουχία βάσεων 5’…AUGACUGAAUUCAAGGCC…3’ αποτελεί τμήμαώριμου mRNA που κωδικοποιεί τα πρώτα 6 αμινοξέα μιας πρωτεΐνης. Τιείδους γονιδιακή μετάλλαξη θα συμβεί στο αντίστοιχο τμήμα της κωδικήςαλυσίδας του γονιδίου ώστε να σχηματίσει πρωτεϊνη που να λείπουν τα 4πρώτα αμινοξέα; (Να θεωρήσεις ότι δεν έγινε αφαίρεση αμινοξέος από τοαμινικό άκρο της πολυπεπτιδικής αλυσίδας)
  • 116. 17. Οι παρακάτω μεταλλαγμένες αιμοσφαιρίνες χαρακτηρίζονται από συγκεκριμένη αντικατάσταση αμινοξέων στη πολυπεπτιδική αλυσίδα. Πώς πραγματοποιήθηκαν οι αλλαγές αυτές; (Συμβουλευτείτε το γενετικό κώδικα.) Θέση αμινοξέος --2-------16-------43-------67----------132------143 Φυσιολογική -his-------gly-----glu-------val----------lys--------his Tokuchi -tyr----------------------------------------------------- Baltimore -----------asp------------------------------------------- Galveston --------------------ala---------------------------------- Milwaukee ------------------------------glu------------------------ Woolwich --------------------------------------------gln---------- Kettwood ------------------------------------------------------asp 18. Πιο κάτω φαίνεται ένα τμήμα της κωδικής αλυσίδας του DNA που μεταγράφεται. 5- CAT CCA AAT TGT TGC CCG -3α) (i) Να γράψετε το mRNA που μεταγράφεται από το πιο πάνω τμήμα του DNA.(ii) Χρησιμοποιώντας τον πιο κάτω πίνακα, να γράψετε με τη σειρά τα αμινοξέα πουκωδικοποιεί το πιο πάνω τμήμα του DNA. β) Το τμήμα του DNA μπορεί να υποστεί μεταλλάξεις κατά διάφορους τρόπους. Μερικοί φαίνονται πιο κάτω : Κανονικό DNA CAT CCA AAT TGT TGC CCG Μετάλλαξη 1 CAT CCA AAT TCT TGC CCG Μετάλλαξη 2 CAT CCA AAT TTT GCC CG Μετάλλαξη 3 CAT CAC AAT TGT TGC CCG (i) Να ονομάσετε το κάθε είδος της γονιδιακής μετάλλαξης. (ii) Να εξηγήσετε ποια μετάλλαξη θα έχει τη μεγαλύτερη επίδραση στην πρωτοταγή δομή του πολυπεπτιδίου που θα σχηματισθεί. γ) Ποιος είναι ο ρόλος του ενζύμου πριμάση στην αντιγραφή του DNA;
  • 117. Ερωτήσεις Πολλαπλής Επιλογής1. Οι μεταλλάξεις έχουν ως αποτέλεσμα α. τη δημιουργία γενετικής ποικιλότητας β. τη δημιουργία κληρονομικών ασθενειών γ. την εμφάνιση πολλών περιπτώσεων καρκίνου δ. όλα όσα περιγράφονται στα α, β, γ.2. Ποιες από τις παρακάτω προτάσεις, που αφορούν τη δρεπανοκυτταρική αναι-μία,είναι λανθασμένες; α. Τα ερυθροκύτταρα περιέχουν την HbS αντί της HbA. β. Οφείλεται σε ελλείψεις ή προσθήκες βάσεων. γ. Το έκτο αμινοξύ της β-αλυσίδας αντί για γλουταμινικό είναι βαλίνη. δ. Το πέμπτο αμινοξύ της α-αλυσίδας αντί για γλουταμινικό είναι λευκίνη.3. Η συχνότητα εμφάνισης μεταλλάξεων σε περιοχές γονιδίων στο γενετικό υλικόείναι υποδεκαπλάσια της συχνότητας εμφάνισης μεταλλάξεων στο υπόλοιπο 95%γιατί α. οι περιοχές εκτός γονιδίων είναι περισσότερες β. οι κωδικοποιούσες περιοχές βρίσκονται κάτω από εξελικτική πίεση γ. οι περιοχές εκτός γονιδίων δε βρίσκονται κάτω από εξελικτική πίεση δ. οι περιοχές εκτός γονιδίων βρίσκονται κάτω από εξελικτική πίεση4. Ποια από τις παρακάτω προτάσεις δεν αφορά την α-θαλασσαιμία; α. Είναι αποτέλεσμα έλλειψης ολόκληρου του γονιδίου α. β. Μπορούν να δημιουργηθούν ελλείψεις σε ένα, δύο, τρία ή και στα τέσσερα γονίδια α. γ. Τα άτομα με α-θαλασσαιμία εμφανίζουν ανθεκτικότητα στο πρωτόζωο της ελονοσίας. δ. Η έλλειψη της α-αλυσίδας επηρεάζει όλες τις αιμοσφαιρίνες.5. Τα άτομα, που εμφανίζουν τρισωμία 13 και 18, εμφανίζουν βαρύτερα συμ-πτώματααπό αυτά που πάσχουν από σύνδρομο Down επειδή τα χρωμοσώ-ματα α. 13 και 18 είναι αυτοσωμικά β. 13 και 18 είναι μεγαλύτερα και με περισσότερα γονίδια γ. 13 και 18 είναι μικρότερα αλλά περιέχουν σημαντικότερα γονίδια δ. 13 και 18 είναι φυλοσύνδετα. 207
  • 119. Διδακτικοί στόχοι • Να ταξινομείς τους μικροοργανισμούς που αναφέρονται στο σχολικό βιβλίο ανάλογα με την προτίμηση του για τις συνθήκες: θερμοκρασία, ρ. Η , οξυγόνο, πηγή άνθρακα, διαθεσιμότητα θρεπτικών • Να περιγράφεις τον τρόπο με τον οποίο απομονώνουμε τα προϊόντα της ζύμωσης • Να ξεχωρίζεις διαγραμματικά τις φάσεις ανάπτυξης ενός μικροοργανισμού σε συνθήκες κλειστής καλλιέργειας • Να συγκρίνεις την κλειστή με την ανοικτή καλλιέργεια και να επεξηγείς σε ποιες περιπτώσεις ενδείκνυται η χρήση της κάθε μιας. • Να διακρίνεις από ένα διάγραμμα την πιθανή φάση ανάπτυξης ενός οργανισμού και να τεκμηριώνεις την άποψή σου 207
  • 120. Επισημάνσεις ΘεωρίαςΗ Βιοτεχνολογία είναι ο κλάδος εκείνος της επιστήμης της Βιολογίας , ο οποίος έχειως στόχο την εφαρμογή των γνώσεων που έχουν αποκτηθεί από την μελέτη τωνζωντανών οργανισμών για την παραγωγή σε ευρεία κλίμακα χρήσιμων προϊόντων.Γενετική Μηχανική είναι το σύνολο των τωχνεκών που χρησιμοποιούνται στηνβιοτεχνολογία.Πιο συνοπτικά μπορούμε να πούμε ότι η Βιοτεχνολογία με την ευρεία έννοια είναιη χρήση ζωντανών οργανισμών προς όφελος του ανθρώπου . ΒΙΟΤΕΧΝΟΛΟΓΙΑΓΕΩΡΓΙΑ ΚΤΗΝΟΤΡΟΦΙΑ ΙΑΤΡΙΚΗ ΒΙΟΜΗΧΑΝΙΑ ΠΡΟΣΤΑΣΙΑΠΕΡΙΒΑΛΛΟΝΤΟΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑ ΜΙΚΡΟΒΙΟΛΟΓΙΑ ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η Βιοτεχνολογία στηρίζεται τόσο στις μικροβιακές τεχνικές ανάπτυξης τωνμικροοργανισμών , όσο και στις τεχνικές μεταφοράς γενετικού υλικού από ένανοργανισμό σε ένα άλλο ( Γενετική Μηχανική) . ΟΙ ΜΙΚΡΟΒΙΑΚΕΣ ΚΑΛΛΙΕΡΓΕΙΕΣ ΑΠΟΤΕΛΟΥΝ ΠΟΛΥ ΣΗΜΑΝΤΙΚΟ ΕΡΓΑΛΕΙΟ ΓΙΑ ΤΗΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑ .
  • 121. Οι μικροοργανισμοί όταν βρεθούν σε κατάλληλες συνθήκες , αυξάνονται σεμέγεθος και διαιρούνται . Έτσι αυξάνεται και ο αριθμός τους . Όμως ο ρυθμός μετον οποίο διαιρούνται τα κύτταρα διαφέρει ανάλογα με το είδος των μικροβίων . Για παράδειγμα η Escherichia coli διαιρείται σε χρόνο 20 λεπτών , ενώ ηΑmoeba proteus διαιρείται σε χρόνο 24 ωρών . ΠΑΡΑΓΟΝΤΕΣ ΠΟΥ ΕΠΗΡΕΑΖΟΥΝ ΤΟΝ ΧΡΟΝΟ ΔΙΠΛΑΣΙΑΣΜΟΥ ΤΩΝ ΜΙΚΡΟΒΙΩΝ  ΘΕΡΜΟΚΡΑΣΙΑ  ΟΞΥΓΟΝΟ  pH  ΘΡΕΠΤΙΚΑ ΣΥΣΤΑΤΙΚΑ Α. ΘΕΡΜΟΚΡΑΣΙΑ ΨΥΧΡΟΦΙΛΑ ΜΕΣΟΦΙΛΑ ΘΕΡΜΟΦΙΛΑ ΥΠΕΡΘΕΡΜΟΦΙΛΑ Οι περισσότεροι μικροοργανισμοί αναπτύσσονται άριστα σε θερμοκρασίες από25-450 C . Για παράδειγμα η Escherichia coli αναπτύσσεται άριστα σεθερμοκρασία 37 C. 0 Όμως υπάρχουν και άλλοι μικροοργανισμοί οι οποίοιαναπτύσσονται σε θερμοκρασίες πολύ μεγαλύτερες από τους 450 C, ή σε πολύμικρότερες από τους 200 C. B. ΟΞΥΓΟΝΟ ΥΠΟΧΡΕΩΤΙΚΑ ΠΡΟΑΙΡΕΤΙΚΑ ΥΠΟΧΡΕΩΤΙΚΑΑΕΡΟΒΙΟΙ ΑΝΑΕΡΟΒΙΟΙ ΑΝΑΕΡΟΒΙΟΙ Η παρουσία ή η απουσία του οξυγόνου μπορεί να βοηθήσει ή να αναστείλειτην ανάπτυξη των μικροοργανισμών . Πιο συγκεκριμένα υπάρχουν μικροοργανισμοί οιοποίοι χρειάζονται το οξυγόνο σε υψηλές συγκεντρώσεις για να αναπτυχθούν . 207
  • 122. Αυτοί ονομάζονται υποχρεωτικά αερόβιοι μικροοργανισμοί , όπως τοMycobacterium. Όμως υπάρχουν μικροοργανισμοί οι οποίοι αναπτύσσονται παρουσίαοξυγόνου ταχύτερα από ότι απουσία οξυγόνου .Δηλαδή είναι μικροοργανισμοί οιοποίοι μπορούν να αναπτυχθούν και χωρίς οξυγόνο όμως προτιμούν να έχουνοξυγόνο για την ανάπτυξή τους . Αυτοί ονομάζονται προαιρετικά αερόβιοιμικροοργανισμοί . Επιπλέον υπάρχουν και μικροοργανισμοί για τους οποίους το οξυγόνο είναιτοξικό . Αυτοί ονομάζονται υποχρεωτικά αναερόβιοι . Γ. pH Tα μικρόβια αναπτύσσονται συνήθως σε pH μεταξύ 6-9 . Όμως υπάρχουν καιμικροοργανισμοί οι οποίοι αναπτύσσονται σε διαφορετικά pH . Για παράδειγμα οLactobacillus αναπτύσσεται σε pH 4-5 . Δ. ΘΡΕΠΤΙΚΑ ΣΥΣΤΑΤΙΚΑ Μέσα σε μια καλλιέργεια πρέπει να υπάρχουν πολλά θρεπτικά συστατικά . Αυτάείναι : Πηγή C, η οποία για τους αυτότροφους οργανισμούς είναι το CO2 ,ενώγια τους ετερότροφους οργανισμούς είναι οι υδατάνθρακες και κυρίως η Γλυκόζη. Επίσης χρειάζεται πηγή αζώτου , η οποία για τους περισσότερουςμικροοργανισμούς είναι τα νιτρικά και τα αμμωνιακά άλατα .Ακόμη είναιαπαραίτητο να υπάρχουν και πολλά μεταλλικά ιόντα για την πραγματοποίηση τωνδιάφορων χημικών αντιδράσεων. ΘΡΕΠΤΙΚΑ ΥΛΙΚΑΣΤΕΡΕΑ ΘΡΕΠΤΙΚΑ ΥΛΙΚΑ ΥΓΡΑ ΘΡΕΠΤΙΚΑ ΥΛΙΚΑ Τα υγρά θρεπτικά υλικά περιέχουν όλα τα συστατικά που αναφέρθηκαν παραπάνωδιαλυμένα μέσα σε νερό . που Αντίθετα τα στερεά θρεπτικά υλικά παρασκευάζονταιμε ανάμιξη των υγρών θρεπτικών υλικών με ένα πολυσακχαρίτη ονομάζεταιΆγαρ. Το Άγαρ είναι ρευστό σε θερμοκρασίες πάνω από τους 450 C, οπότεστερεοποιείται σε μικρότερες θερμοκρασίες .
  • 123. ΖΥΜΩΤΗΡΕΣ ΒΙΟΑΝΤΙΔΡΑΣΤΗΡΕΣ Προκειμένου να μπορέσουμε να αναπτύξουμε σε πολύ μεγάλες ποσότητες κάποιονμικροοργανισμό πρέπει να εισάγουμε μέσα σε μια συσκευή που ονομάζεταιβιοαντιδραστήρας , μια καλλιέργεια από αυτόν τον μικροοργανισμό, οπότε οιμικροοργανισμοί αναπτύσσονται γιατί χρησιμοποιούν τα θρεπτικά συστατικά πουέχουμε βάλει μέσα στον βιοαντιδραστήρα . Συνήθως χρησιμοποιείται φθηνή πηγήάνθρακα , που είναι η μελάσα . Να σημειωθεί ότι ο βιοαντιδραστήρας και τοθρεπτικό υλικό αποστειρώνονται πριν από την χρήση τους . Ζύμωση όταν λέμε εννοούμε την διαδικασία ανάπτυξης μικροοργανισμών σευγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες . Η ζύμωση περιλαμβάνειόλες τις διεργασίες , αερόβιες και αναερόβιες . ΚΑΛΛΙΕΡΓΕΙΕΣΚΛΕΙΣΤΗ ΚΑΛΛΙΕΡΓΕΙΑ ΣΥΝΕΧΗΣ ΚΑΛΛΙΕΡΓΕΙΑ ΔΙΑΦΟΡΕΣ ΜΕΤΑΞΥ ΚΛΕΙΣΤΗΣ ΚΑΙ ΣΥΝΕΧΟΥΣ ΚΑΛΛΙΕΡΓΕΙΑΣ ΚΛΕΙΣΤΗ ΚΑΛΛΙΕΡΓΕΙΑ ΑΝΟΙΧΤΗ ΚΑΛΛΙΕΡΓΕΙΑ Η ποσότητα του θρεπτικού υλικού Υπάρχει συνεχής τροφοδότηση είναι περιορισμένη θρεπτικού υλικού Δεν απομακρύνονται τα τοξικά Απομακρύνονται τα τοξικά απόβλητα απόβλητα των οργανισμών των οργανισμών Διακρίνονται 4 φάσεις Οι μικροοργανισμοί βρίσκονται σε εκθετική φάση 207
  • 124. ΚΛΕΙΣΤΗ ΚΑΛΛΙΕΡΓΕΙΑ ΛΑΝΘΑΝΟΥΣΑ ΕΚΘΕΤΙΚΗ ΣΤΑΤΙΚΗ ΦΑΣΗ ΘΑΝΑΤΟΥ ΦΑΣΗ ΦΑΣΗ ΦΑΣΗΛΑΝΘΑΝΟΥΣΑ ΦΑΣΗ : Είναι το χρονικό διάστημα στο οποίο οι μικροοργα νισμοίπροσαρμόζονται στο νέο περιβάλλον στο οποίο τοποθετήθηκαν .Έρχονται σε επαφήμε το καινούργιο θρεπτικό υλικό και παράγουν τα κατάλληλα ένζυμα για να τοδιασπάσουν .ΕΚΘΕΤΙΚΗ ΦΑΣΗ : Οι μικροοργανισμοί αναπτύσσονται με πολύ γρήγορο ρυθμόΣΤΑΤΙΚΗ ΦΑΣΗ : Στο σημείο αυτό δεν αυξάνεται ο πληθυσμός τωνμικροοργανισμών. Αυτό συμβαίνει γιατί μπορεί να έχει τελειώσει κάποιο από ταθρεπτικά συστατικά , ή να έχουν παραχθεί πολλά τοξικά απόβλητα ωςπαραπροϊόντα του μεταβολισμού , οπότε αυτά εμποδίζουν την αύξηση τωνμικροοργανισμών .ΦΑΣΗ ΘΑΝΑΤΟΥ : Εδώ πλέον ο αριθμός των μικροβίων αρχίζει να μειώνεταιλόγω ύπαρξης των δυσμενών συνθηκών που προαναφέρθηκαν . ΟΙ ΜΙΚΡΟΒΙΑΚΕΣ ΚΑΛΛΙΕΡΓΕΙΕΣ ΑΠΟΤΕΛΟΥΝ ΠΟΛΥ ΣΗΜΑΝΤΙΚΟ ΕΡΓΑΛΕΙΟ ΓΙΑ ΤΗΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑ Οι μικροοργανισμοί όταν βρεθούν σε κατάλληλες συνθήκες, αυξάνονται σεμέγεθος και διαιρούνται . Έτσι αυξάνεται και ο αριθμός τους .Όμως ο ρυθμός με τονοποίο διαιρούνται τα κύτταρα δηλαδή ο ΧΡΟΝΟΣ ΔΙΠΛΑΣΙΑΣΜΟΥ διαφέρειανάλογα με το είδος των μικροοργανισμών.
  • 125. Ερωτήσεις Θεωρίας1. Τι είναι η Βιοτεχνολογία και σε ποιες τεχνικές στηρίζεται;2. Γιατί η Βιοτεχνολογία χρησιμοποιεί τεχνικές ανασυνδυασμένου DNA;3. Πώς καθορίζεται ο ρυθμός ανάπτυξης ενός πληθυσμούμικροοργανισμών;4. Τι είναι ο χρόνος διπλασιασμού των μικροοργανισμών;5. Ποιοι παράγοντες επηρεάζουν το χρόνο διπλασιασμού ενόςμικροοργανισμού;6. Αναπτύσσουν όλα τα είδη μικροοργανισμών, πληθυσμούς με τον ίδιοαριθμό ατόμων, όταν ο καθένας από αυτούς καλλιεργηθεί στις ιδανικές γιαυτόν συνθήκες για 12 ώρες;7. Ποια είναι τα απαραίτητα υλικά που χρειάζεται να προσλαμβάνει έναςμικροοργανισμός από το περιβάλλον του;8. Ποια είναι η πηγή C για τους ετερότροφους και ποια για τουςαυτότροφους οργανισμούς;9. Να αναφέρετε παράδειγμα μικροοργανισμού που αναπτύσσεται σε όξινοpH.10. Ποιοι οργανισμοί ονομάζονται υποχρεωτικά αερόβιοι, ποιοιπροαιρετικά αερόβιοι και ποιοι αναερόβιοι. Να δώσετε ένα παράδειγμαοργανισμού από κάθε κατηγορία.11. Τι γνωρίζετε σχετικά με την άριστη θερμοκρασία ανάπτυξης διάφορωνμικροοργανισμών;12. Ποια μορφή μπορεί να έχουν τα θρεπτικά υλικά που χρησιμοποιούνταιγια την καλλιέργεια μικροοργανισμών στο εργαστήριο, τι περιέχουν και πώςπαρασκευάζονται;13. Τι ονομάζουμε «εμβολιασμό» των θρεπτικών υλικών;14. Τι είναι το άγαρ, πού χρησιμοποιείται κατά τη διαδικασίακαλλιέργειας μικροοργανισμών και γιατί;15. Ποια διαδικασία ακολουθούμε προκειμένου να δημιουργήσουμε μίαστερεή καλλιέργεια ενός μικροοργανισμού που περιέχεται σε ένα δείγμα;16. Τι είναι οι βιοαντιδραστήρες και πότε χρησιμοποιούνται;17. Ποιες φάσεις ακολουθούν κατά την ανάπτυξή τους οι μικροοργανισμοίπου καλλιεργούνται σε μία κλειστή καλλιέργεια;18. Ποια είναι τα προϊόντα της ζύμωσης;19. Να συγκρίνετε την κλειστή και την ανοικτή καλλιέργειαμικροοργανισμών.20. Ποια είναι τα χαρακτηριστικά της κλειστής καλλιέργειαςμικροοργανισμών; 207
  • 126. 21. Σε ποια κατεργασία υποβάλλεται το προϊόν που παραλαμβάνεται απότον βιοαντιδραστήρα προκειμένου να παραληφθεί το προϊόν της ζύμωσης πουμας ενδιαφέρει;22. Τι ονομάζουμε ζύμωση;23. Να αναφέρετε τις τεχνικές που αποτελούν το θεμέλιο τηςΒιοτεχνολογίας24. Κατά την αλκοολική ζύμωση οι σακχαρομύκητες μετατρέπουν τηνγλυκόζη του μούστου σε αιθυλική αλκοόλη. Γιατί κατά τη γνώμη σας,σταματάει η ζύμωση, ακόμα και όταν υπάρχει και άλλη διαθέσιμη γλυκόζη,όταν η περιεκτικότητα σε αιθανόλη γίνει περίπου 10%;25. Να αναφέρετε διαφορές μεταξύ των κλειστών και ανοικτώνκαλλιεργειών;26. Γιατί αποστειρώνονται οι συσκευές καλλιέργειας πριν από την έναρξητης διαδικασίας;27. Ποια βήματα ακολουθούμε για την καλλιέργεια ενός μικροοργανισμούστο εργαστήριο;
  • 127. Ερωτήσεις Πολλαπλής Επιλογής1. Η Βιοτεχνολογία χρησιμοποιεί διαδικασίες με τις οποίες εισάγονται νέες ιδιότητεςστους οργανισμούς. Για τις διαδικασίες αυτές χρησιμοποιούνταια. ένζυμα ελικάσεςβ. πλασμίδιαγ. ιοειδήδ. ολόκληρο το γονιδίωμα των βακτηρίων.2. Ως βιοτεχνολογική διαδικασία θεωρείται ηα. εισαγωγή νέων γονιδίων στα φυτάβ. διαδικασία σύνθεσης χημικών εντομοκτόνωνγ. διαδικασία παραγωγής πετρελαίουδ. διαδικασία παρασκευής πλαστικών.3. Με τη Βιοτεχνολογία μπορεί να παραχθούν προϊόντα όπωςα. μπίρα, κρασί, τυρί, μαγιάβ. χημικά εντομοκτόναγ. ασπιρίνηδ. καύσιμα ενεργειακά υλικά.4. Οι μικροοργανισμοί είναια. πάντα βλαβεροί για τον άνθρωποβ. πάντα ωφέλιμοι για τον άνθρωπογ. ορισμένοι είναι βλαβεροί και ορισμένοι είναι ωφέλιμοιδ. πάντοτε παθογόνοι.5. Τα γενετικά τροποποιημένα βακτήριαα. υπάρχουν φυσιολογικά ελεύθερα στη φύσηβ.είναι αυτά στα οποία ο άνθρωπος έχει εισαγάγει νέες γενετικές πληροφορίεςγ. παράγουν τις ίδιες πρωτεΐνες με τον άνθρωποδ. δεν απαιτούν αποστείρωση για την καλλιέργειά τους.6. Η ανθρώπινη ινσουλίνη που χρησιμοποιούν σήμερα οι διαβητικοί προέρχεται απόα. ανθρώπινα κύτταραβ. κύτταρα θηλαστικώνγ. την εργαστηριακή σύνθεση των αμινοξέων που την αποτελούνδ. γενετικά τροποποιημένα βακτήρια.7. Η ανάπτυξη των μικροοργανισμών, που χρησιμοποιεί η Βιοτεχνολογία, απαιτεία. διαθεσιμότητα θρεπτικών υλών που περιέχουν άνθρακαβ. παρουσία υποχρεωτικά οξυγόνουγ. θερμοκρασίες υποχρεωτικά πολύ ψηλέςδ. ρH πάντα μεταξύ 6-8. 207
  • 128. 8. Στα θρεπτικά συστατικά όλων των μικροοργανισμών περιλαμβάνονται απα-ραιτήτως οι:α. υδατάνθρακεςβ. βιταμίνεςγ. ορμόνεςδ. πρωτεΐνες.9. Μεταξύ των προϊόντων της Βιοτεχνολογίας περιλαμβάνονταια. οι βενζίνεςβ. τα χημικά εντομοκτόναγ. το κρασίδ. το φυσικό καουτσούκ10. Τα ετερότροφα βακτήρια της Βιοτεχνολογίας προμηθεύονται τον άνθρακα απόα. τις πρωτεΐνεςβ. τους υδατάνθρακεςγ. το διοξείδιο του άνθρακα της ατμόσφαιραςδ. το διοξείδιο του άνθρακα των αμινοξέων.11. Με τις τεχνικές της Βιοτεχνολογίας εισάγονται νέες ιδιότητες στους οργανι-σμούς. Για τον σκοπό αυτό, χρησιμοποιείταια. ολόκληρο το γονιδίωμα του δότηβ. το γονίδιο που επιθυμούμε να κλωνοποιήσουμεγ. το επιθυμητό γονίδιο συνδεδεμένο με ένα ριβόσωμαδ. το γονιδίωμα του δότη και συγκεκριμένο γονίδιο.12. Τροποποποιημένος γενετικά οργανισμός σημαίνει ότι έχεια. διασταυρωθεί με ένα άλλο οργανισμό με βελτιωμένες ιδιότητεςβ. εισαχθεί στο DNA του όλο το DNA από ένα άλλο οργανισμό, που ανήκειαποκλειστικά στο ίδιο είδος με αυτόνγ. εισαχθεί στο DNA του κάποιο γονίδιο, που του προσφέρει νέες ιδιότητεςδ. εισαχθεί στο DNA του κάποιο γονίδιο συνδεδεμένο πάνω σε ένα ειδικό φορέα.
  • 129. ΑΣΚΗΣΕΙΣ Ένας μικροοργανισμός έχει ικανότητα μεταβολισμού της λακτόζης όταν ενεργοποιηθεί το αντίστοιχο οπερόνιο. 1. Τι ορίζεται ως οπερόνιο; 2. Ποια η θέση και ποιος ο ρόλος του υποκινητή και ποιος του χειριστή σε ένα οπερόνιο; 3. Ποια από τις παρακάτω δύο καμπύλες (1 ή 2) πιστεύετε ότι δείχνει πιο αντιπροσωπευτικά την αύξηση του μικροοργανισμού σε κλειστή καλλιέργεια, όταν στο θρεπτικό του υλικό περιέχεται και γλυκόζη και λακτόζη.ΑριθμόςΜικροοργανισμών Χρόνος (ημέρες) 4. Σε ποιες φάσεις ανάπτυξης του μικροοργανισμού πιστεύετε ότι μπορούν να παραχθούν χρήσιμα προϊόντα για τον άνθρωπο; 207
  • 131. Διδακτικοί Στόχοι • Να διαχωρίζεις τις έννοιες της βιοτεχνολογίας από την γενετική μηχανική • Να περιγράφεις την παραγωγή ινσουλίνης με μεθόδους γενετικής μηχανικής • Να ορίζεις τις φαρμακευτικές πρωτεΐνες και να περιγράφεις τις χρήσεις τους • Να περιγράφεις τον τρόπο παραγωγής των μονοκλωνικών αντισωμάτων και την χρήση τους • Να συγκρίνεις την ex vivo με την in vivo γονιδιακή θεωρία • Να περιγράφεις τα χαρακτηριστικά του ιδανικού φορέα κλωνοποίησης • Να υποθέσεις πιθανές αρνητικές επιπτώσεις της γονιδιακής θεραπείας • Να αναφέρεις τις ασθένειες στις οποίες πιθανά να είναι αποδοτική η γονιδιακή θεραπεία • Να απαριθμείς τους στόχους του προγράμματος ανθρώπινου γονιδιώματος 207
  • 132. Επισημάνσεις Θεωρίας ΒΙΟΤΕΧΝΟΛΟΓΙΑΔΙΑΓΝΩΣΗ ΠΡΟΛΗΨΗ ΘΕΡΑΠΕΙΑ ΦΑΡΜΑΚΕΥΤΙΚΕΣ ΠΡΩΤΕΪΝΕΣ Χρησιμοποιούνται για την θεραπεία πολλών ασθενειών . Ενώ στο παρελθόν ηπαραγωγή τους ήταν πολύ ακριβή , σήμερα με την βοήθεια της τεχνολογίας τουανασυνδυασμένου DNA είναι δυνατή η παραγωγή τους σε μεγάλες ποσότητεςΧαρακτηριστικό παράδειγμα αποτελεί η Ινσουλίνη . ΙΝΣΟΥΛΙΝΗ Αποτελείται από 51 αμινοξέα . Παράγεται στο πάγκρεας . Η ιδιότητα της είναι ναρυθμίζει την ποσότητα της γλυκόζης στο αίμα . Ο Διαβήτης είναι η ασθένεια πουπροκαλείται από την έλλειψη της ινσουλίνης και από την ασθένεια αυτή πάσχουνπερίπου 60000000 άτομα στον πλανήτη . Η Ινσουλίνη αποτελείται από δύο μικρά πεπτίδια Α και Β που συνδέονται μεταξύτους με δισουλφιδικούς δεσμούς . Αρχικά παράγεται ένα πρόδρομο μόριο πουονομάζεται Προϊνσουλίνη , το οποίο τελικά μετατρέπεται στο μόριο της Ινσουλίνης . Η μέθοδος παρασκευής της Ινσουλίνης αποτελείται από τα εξής βήματα :1) Απομόνωση του m –RNA από ανθρώπινα κύτταρα παγκρέατος .2) Κατασκευή δίκλωνων μορίων DNA και ενσωμάτωση τους μέσα σε πλασμίδια .3) Μετασχηματισμός βακτηρίων με τα ανασυνδυασμένα αυτά πλασμίδια και πολλαπλασιασμός τους σε υγρό θρεπτικό υλικό .
  • 133. 4) Επιλογή των βακτηρίων που περιέχουν το γονίδιο , το οποίο κωδικοποιεί το πρόδρομο μόριο της Ινσουλίνης .5) Αύξηση των βακτηρίων αυτών σε βιοαντιδραστήρα και έπειτα από την παραγωγή της προϊνσουλίνης , ακολουθεί ο καθαρισμός της και με χρήση κατάλληλου ενζύμου , η αφαίρεση του ενδιαμέσου πεπτιδίου , οπότε τελικά προκύπτει η ινσουλίνη. ΜΟΝΟΚΛΩΝΙΚΑ ΑΝΤΙΣΩΜΑΤΑ Μονοκλωνικά ονομάζονται τα αντισώματα εκείνα , τα οποία παράγονται από ένακλώνο Β-λεμφοκυττάρων .Παράγονται στο εργαστήριο από κύτταρα που έχουνπροέλθει από σύντηξη Β-λεμφοκυττάρων και καρκινικών κυττάρων . Τα κύτταρααυτά ονομάζονται Υβριδώματα και μπορούν να παράγουν με πρωτεϊνοσύνθεση τααντισώματα ενώ πολλαπλασιάζονται συνεχώς . Οι εφαρμογές των μονοκλωνικών αντισωμάτων στηρίζονται στην απόλυτηεξειδίκευση τους και είναι οι εξής :α) ΑΝΟΣΟΔΙΑΓΝΩΣΤΙΚΑ : Αυτά αφορούν την διάγνωση ουσιών σε διάφορα υγράτου σώματος και εμείς θέλουμε να μετρήσουμε την ποσότητα τους . Η μέθοδοςστηρίζεται στην ένωση του αντισώματος με την προς μέτρηση ουσία .β) ΘΕΡΑΠΕΥΤΙΚΑ : Αφορούν την θεραπεία του καρκίνου και γίνεται ως εξής :Κατασκευάζονται μονοκλωνικά αντισώματα για αντιγονικούς καθοριστές οι οποίοιβρίσκονται στα καρκινικά κύτταρα . Τα αντισώματα συνδέονται με αντικαρκινικάφάρμακα και στην συνέχεια εισάγονται στον οργανισμό , όπου αφού ενωθούν με τακαρκινικά κύτταρα, εισάγουν στο εσωτερικό τους τα φάρμακα .γ) ΕΠΙΛΟΓΗ ΟΡΓΑΝΩΝ ΓΙΑ ΜΕΤΑΜΟΣΧΕΥΣΗ :Τα μονοκλωνικά αντισώματααναγνωρίζουν τα ειδικά αντιγόνα που υπάρχουν στην επιφάνεια των κυττάρων πουπροορίζονται για μεταμόσχευση στο όργανο του δότη, οπότε ελέγχεται η συγγένειαμεταξύ του δότη και του δέκτη .δ) ΑΝΙΧΝΕΥΤΕΣ: Μπορούμε να σημάνουμε τα μονοκλωνικά αντισώματα μεραδιενεργές ουσίες, οπότε θα εντοπίζονται εύκολα μέσα στο σώμα του ανθρώπουδιάφοροι όγκοι ή θρόμβοι . 207
  • 134. ε) ΕΛΕΓΧΟΣ ΚΑΘΑΡΟΤΗΤΑΣ ΦΑΡΜΑΚΩΝ : Τα μονοκλωνικά αντισώματαχρησιμοποιούνται για να αναγνωρίσουν και να απομονώσουν πολύτιμες ουσίες , οιοποίες βρίσκονται σε πολύ μικρές ποσότητες σε μείγμα ουσιών . ΓΟΝΙΔΙΑΚΗ ΘΕΡΑΠΕΙΑ Ex vivo In vivo Γονιδιακή θεραπεία ονομάζεται η θεραπεία σε επίπεδο γονιδίων και έχειστόχο να διορθώσει την γενετική βλάβη , που τις περισσότερες φορές είναιγονιδιακή μετάλλαξη , εισάγοντας το φυσιολογικό γονίδιο Ex vivo ονομάζεται η γονιδιακή θεραπεία , όταν τα κύτταρα τροποποιούνταιέξω από τον οργανισμό και στην συνέχεια εισάγονται πάλι σε αυτόν . In vivo ονομάζεται η γονιδιακή θεραπεία, όταν τα φυσιολογικά γονίδιαενσωματώνονται σε μόρια φορείς όπως οι ιοί και στην συνέχεια εισάγονται στονοργανισμό διαμέσου αυτών.ex vivo ΓΟΝΙΔΙΑΚΗ ΘΕΡΑΠΕΙΑ in vivo ΓΟΝΙΔΙΑΚΗ ΘΕΡΑΠΕΙΑΚύτταρα μυελού πολλαπλασιάζονται Απομονώνεται το φυσιολογικόσε καλλιέργειες αλληλόμορφο από τον δότητο γονίδιο ενσωματώνεται σε φορέα(ιο) το γονίδιο ενσωματώνεται σε φορέα (ιο)που είναι αβλαβής που είναι αβλαβήςτο κύτταρο δέκτης διαμολύνεται ο φορέας εισάγεται στον οργανισμότα γενετικά τροποποιημένα κύτταραεισάγονται στον ασθενή εάν το γενετικό υλικό ενσωματωθεί στην κατάλληλη θέση θα εκφραστεί η ομόλογη πρωτείνη
  • 135. ΑΝΑΛΥΣΗ ΑΝΘΡΩΠΙΝΟΥ ΓΟΝΙΔΙΩΜΑΤΟΣ Η ανάλυση του ανθρώπινου γονιδιώματος θα συμβάλλει : α) στην ανακάλυψη του ακριβούς αριθμού των ανθρωπίνων γονιδίων , καθώς επίσης και της λειτουργίας του υπόλοιπου γενετικού υλικού . β) στην διάγνωση και θεραπεία διάφορων κληρονομικών ανωμαλιών . γ) στην παραγωγή και άλλων νέων πρωτεϊνών με την μέθοδο του ανασυνδυασμένου DNA , δ) στην μελέτη της εξέλιξης του ανθρώπινου γονιδιώματος . Ερωτήσεις1. Ποια στάδια ακολουθεί η παραγωγή προϊόντων με τη χρήση μικροοργανισμών;2. Τι είναι τα μονοκλωνικά αντισώματα;3. Τι ονομάζουμε υβριδώματα και ποιο πρόβλημα έλυσε η δημιουργία τους;4. Ποια διαδικασία ακολουθεί η τεχνική παραγωγής μονοκλωνικών αντισωμάτων;5. Πώς χρησιμοποιούνται τα μονοκλωνικά αντισώματα ως διαγνωστικά μέσα.6. Πώς χρησιμοποιούνται τα μονοκλωνικά αντισώματα ως θεραπευτικά μέσα;7. Να περιγράψετε τη διαδικασία παραγωγής υβριδωμάτων για την παραγωγή μονοκλωνικών αντισωμάτων.8. Τι ονομάζουμε γονιδιακή θεραπεία;9. Με ποιο τρόπο συντελεί η Βιοτεχνολογία στην πρόληψη ασθενειών;10. Με ποιο τρόπο συντελεί η Βιοτεχνολογία στην έγκαιρη διάγνωση;11. Με ποιο τρόπο συντελεί η Βιοτεχνολογία στην θεραπεία ασθενειών;12. Τι ονομάζουμε φαρμακευτικές πρωτεΐνες;13. Να αναφέρετε φαρμακευτικές πρωτεΐνες που παράγονται με μεθόδους της Βιοτεχνολογίας; 207
  • 136. 14. Τι είναι η ινσουλίνη, ποιος είναι ο ρόλος της και τι προκαλεί η έλλειψη ή η μείωσή της;15. Ποια είναι η προέλευση της ινσουλίνης που χρησιμοποιούνταν από τους διαβητικούς πριν το 1982 και ποια μειονεκτήματα εμφάνιζε;16. Να περιγράψετε τη μέθοδο παραγωγής ανθρώπινης ινσουλίνης από βακτήρια μέσο του πρόδρομου μορίου της;17. Τι είναι οι ιντερφερόνες και πώς δρουν στον οργανισμό μας;18. Τι ονομάζουμε αντιγονικό καθοριστή;19. Να περιγράψετε τη διαδικασία που ακολουθούμε στην ex vivo γονιδιακή θεραπεία.20. Τι ονομάζεται in vivo γονιδιακή θεραπεία και πότε εφαρμόζεται;21. Τι είναι η κυστική ίνωση και τι περιλαμβάνει η γονιδιακή θεραπεία της;22. Με ποιο τρόπο μπορεί να εισαχθεί το επιθυμητό γονίδιο στον επιθυμητό τύπο κυττάρου κατά την in vivo γονιδιακή θεραπεία;23. Γιατί η γονιδιακή θεραπεία έχει σήμερα περιορισμένη εφαρμογή;24. Τι γνωρίζετε για το πρόγραμμα του ανθρώπινου γονιδιώματος;25. Ποιες εφαρμογές πιστεύεται ότι θα έχουν τα αποτελέσματα του προγράμματος του ανθρώπινου γονιδιώματος;26. Γιατί για την παραγωγή μονοκλωνικών αντισωμάτων χρησιμοποιούνται υβριδώματα και όχι τα ίδια τα Β-λεμφοκύτταρα;27. Σε τι διαφέρουν η ex vivo και in vivo γονιδιακές θεραπείες;28. Να περιγράψετε τη διαδικασία που εφαρμόστηκε για τη γονιδιακή θεραπεία της έλλειψης του ενζύμου ADA.29. Πώς συντέλεσε η βιοτεχνολογία στην πρόληψη της ηπατίτιδας Β;30. Γιατί τα μονοκλωνικά αντισώματα είναι τόσο σημαντικά στην ιατρική;31. Τα μονοκλωνικά αντισώματα ως ανοσοδιαγνωστικά μέσα;32. Πώς αντιμετωπίζεται ο καρκίνος με τη χρήση μονοκλωνικών αντισωμάτων;
  • 137. 33. Πώς χρησιμοποιούνται τα μονοκλωνικά αντισώματα στην επιλογή οργάνων συμβατών για μεταμόσχευση;34. Γιατί με τις μεθόδους γονιδιακής θεραπείας που εφαρμόζονται τα αποτελέσματα δεν είναι πάντα μόνιμα και ποτέ το γονίδιο που ενσωματώνεται δεν μεταβιβάζεται στους απογόνους;35. Ποια στάδια ακολουθεί η παραγωγή προϊόντων με τη χρήση μικροοργανισμών; 207
  • 138. Ερωτήσεις Πολλαπλής Επιλογής1. Οι τεχνικές, που αφορούν τον ανασυνδυασμό του DNA, συμβάλλουνα. στην παραγωγή πρωτεϊνών σε μεγάλες ποσότητεςβ. στην παραγωγή πρωτεϊνών με μικρό κόστοςγ. στην πλήρη κατανόηση της βιολογικής δράσης των πρωτεϊνώνδ. σε όλα όσα περιγράφονται στα α, β, γ.2. Η ινσουλίνη παράγεται σε μεγάλες ποσότητες και με μικρό κόστος απόα. εκχύλιση ιστών του παγκρέατος των βοοειδώνβ. βακτήρια με την τεχνολογία του ανασυνδυασμένου DNAγ. μύκητες με σύγχρονες χημικές μεθόδους διαχωρισμούδ. τον ερυθρό μυελό των οστών με εκχύλιση.3. Τα αντισώματα είναια. πρωτεΐνεςβ. νουκλεϊκά οξέαγ. υδατάνθρακεςδ. λιπίδια.4. Τα μονοκλωνικά αντισώματα παράγονται απόα. ένα κλώνο Τ λεμφοκυττάρωνβ. μια ομάδα όμοιων Β λεμφοκυττάρωνγ. κυτταροτοξικά Τ λεμφοκύτταραδ. μακροφάγα κύτταρα.5. Τα μονοκλωνικά αντισώματα χρησιμοποιούνται στην Ιατρικήα. ως διαγνωστικά για την ανίχνευση ασθενειώνβ. ως εξειδικευμένα φάρμακαγ. εναντίον καρκινικών κυττάρωνδ. σε όλες τις περιπτώσεις που περιγράφονται στα α, β, γ.6. Πώς ονομάζεται η διαδικασία εισαγωγής γενετικά τροποποιημένου ιού σταλεμφοκύτταρα;α. Γονιδιακή θεραπείαβ. Μεταμόσχευσηγ. Επιμόλυνσηδ. Εμβολιασμός.7. Με τη “γονιδιακή θεραπεία”α. παράγονται μονοκλωνικά αντισώματαβ. γίνεται προσπάθεια αποκατάστασης της γενετικής βλάβηςγ. γίνεται παραγωγή αντιβιοτικών
  • 139. δ. γίνεται ανίχνευση ουσιών οι οποίες δρουν ως αντιγόνα.8. Τα “εμβόλια υπομονάδες” αποτελούνται απόα. εξασθενημένες μορφές παθογόνων μικροοργανισμώνβ. το DNA παθογόνων οργανισμώνγ. αντισώματα που παράγουν τα Β λεμφοκύτταραδ. πρωτεΐνες της επιφάνειας παθογόνων οργανισμών με αντιγονικές ιδιότητες.9. Τα υβριδώματα είναια. υβρίδια καλαμποκιούβ. σύμπλεγμα αντισωμάτων με καρκινικά κύτταραγ. καρκινικά κύτταραδ. κύτταρα που προκύπτουν από σύντηξη Β λεμφοκυττάρων με καρκινικά κύτταρα. 207
  • 141. Διδακτικοί στόχοι • Να διακρίνεις τους όρους διαγονιδιακός, μετασχηματισμένος, μεταλλαγμένος ανασυνδυασμένος μικροέγχυση • Να διακρίνεις τα ονόματα των οργανισμών που σχετίζονται με διαγονιδιακά ζώα και φυτά σε ερωτήσεις πολλαπλής επιλογής • Να περιγράφεις τον τρόπο παρασκευής ενός διαγονιδιακού φυτού • Να συγκρίνεις το πλασμίδιο Τi με το πρότυπο πλασμιδίου που είδαμε στο 1ο κεφάλαιο • Να περιγράφεις τον τρόπο παρασκευής ενός διαγονιδιακού ζώου • Να περιγράφεις τα στάδια κλωνοποίησης ενός οργανισμού, ενός μικροοργανισμού και ενός μορίου DNA. 207
  • 142. Επισημάνσεις ΘεωρίαςΤΡΟΠΟΙ ΒΕΛΤΙΩΣΗΣ ΤΗΣ ΦΥΤΙΚΗΣ ΚΑΙ ΤΗΣ ΖΩΪΚΗΣ ΠΑΡΑΓΩΓΗΣΕΠΙΛΕΚΤΙΚΗ ΔΙΑΣΤΑΥΡΩΣΗ ΔΗΜΙΟΥΡΓΙΑ ΟΡΓΑΝΙΣΜΩΝ ΔΙΑΓΟΝΙΔΙΑΚΩΝ Τα πλεονεκτήματα της επιλεκτικής διασταύρωσης είναι ότι δενδημιουργούνται προβλήματα ηθικής . Όμως τα μειονεκτήματα που έχει είναι ότιη διαδικασία είναι χρονοβόρα και επιπλέον τα άτομα που προκύπτουν από τιςδιασταυρώσεις αυτές είναι πιθανό να είναι φορείς και άλλων μη επιθυμητώνχαρακτηριστικών . Τα μειονεκτήματα της δημιουργίας διαγονιδιακών ή γενετικά τροποποιημένωνοργανισμών είναι ότι προστίθενται νέα γονίδια στον οργανισμό , και επίσηςανακύπτουν προβλήματα που έχουν να κάνουν με την υγεία του ανθρώπου , οοποίος καταναλώνει τα νέα προϊόντα που παράγονται από τις μεθόδους τηςΓενετικής Μηχανικής . Επίσης μπορούν να προκύψουν προβλήματα που έχουννα κάνουν με θέματα ηθικής .Διαγονιδιακά ή γενετικά τροποποιημένα ζώα και φυτά είναι εκείνα που έχουνυποστεί τροποποίηση ( αλλαγή) του γενετικού τους υλικού . Τα βακτήρια αποτελούν πολύ καλό υλικό για την γενετική τροποποίηση των φυτών,γιατί πολλά βακτήρια περιέχουν πλασμίδιο , το οποίο αποτελεί πολύ καλόπειραματικό υλικό για την Βιοτεχνολογία , αφού τα πλασμίδια αποτελούν τους φορείςμε τους οποίους μεταφέρονται τα επιθυμητά γονίδια στους οργανισμούς .
  • 143. ΔΙΑΔΙΚΑΣΙΑ ΔΗΜΙΟΥΡΓΙΑΣ ΔΙΑΓΟΝΙΔΙΑΚΩΝ ΦΥΤΩΝ Eχουμε τα εξής βήματα :1) Απομόνωση με κατάλληλες τεχνικές του πλασμιδίου από το βακτήριο.2) Εισαγωγή στο πλασμίδιο του γονιδίου εκείνου που φέρει την γενετική πληροφορία για την ιδιότητα που μας ενδιαφέρει . Πλέον το πλασμίδιο είναι ανασυνδυασμένο.3) Εισαγωγή του πλασμιδίου στο βακτήριο .4) Μετά από την αύξηση του αριθμού των γενετικά τροποποιημένων βακτηρίων ακολουθεί μόλυνση των κυττάρων ενός φυτού από τα μετασχηματισμένα βακτήρια.5) Πλέον τα φυτικά κύτταρα περιέχουν ένα ξένο γονίδιο οπότε είναι γενετικά τροποποιημένα ή αλλιώς Διαγονιδιακά φυτά , τα οποία μάλιστα έχουν την δυνατότητα να μεταβιβάζουν στους απογόνους τους τις νέες ιδιότητες τις οποίες απέκτησαν . ΓΙΑΤΙ ΔΗΜΙΟΥΡΓΟΥΜΕ ΣΗΜΕΡΑ ΔΙΑΓΟΝΙΔΙΑΚΑ ΦΥΤΑ Σήμερα δημιουργούμε διαγονιδιακά φυτά γιατί : 1)Θέλουμε τα φυτά να έχουν αυξημένη διάρκεια ζωής από την παραγωγή ως τον καταναλωτή . 2) Επίσης θέλουμε τα φυτά να είναι ανθεκτικά σε διάφορες ασθένειες . 3) Να είναι ανθεκτικά απέναντι σε ιούς , βακτήρια , μύκητες , έντομα και παράσιτα . Τα τελευταία είναι πολύ σημαντικά γιατί αν επιτευχθεί αυτό τότε δεν θα χρειάζεται παρατεταμένη χρήση εντομοκτόνων . 4) Μας ενδιαφέρει τα φυτά που παράγονται από τις μεθόδους της Γενετικής Μηχανικής να έχουν αυξημένη παραγωγικότητα . ΔΙΑΓΟΝΙΔΙΑΚΑ ΖΩΑ 207
  • 144. Τα διαγονιδιακά ζώα είναι τα ζώα εκείνα που έχουν υποστεί τροποποίηση του γενετικού τους υλικού . Τα βήματα που ακολουθούμε είναι τα εξής :1) Εισαγωγή του ξένου DNA με ειδική μικροβελόνα σε γονιμοποιημένο ωάριο του ζώου που θέλουμε να το μετατρέψουμε σε διαγονιδιακό . Η Εισαγωγή σε ένα ζώο τμήματος γενετικού υλικού από ένα ζώο άλλου είδους ονομάζεται Μικροέγχυση .2) Εισαγωγή του ξένου γενετικού υλικού σε κάποιο χρωμόσωμα του ζυγωτού .3) Εμφύτευση του ζυγωτού στην μήτρα ενός ζώου ( θετή μητέρα )4) Γέννηση του διαγονιδιακού ζώου .5) Επιλεκτικές διασταυρώσεις με σκοπό την παραγωγή απογόνων που να έχουν τις νέες ιδιότητες .6) Παραγωγή , απομόνωση και καθαρισμός της φαρμακευτικής πρωτεϊνης . ΚΛΩΝΟΠΟΙΗΣΗ Η κλωνοποίηση μπορεί να βοηθήσει στους εξής τομείς:1) Μπορούμε να δημιουργήσουμε κλώνους διαγονιδιακών ζώων που χρησιμοποιούνται στην παραγωγή φαρμακευτικών πρωτεϊνών , οπότε είναι δυνατό να μειώσουμε το κόστος παραγωγής , ενώ ταυτόχρονα θα πετυχαίνουμε μεγαλύτερη παραγωγή πρωτεϊνών .2) Μπορούμε να δημιουργήσουμε κλωνοποιημένα φυτά με απώτερο στόχο την αύξηση της παραγωγικότητας και την ανθεκτικότητα σε ασθένειες , σε έντομα , παράσιτα , βακτήρια μύκητες και ιούς .3) Γνωρίζουμε ότι τα κλωνοποιημένα ζώα μπορούν να χρησιμοποιηθούν στην έρευνα για την γήρανση των κυττάρων4) Με την βοήθεια της κλωνοποίησης είναι δυνατό να αντιμετωπιστούν και
  • 145. πολλά οικολογικά προβλήματα, δεδομένου ότι τα προϊόντα που προκύπτουν από διαγονιδιακά ζώα και φυτά , θα έχουν και οικολογικές ιδιότητες . Ερωτήσεις1. Ποιοι είναι οι 2 βασικοί τρόποι βελτίωσης της φυτικής και ζωικής παραγωγής; Ποιες κοινωνικές ανάγκες εξυπηρετούν; Ποια τα πλεονεκτήματα και ποια τα μειονεκτήματα της καθεμιάς;2. Ποιοι οργανισμοί λέγονται διαγονιδιακοί; Ποια είναι τα βήματα για να παράγουμε σήμερα διαγονιδιακά φυτά και ποια τα αντίστοιχα για τα διαγονιδιακά ζώα; Να αναφέρετε παραδείγματα φυτών και ζώων που έχουν τροποποιηθεί γενετικά.3. Ποια ιδιότητα του βακτηρίου εκμεταλλευόμαστε στη δημιουργία διαγονιδιακών φυτών;4. Για ποιους λόγους δημιουργούμε διαγονιδιακά φυτά;5. Ποια μειονεκτήματα παρουσιάζει η καταπολέμηση παρασίτων και εντόμων με χημικά εντομοκτόνα; Πώς η Βιοτεχνολογία έχει βοηθήσει στην καταπολέμηση παρασίτων και εντόμων;6. Τα βακτήρια αποτελούν πολύ καλό υλικό για τη γενετική τροποποίηση φυτών. Εξηγήστε γιατί, δίνοντας παραδείγματα τέτοιων βακτηρίων.7. Ποια τα στάδια παραγωγής μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από διαγονιδιακό ζώο; Δώστε ένα παράδειγμα επιτυχημένης εφαρμογής της μεθόδου αυτής.8. Γιατί πολλές φορές η παραγωγή ανθρώπινων πρωτεϊνών σε βακτήρια μειονεκτεί σε σχέση με την παραγωγή τους από διαγονιδιακά ζώα;9. Ποια τα πλεονεκτήματα της δημιουργίας διαγονιδιακών ζώων και φυτών έναντι της κλασικής μεθόδου των διασταυρώσεων;10. Τι χαρακτηρίζουμε κλώνο σε επίπεδο οργανισμού; Πώς δημιουργήθηκε η Ντόλλυ; Τι διαφορετικό υπήρχε στην περίπτωσή της σε σχέση με παλιότερα πειράματα κλωνοποίησης της δεκαετίας του 1960;11.Ποιες ενδεικτικές εφαρμογές μπορεί να έχει η κλωνοποίηση;12.Τι γνωρίζετε για την ποικιλία Btq; 207
  • 146. 13.Ποια τα βήματα δημιουργίας της Tracy;14.Τι γνωρίζετε για την α1- αντιθρυψίνη και τι για τον παράγοντα ΙΧ;
  • 147. Ερωτήσεις Πολλαπλής Επιλογής1. Ποιοι οργανισμοί ονομάζονται διαγονιδιακοί;α. Οι οργανισμοί που προέρχονται από ελεγχόμενες διασταυρώσειςβ. Οι οργανισμοί στους οποίους έχουν εισαχθεί διάφορες ορμόνεςγ. Οι οργανισμοί που έχουν υποστεί γενετική αλλαγή με τις τεχνικές της ΓενετικήςΜηχανικής.δ. Οι οργανισμοί που έχουν εμβολιαστεί με το κατάλληλο αντιγόνο in vitro.2. Το βακτήριο Agrobacterium tumefaciensα. είναι ένα επικίνδυνο βακτήριο για την υγεία του ανθρώπουβ. παράγει μια ισχυρή τοξίνη δραστική στα πρόβαταγ. χρησιμοποιείται για τη δημιουργία διαγονιδιακών φυτώνδ. ζει κυρίως στο νερό κάτω από αερόβιες συνθήκες.3. Το πλασμίδιο Τiα. προέρχεται από το βακτήριο Bacilus thuringiensisβ. είναι ένα κυκλικό DNA του βακτηρίου Ε. Coliγ. ενσωματώνεται στο γενετικό υλικό των ζώωνδ. απομονώνεται από το Agrobacterium tumefaciens.4. Για να τροποποιηθούν γενετικά τα φυτά χρησιμοποιούνταια. πλασμίδια από οποιοδήποτε βάκιλοβ. τεχνητό DNAγ. πλασμίδιο ιοειδούςδ. πλασμίδιο του Agrobacterium tumefaciens, που συμβιώνει με φυτά.5. Tο πλασμίδιο Τiα. είναι παράγοντας ανθεκτικότητας ενός βακτηρίουβ. προκαλεί όγκους στα φυτά με τα οποία συμβιώνειγ. παράγει τοξίνες που καταστρέφουν το φυτόδ. εισάγεται με μικροέγχυση στα κύτταρα φυτών.6. Τα διαγονιδιακά ζώαα. προέρχονται από τη διασταύρωση επιλεγμένων ζώωνβ. προέρχονται από ζώα των οποίων το ζυγωτό έχει υποστεί γενετική τροπο-ποίησηγ. μοιάζουν με τη "θετή" μητέρα, στη μήτρα της οποίας αναπτύχθηκανδ. μοιάζουν μόνο με τη μητέρα από την οποία προήλθε το ωάριο.7. Για να τροποποιηθεί το γενετικό υλικό μιας αγελάδας εισάγεται «ξένο» γονίδιο σεα. ωάριο του θηλυκού ζώουβ. σπερματοζωάριογ. ζυγωτό 207
  • 148. δ. μαστικά κύτταρα.
  • 150. ΕΠΑΝΑΛΗΨΗ
  • 151. ΕΠΑΝΑΛΗΨΗ ΣΤΑ ΚΕΦΑΛΑΙΑ 1 & 2Ερωτήσεις Πολλαπλής Επιλογής 1. Οι γαµέτες είναι απλοειδή κύτταρα γιατί: α . το γενετικό τους υλικό υπάρχει σε ένα μόνο αντίγραφο β . το γονιδίωµα τους είναι μονόκλωνο γ . η δομή τους είναι όμοια µε των προκαρυωτικών κυττάρων δ . το γονιδίωμά τους υπάρχει σε δύο µόνο αντίγραφα . 2.Το πλασμίδιο των βακτηρίων είναι α . το γονιδίωμά τους β . ένα επί πλέον κυκλικό µόριο DNA γ . τμήμα του κυκλικού µορίου του DNA δ . κυκλικό DNA, μεγαλύτερο από το γονιδίωµα τους . 3.Τα φυλετικά χρωμοσώματα α . εντοπίζονται µόνο στα γεννητικά κύτταρα των πολυκύτταρων οργανισµών β . διατάσσονται πάντοτε σε ζεύγη ομολόγων χρωμοσωμάτων γ . είναι ορατά στα σωµατικά κύτταρα κατά τη μεσόφαση δ . υπάρχουν τόσο στα σωµατικά όσο και στα γεννητικά κύτταρα 4.Η γενετική πληροφορία μεταφέρεται στα ριβοσώματα με : α . πρωτεΐνες β . DNA γ . RNA δ . λιπίδια 5.Τα μόρια με τα οποία μεταφέρονται οι γενετικές πληροφορίες από κύτταρο σε κύτταρο , σε έναν οργανισμό είναι : α . πρωτεΐνες β . DNA γ . RNA δ . τίποτα από τα πιο πάνω 6.Οι μεταγραφικοί παράγοντες α . είναι ρυθμιστικά στοιχεία αντιγραφής του DNA β . είναι ειδικές περιοχές του DNA που πρόκειται να γίνει η μεταγραφή γ . επιτρέπουν στην RNA πολυμεράση τη σωστή έναρξη της μεταγραφής δ . είναι πρωτεΐνες , οι οποίες ρυθμίζουν τη μεταγραφή του DNA. 7. Ο όρος κωδικόνιο αναφέρεται α . σε μια τριάδα νουκλεοτιδίων του γονιδίου και του mRNA β . μόνο σε μια τριάδα νουκλεοτιδίων έναρξης ή λήξης του mRNA 207
  • 152. γ . στα συνώνυμα αμινοξέα του γονιδίουδ . στα αμινοξέα που κωδικοποιούνται από τρία νουκλεοτίδια του mRNA.8. Στην E. coli, το mRNA, που προκύπτει κατά τη μεταγραφή του οπερονίου τηςλακτόζης:α . μεταφράζεται σε τρία ένζυμα απαραίτητα για τη διαδικασία αποικοδόμησης τηςβ . μεταφράζεται σε πρωτεΐνη καταστολέα της λακτόζηςγ . ενεργοποιείται από τον επαγωγέα του οπερονίου της λακτόζηςδ . μεταφράζεται σε RNA πολυμεράση του οπερονίου της λακτόζης .9. Για να γίνει η μεταγραφή του οπερονίου της λακτόζης πρέπει να:α . συνδεθεί ο επαγωγέας με την πρωτεΐνη καταστολέαβ . διεγερθεί η ενζυμική αντίδραση της RNA πολυμεράσης στον υποκινητήγ . εισέλθει η λακτόζη στο κύτταρο της E. coliδ . συνδεθεί µ ε τον καταστολέα το ρυθμιστικό γονίδιο .10. Πώς ονομάζεται το µόριο του DNA που συντίθεται µε µήτρα το mRNA καιτην παρουσία της αντίστροφης μεταγραφάσης;α. ανασυνδυασµένο DNAβ. cDNA,γ. γονιδιωματικό DNAδ. χρωμοσωμικό DNA.11. Με τον όρο γονιδιακή έκφραση αναφερόμαστε στη διαδικασία:α. μεταγραφής των γονιδίωνβ. μετάφρασης των γονιδίωνγ. μετάφρασης του RNAδ. μεταγραφής και μετάφρασης των γονιδίων12. Από τα είδη του RNA αυτό που βρίσκεται σε μεγαλύτερη συγκέντρωση σ’ έναευκαρυωτικό κύτταρο είναι:α. το mRNAβ. το tRNAγ. το rRNAδ. το snRNA13. Στα προκαρυωτικά κύτταρα υπάρχουν τα παρακάτω είδη RNA:α. το mRNA, το snRNA, το tRNAβ. το mRNA, το rRNA, το snRNAγ. το tRNA, το rRNA, το mRNAδ. το snRNA, το tRNA, το rRNA
  • 153. 14. Οι γενετικές πληροφορίες του κυττάρου αποθηκεύονται:α. στις πρωτεΐνεςβ. στο DNAγ. στο RNAδ. στις ιστόνες15. Οι γενετικές πληροφορίες μεταβιβάζονται από κύτταρο σε κύτταρο με:α. τις πρωτεΐνεςβ. το DNAγ. το RNAδ. τα πλασμίδια16. Οι γενετικές πληροφορίες μεταβιβάζονται από έναν πολυκύτταρο οργανισμόστους απογόνους του με:α. τις πρωτεΐνεςβ. το DNAγ. το RNAδ. τους γαμέτες17. Οι υποκινητές είναι ειδικές θέσεις του DNA:α. στις οποίες γίνεται η πρόσδεση της DNA πολυμεράσηςβ. που μεταγράφονται και μεταφράζονται κατά περίπτωσηγ. στις οποίες γίνεται η πρόσδεση της RNA πολυμεράσηςδ. στις οποίες γίνεται η πρόσδεση του καταστολέα18. Ποιο από τα παρακάτω αποτελείται από ριβονουκλεοτίδια;α. υποκινητήςβ. χειριστήςγ. πρωταρχικά τμήματαδ. RNA πολυμεράση19. Οι μεταγραφικοί παράγοντες:α. εμφανίζουν τεράστια ποικιλία σε όλους τους οργανισμούςβ. είναι ειδικές περιοχές του DNA που δηλώνουν έναρξη της μεταγραφήςγ. βοηθούν την RNA πολυμεράση να αρχίσει σωστά τη μεταγραφήδ. είναι ρυθμιστικά στοιχεία της μετάφρασης20. Ποιο από τα παρακάτω αποτελείται από δεοξυριβονουκλεοτίδια;α. πολύσωμαβ. υποκινητήςγ. πρωταρχικά τμήματαδ. DNA πολυμεράση 207
  • 154. 21. Κλώνος είναι:α. τα βακτήρια που έχουν ανασυνδυασμένο DNAβ. το σύνολο των βακτηρίων που είναι ανθεκτικά σε ένα αντιβιοτικόγ. το σύνολο των πλασμιδίων που φέρουν το ίδιο τμήμα DNAδ. τίποτε από τα παραπάνω22.Ένας φωσφοδιεστερικός δεσμός σε δίκλωνο μόριο μπορεί να υδρολυθεί απότη δράση:α. μίας RNA πολυμεράσηςβ. μίας DNA δεσμάσηςγ. μίας περιοριστικής ενδονουκλεάσηςδ. μίας DNA ελικάσης23.Η συμπληρωματικότητα των βάσεων έχει μεγάλη σημασία:α. για τον αυτοδιπλασιασμό του DNAβ. για τη μεταβίβαση της γενετικής πληροφορίας από κύτταρο σε κύτταρογ. για τη σύνθεση των πρωτεϊνώνδ. για όλα τα παραπάνω24.Το νουκλεϊκό οξύ RNA είναι το γενετικό υλικό:α. των προκαρυωτικών κυττάρωνβ. των μιτοχονδρίων και χλωροπλαστώνγ. των διπλοειδών οργανισμώνδ. κάποιων ιών25.Το γονιδίωμα στους προκαρυωτικούς οργανισμούς είναι:α. δυο αντίγραφα κυκλικών μορίων DNAβ. μόνο δίκλωνα κυκλικά μόρια DNA, τα πλασμίδιαγ. ένα δίκλωνο κυκλικό μόριο DNA και τα πλασμίδιαδ. ένα κυκλικό μόριο DNA με πρωτεϊνες26.Τα πλασμίδια που υπάρχουν σε ένα προκαρυωτικό κύτταρο:α. είναι δίκλωνα μόρια DNA με το ίδιο μέγεθοςβ. φέρουν γενικές πληροφορίες για το σύνολο των ιδιοτήτων του βακτηρίουγ. μεταφέρουν γενετικό υλικό σε άλλα βακτήριαδ. αντιγράφονται ταυτόχρονα με το κύριο μόριο DNA του βακτηρίου27.Το γενετικό υλικό βρίσκεται στην κυκλική του μορφή:α. στα προκαρυωτικά κύτταραβ. σε κάποιους ιούςγ. στους χλωροπλάστες και στα μιτοχόνδρια των περισσότερων ευκαρυωτικώνκυττάρωνδ. σε όλα τα παραπάνω
  • 155. 28.Το πείραμα του Griffith απέδειξε:α. ότι το DNA εντοπίζεται στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλά-στες των ευκαρυωτικών κυττάρωνβ. ότι το DNA είναι δυνατόν να μεταφερθεί από νεκρά βακτήριαπνευμονιόκοκκου σε ζωντανάγ. ότι το DNA είναι το γενετικό υλικόδ. τα β και γ29.Στην αντιγραφή του DNA τα κομμάτια της αλυσίδας που αντιγράφεται κατάασυνεχή τρόπο συνδέονται μεταξύ τους:α. με το πριμόσωμαβ. με τη DNA πολυμεράσηγ. με τη DNA δεσμάσηδ. με τις DNA ελικάσες30.Στην αντιγραφή του DNA τα πρωταρχικά τμήματα RNA συντίθεται:α. από τη DNA πολυμεράσηβ. από το πριμόσωμαγ. από τη DNA δεσμάσηδ. από τα επιδιορθωτικά ένζυμα31.Για την αντιγραφή του DNA είναι απαραίτητο να ξετυλιχτούν στις θέσειςέναρξης της αντιγραφής οι δύο αλυσίδες. Αυτό επιτυγχάνεται:α. με τη DNA δεσμάσηβ. με τις DNA ελικάσεςγ. με το πριμόσωμαδ. με τη DNA πολυμεράση32.Στην αντιγραφή του DNA δεν συμμετέχει:α. η DNA ελικάσηβ. η DNA δεσμάσηγ. η αντίστροφη μεταγραφάσηδ. το πριμόσωμα33.Κατά την αντιγραφή του DNA το ένζυμο που επιμηκύνει τα πρωταρχικάτμήματα RNA είναι:α. η RNA πολυμεράσηβ. η αντίστροφη μεταγραφάσηγ. ο πριμόσωμαδ. η DNA πολυμεράση 207
  • 156. 34. Για τη DΝΑ δεσμάση ισχύει:α. ότι καταλύει τη σύνθεση πεπτιδικού και φωσφοδιεστερικούδεσμούβ. ότι ενώνει τα κομμάτια mRNA που προκύπτουν από τη δράση τουριβονουκλεοπρωτεϊνικού (snRNA, πρωτείνες) σωματιδίουγ. ότι η δράση της δεν επηρεάζεται από το ρΗ και τη θερμοκρασίαδ. τίποτε από τα παραπάνω35. Η RNA πολυμεράση:α. υπάρχει μέσα σε όλα τα οργανίδια ενός ευκαρυωτικού κυττάρουβ. τοποθετείται σύμφωνα με τον κανόνα συμπληρωματικότητας απέναντι από τομεταγραφόμενο κλώνο του DNAγ. δεσμεύει, τοποθετεί και συνδέει ριβονουκλεοτίδια σχηματίζονταςτα διάφορα είδη RNA που δημιουργούνται με τη διαδικασία της μεταγραφήςδ. δημιουργεί τα mRNA συνδέοντας ριβονουκλεοτίδια με 5-3φωσφοδιεστερικό δεσμό36. Τα πρόδρομα ερυθροκύτταρα του ανθρώπου:α. περιέχουν 23 μόρια DNAβ. σε αυτά εκφράζονται κυρίως τα γονίδια των αντισωμάτωνγ. περιέχουν 22 ζεύγη ομόλογων αυτοσωμικών χρωμοσωμάτωνδ. όλα τα παραπάνω37.Για την παραγωγή πολλών αντιγράφων ενός πολυπεπτιδίου δεν χρειάζεται:α. να μεταγράφονται πολλά μόρια mRNA από ένα γονίδιοβ. να μεταφράζεται από πολλά ριβοσώματα το ίδιο μόριο mRNAγ. ο σωστός συνδυασμός μεταγραφικών παραγόντωνδ. να αντιγράφεται πολλές φορές το DNA38. Μεταγραφή είναι η μεταφορά της γενετικής πληροφορίας από το μόριοDNA:α. στο μόριο RNAβ. στη πολυπεπτιδική αλυσίδαγ. σε ένα δεύτερο μόριο DNAδ. σε όλα τα παραπάνω39. Η γονιδιωματική βιβλιοθήκη είναι:α. το σύνολο των βακτηριακών κλώνων που περιέχει το ώριμο mRNA ενός ιστούβ. το σύνολο των βακτηριακών κλώνων που περιέχει το συνολικόDNA του οργανισμού δότηγ. το συνολικό DNA του οργανισμού δότηδ. το συνολικό DNA του οργανισμού δότη ενσωματωμένο σε φορέα κλωνοποίησης
  • 157. 40. Γιατί τα πιο πολλά γονίδια των ευκαρυωτικών οργανισμών θεωρούνταιασυνεχή;α) διότι έχουν περιοχές που δεν μεταφράζονται.β)διότι, αν μια πρωτεΐνη συνίσταται από περισσότερες από μια πολυπεπτιδικέςαλυσίδες, χρειάζεται και αντίστοιχο αριθμό γονίδιων.γ) διότι οι αλληλουχίες που τελικά μεταφράζονται διακόπτονται από άλλες πουδεν μεταφράζονται.δ) διότι τα τμήματα τους βρίσκονται σε διαφορετικά χρωμοσώματα.41. Από τι συνίστανται τα σωματίδια που αποκόπτουν τα εσώνια;α) από snRNA.β) από πρωτεΐνες.γ) από ένζυμα.δ) από πρωτεΐνες και snRNA.42. Πού γίνεται η ωρίμανση του mRNA;α) στον πυρήναβ) στο κυτταρόπλασμαγ) στο ενδοπλασματικό δίκτυοδ) σε όλα τα προηγούμενα, ανάλογα με το που παράχθηκε.43. Γιατί η διαδικασία της πρωτεϊνοσύνθεσης χαρακτηρίζεται μετάφραση;α) διότι αντιστοιχούν τρία νουκλεοτίδια σε ένα αμινοξύ.β) διότι η αλληλουχία των συστατικών ενός είδους μορίων καθορίζει τηναλληλουχία ενός μορίου εντελώς διαφορετικού είδους.γ) διότι η γενετική πληροφορία υλοποιείται με τηνπρωτεϊνοσύνθεσηδ) αληθεύουν όλα τα προηγούμενα.44. Σε τι μπορεί να αντιστοιχεί ένα κωδικόνιο;α) σε ένα αμινοξύ.β) στην έναρξη της μετάφρασης και σε αμινοξύ.γ) τη λήξη της μετάφρασηςδ)σ ε όλα τα προηγούμενα.45. Επειδή ο γενετικός κώδικας είναι σχεδόν καθολικός, ένα mRNA μπορείπρακτικά να αποδώσει την ίδια πρωτεΐνη αν μεταφραστεί σε εκχύλισμα:α) φυτικών κυττάρωνβ) ζωικών κυττάρωνγ) βακτηριακών κυττάρωνδ) οποιουδήποτε από τα προηγούμενα 207
  • 158. 46. Δεν έχει συνώνυμα κωδικόνια: α) η έναρξη της μετάφρασης β) η μεθειονίνη γ) η τρυπτοφάνη δ) όλα τα προηγούμενα 47. Ποιο από τα παρακάτω δεν είναι κωδικόνιο λήξης; α) τo AUG β) το UΑΑ γ) τo UAG δ) τo UGA. 48. Το πλήθος των κωδικονίων στο mRNA και τα διαφορετικά μηνύματα που κωδικοποιούν είναι: α) 64 β) 64 και 22 αντίστοιχα γ) 64 και 20 αντίστοιχα δ) 22 49. Ένας άνθρωπος με 45 και ένας με 47 χρωμοσώματα: α) εκδηλώνουν την ίδια ανευπλοειδία β) μάλλον εκδηλώνουν μονοσωμία και τρισωμία αντίστοιχα γ) δεν μπορεί να υπάρχουν δ) προκύπτουν πάντα από τη σύντηξη δυο μη φυσιολογικών γαμετών μεταξύ τουςΕρωτήσεις Σωστού- Λάθους 1. Στο δίκλωνο μόριο DNA ισχύει πάντα η ισότητα: A+ T = C + G. 2. Η αναλογία των βάσεων στο DNA διαφέρει από είδος σε είδος και σχετίζεται με το είδος του οργανισμού. 3. Το κυκλικό μόριο DNA των προκαρυωτικών κυττάρων αναδιπλώνεται και πακετάρεται με τη βοήθεια κυρίως ιστονών. 4. Τα χρωμοσώματα μελετώνται στο στάδιο της μεσόφασης. 5. Η ποσότητα των πρωτεϊνών σε κάθε κύτταρο ενός οργανισμού είναι σταθερή και δεν μεταβάλλεται από αλλαγές στο περιβάλλον.
  • 159. 6. Η ποσότητα DNA σε κάθε κύτταρο ενός οργανισμού μεταβάλλεται με την ηλικία του οργανισμού.7. Το καρδιακό κύτταρο περιέχει διπλάσια ποσότητα DNA από το γαμετικό κύτταρο.8. Τα γαμετικά κύτταρα του ανθρώπου περιέχουν 23 ομόλογα χρωμοσώματα9. Στο πείραμα του Griffith μεγάλο ποσοστό «αδρών» βακτηρίων μετασχηματίστηκαν» σε «λεία» παθογόνα.10. Σε μερικές περιπτώσεις το RNA είναι φορέας γενετικών πληροφοριών.11. Το πείραμα των Arevy κ.ά. η ικανότητα μετασχηματισμού των «αδρών» βακτηρίων σε «λεία» παθογόνα χάνεται με τη δράση ενζύμου που υδρολύει το RNA των νεκρών βακτηρίων.12. Το κάθε ζεύγος ομολόγων χρωμοσωμάτων στον άνδρα έχει το ίδιο μέγεθος.13. To DNA στον άνθρωπο είναι ένα ενιαίο μόριο, που στο διπλοειδές κύτταρο έχει μήκος 2 m.14. Τα γονίδια διπλασιάζονται στη μεσόφαση.15. Ο αριθμός των φυλετικών χρωμοσωμάτων σε ένα ανθρωπινό νευρικό κύτταρο είναι δύο.16. Η παρατήρηση των χρωμοσωμάτων γίνεται στη φάση της μεσόφασης17. Τα γαμετικά κύτταρα είναι απλοειδή, ενώ τα σωματικά κύτταρα είναι διπλοειδή.18. Το γενετικό υλικό των ιών μπορεί να είναι μόνο DNA. 207
  • 160. 19. Ο Griffith απέδειξε ότι το συστατικό που προκαλεί το μετασχηματισμό του «αδρού» βακτηρίου σε «λείο» είναι το DNA.20. Η ποσότητα του DNA είναι αντιστρόφως ανάλογη της πολυπλοκότητας του οργανισμού. Υποκινητές βρίσκονται στο DNA και των προκαρυωτικών οργανισμών.21. To tRNA είναι ένα αντικωδικόνιο.22. Στους προκαρυωτικούς οργανισμούς ένα μόριο mRNA μπορεί να23. έχει περισσότερα από ένα κωδικόνια έναρξης και λήξης. Κάθε μόριο mRNA στους ευκαρυωτικούς οργανισμούς έχει ένα και μόνο24. κωδικόνιο έναρξης και λήξης. To mRNA στους προκαρυωτικούς οργανισμούς έχει δύο περιοχές που δεν25. μεταφράζονται. Η μετακίνηση των ριβοσωμάτων στο mRNA γίνεται προς το 3 άκρο του26. mRNA. Στους προκαρυωτικούς οργανισμούς βρίσκονται μόρια rRNA και tRNA.27.
  • 161. To mRNA της ανθρώπινης προϊνσουλίνης σε εκχυλίσματα βακτηριακών28. κυττάρων in vitro παράγει προϊνσουλίνη. Στους ευκαρυωτικούς οργανισμούς υπάρχουν ομάδες γονιδίων που29. υπόκεινται σε κοινό έλεγχο της έκφρασης τους.30. Τα εσώνια δεν μεταγράφονται. Η DNA δεσμάση καταλύει το σχηματισμό 3 -5 φωσφοδιεστερικών δεσμών.31.32. Τα κύτταρα του ήπατος περιέχουν τα γονίδια των αιμοσφαιρινων.33. Όλα τα γονίδια των ευκαρυωτικών οργανισμών είναι ασυνεχή ή διακε- κομμένα. Στους ευκαρυωτικούς οργανισμούς το «ώριμο» mRNA περιέχει στη σειρά34. την πληροφορία για δυο η περισσότερες πολυπεπτιδικες αλυσίδες. Ο υποκινητής είναι ειδική περιοχή του DNA πριν από την αρχή κάθε35. γονιδίου. 207
  • 162. 36. Ο καταστολέας δένεται ισχυρά στο χειριστή και εμποδίζει την RNA πολυμεράση να αρχίσει τη μεταγραφή37. Η αντιγραφή, η μεταγραφή και η μετάφραση αποτελούν τη γονιδιακή έκφραση.38. Στα ευκαρυωτικά κύτταρα η γονιδιακή έκφραση ρυθμίζεται σε τρία επίπεδα.39. Εσώνια είναι περιοχές του πρόδρομου mRNA που μεταφράζονται σε αμινοξέα.40. Στους προκαρυωτικούς οργανισμούς η μετάφραση αρχίζει πριν ακόμα ολοκληρωθεί η διαδικασία της μεταγραφής.
  • 163. Να συμπληρώσετε τα κενά1. Η αντιγραφή του DNA είναι ………………… μηχανισμός και πραγματοποιείται κατά την ………………… κατεύθυνση. Απαιτεί τη συμμετοχή εξειδικευμένων …………………… και γίνεται κυρίως στον ……………….., αλλά και στα ……………………… , χλωροπλάστες.2. Υπάρχουν τέσσερα είδη RNA: το ……………., το ………………… και το ……………… . Το ………….. υπάρχει μόνο στους ……………. οργανισμούς.3. Στους …………….. οργανισμούς το RNA που προκύπτει από τη διαδικασία της …………………. υφίσταται …………… . Έτσι σχηματίζεται ένα mRNA που αποτελείται μόνο από ………………….. και …………………….. περιοχές, που δε μεταφράζονται σε αμινοξέα.4. Ο γενετικός κώδικας αποτελείται από τους …………… δυνατούς συνδυασμούς των τεσσάρων νουκλεοτιδίων του ………….. ανά ………….. . Τα κωδικόνια λήξης είναι τρία: ………….., …………….. , ……………. και δεν κωδικοποιούν κανένα αμινοξύ.5. Η εισαγωγή του ανασυνδυασμένου DNA σε βακτηριακό κύτταρο ξενιστή ονομάζεται ................6. . Κάθε βακτήριο περιέχει αντίγραφα ενός μονό ............... πλασμιδίου και δίνει ένα................7. Η διαδικασία δημιουργίας κλώνων βακτηρίων ονομάζεται................8. Κλώνος ονομάζεται μια ομάδα ............... μορίων,............... ή………………… 207
  • 165. ΑΠΑΝΤΗΣΗ 207
  • 166. 2ο θέμα
  • 167. Θέμα 3ο 207
  • 168. θέμα 4ο
  • 169. ΑΠΑΝΤΗΣΗ 207
  • 170. Θέμα 5οΑΠΑΝΤΗΣΗ
  • 171. Θέμα 6οΈνα νουκλεϊκό οξύ συνίσταται από 100.000.000 νουκλεοτίδια. α) Πόσες αζωτούχες βάσεις, πεντόζες και φωσφορικές ομάδες περιέχει; β) Πόσους φωσφοδιεστερικούς δεσμούς περιέχει; γ) Πόσες ελεύθερες φωσφορικές ομάδες διαθέτει; δ) Αν η κυτοσίνη αποτελεί το 10% των αζωτούχων βάσεων, ποιο είναι το ποσοστό και το πλήθος των άλλων αζωτούχων βάσεων;ΑΠΑΝΤΗΣΗΘέμα 7ο Σε ένα δίκλωνο μόριο DNA βρέθηκαν 2 · 107 Α και 8 · 107 φωσφοδιεστερικοίδεσμοί. Πόσα είναι τα νουκλεοτίδια και οι δεσμοί υδρογόνου που περιέχει;ΑΠΑΝΤΗΣΗΘέμα 8ο Ένα νουκλεϊκό οξύ συνιστάται από 80.000.000 νουκλεοτίδια. Η θυμίνη αποτελεί το15% των αζωτούχων βάσεων του. α) Ποιο είναι το ποσοστό και το πλήθος των άλλων αζωτούχων βάσεων; β) Ποιο είναι το πλήθος των δεσμών υδρογόνου που αναπτύσσονται; 207
  • 172. γ) Ποιο είναι το πλήθος των φωσφοδιεστερικών δεσμών;ΑΠΑΝΤΗΣΗΘέμα 9ο Σε ένα μόριο DNA από κύτταρο εντοπίστηκαν 55.000.000 φωσφοδιεστερικοί δεσμοί και 65.000.000 δεσμοί υδρογόνου. Ποιο είναι το πλήθος καθεμιάς από τις αζωτούχες βάσεις;ΑΠΑΝΤΗΣΗΘέμα 10οΈνα μόριο DNA έχει 24.998 φωσφοδιεστερικούς δεσμούς. Επίσης το 20 % τωνβάσεων του είναι αδενίνη. Να υπολογίσετε : α) τις αριθμητικές τιμές όλων των βάσεων. β) τους δεσμούς υδρογόνων που συγκρατούν το μόριο αυτόΑΠΑΝΤΗΣΗΘέμα 11ο Σε ένα μόριο DNA υπάρχουν 10.000 άτομα φωσφόρου. Το μόριο αυτό μεταφέρεταικαι διπλασιάζεται σε περιβάλλον ραδιενεργού φωσφόρου. Πόσα άτομα ραδιενεργού
  • 173. φωσφόρου θα υπάρχουν μετά τον πρώτο και πόσα μετά τον τρίτο διπλασιασμό ;Εξηγήστε την απάντηση σας .ΑΠΑΝΤΗΣΗΘέμα 12οΣε ένα μόριο DNA υπάρχουν 10.000 άτομα ραδιενεργού φωσφόρου. Το μόριο αυτό μεταφέρεται και διπλασιάζεται σε περιβάλλον μη ραδιενεργού φωσφόρου. Πόσα άτομα ραδιενεργού φωσφόρου θα υπάρχουν μετά τον πρώτο και πόσα μετά τον τρίτο διπλασιασμό ; Εξηγήστε την απάντηση σας.ΑΠΑΝΤΗΣΗΘέμα 13οΈνα μόριο DNA αποτελείται από 500.000 ζεύγη βάσεων και συγκρατείται από 1.400.000 δεσμούς υδρογόνου. Να βρείτε α) Τα ποσοστά των αζωτούχων βάσεων στο δίκλωνο μόριο DNA β) Τις αριθμητικές τιμές των αζωτούχων βάσεων στο δίκλωνο μόριο DNA γ) Τους φωσφοδιεστερικούς δεσμούς στο δίκλωνο μόριο DNAΑΠΑΝΤΗΣΗΘέμα 14οΜόριο DNA αποτελείται από 1200 νουκλεοτίδια. Υπολογίστε: 207
  • 174. α) Από πόσα κωδικόνια αποτελείται το mRNA που παράγεται από το μόριο αυτό. β) Από πόσα αμινοξέα αποτελείται η πρωτεΐνη που παράγεται από αυτό το μόριο του DNAΑΠΑΝΤΗΣΗΘέμα 15οΈνα μόριο βακτηριακού DNA έχει την παρακάτω ακολουθία: -TACCCAGGTCTCGACCCATAGTGTGACATTCACTTCCTG- -ATGGGTCCAGAGCTGGGTATCACACTGTAAGTGAAGGAC-Αν είναι γνωστό ότι μια αλυσίδα δίνει λειτουργικό προϊόν (πρωτεΐνη) να βρείτε: α) Ποια αλυσίδα είναι η κωδική και ποια η μεταγραφόμενη β) Την αλληλουχία των βάσεων στο mRNA που παράγεται γ) Από πόσα αμινοξέα αποτελείται η πρωτεΐνη που παράγεται δ) Πόσοι δεσμοί πεπτιδικοί συγκρατούν την πρωτεΐνη αυτήΑΠΑΝΤΗΣΗΘέμα 16οΈνα μόριο βακτηριακού DNA έχει την παρακάτω ακολουθία: -AAACGCACGTTAAACATGAGGAAGCCGC ATAACTTT- -TTTGCGTGCAATTTGTACTCCTTCGGCGTATTGAAA-Αν είναι γνωστό ότι μια αλυσίδα δίνει λειτουργικό προϊόν (πρωτεΐνη) να βρείτε: α) Ποια αλυσίδα είναι η κωδική και ποια η μεταγραφόμενη β) Την αλληλουχία των βάσεων στο mRNA που παράγεται
  • 175. γ) Από πόσα αμινοξέα αποτελείται η πρωτεΐνη που παράγεται δ) Πόσοι δεσμοί πεπτιδικοί συγκρατούν την πρωτεΐνη αυτήΑΠΑΝΤΗΣΗΘέμα 17ο Μια αλυσίδα ενός μορίου DNA περιέχει 20% αδενίνη. Υπολογίστε τα ποσοστά των υπολοίπων βάσεων.ΑΠΑΝΤΗΣΗΘέμα 18ο Ένα μόριο mRNA αποτελείται από 30 % αδενίνη ,30 % γουανίνη και 20 % κυτοσίνη.Ποια θα είναι η αναλογία των βάσεων στο δίκλωνο μόριο DNA από το οποίο προήλθεαυτό το μόριο ; (Υπολογίστε τις αναλογίες των βάσεων και στην κωδική και στηνμεταγραφόμενη αλυσίδα)ΑΠΑΝΤΗΣΗ 207
  • 176. Θέμα 19οΣε ένα μόριο DNA η μία αλυσίδα έχει 29% G, 31%C, 25% Τ. Αν η αλυσίδα τουmRNA έχει λόγο A/U μεγαλύτερο από 1 βρείτε ποια αλυσίδα είναι η κωδική και ποιαη μεταγραφόμενη.ΑΠΑΝΤΗΣΗΘέμα 20ο Πόσοι δεσμοί υδρογόνου συγκρατούν 2 αλυσίδες σε ένα μόριο DNA το οποίο έχει106ζεύγη βάσεων σε μήκος και στο οποίο το 20 % των βάσεων είναι θυμίνηΑΠΑΝΤΗΣΗΘέμα 21ο Να βρεθεί ο αριθμός των δεσμών υδρογόνου που θα συγκρατούν ένα μόριο DNA τοοποίο είναι υπεύθυνο για τη σύνθεση πολυπεπτιδικής αλυσίδας 99 αμινοξέων καιπεριέχει 15 % Αδενίνη.ΑΠΑΝΤΗΣΗΘέμα 22οΣας δίνεται η αλληλουχία μιας αλυσίδας ενός δίκλωνου μορίου DNA -ΑΑΑ TTG TAG CAT CTT TAA GGG ACT CCG ΤΤΤ -
  • 177. Να γράψετε τη συμπληρωματική της. Αν γνωρίζετε ότι μια αλυσίδα δίνει λειτουργικό προϊόν βρείτε α) Ποια αλυσίδα είναι κωδική και ποια μεταγραφόμενη β) Το τμήμα του mRNA που θα μεταφραστείΑΠΑΝΤΗΣΗΘέμα 23οΣας δίνεται η αλληλουχία ενός δίκλωνου μορίου DNA -ATG CCG ΤΤΑ ΑΑΑ CGC AGC TAG GGC CAT AAG CCC TCA- -TAC GGC AAT TTT GCG TCG ATG CCG GTA TTC GGG AGT- Av είναι γνωστό ότι μια από ης 2 αλυσίδες δίνει ένα πεπτίδιο με 6 αμινοξέα να βρείτε α) Ποια αλυσίδα είναι κωδική και ποια μεταγραφόμενη β)Το τμήμα του mRNA που θα μεταφραστείΑΠΑΝΤΗΣΗΘέμα 24ο Μια πρωτεΐνη αποτελείται έχει 98 πεπτιδικούς δεσμούς. Αν το DNA (δίκλωνο) που είναι υπεύθυνο για την παραγωγή της πρωτείνης αυτήςσυγκρατείται από 800 δεσμούς υδρογόνου να βρεθεί το ποσοστό των βάσεων στο δίκλωνο μόριο του DNA.ΑΠΑΝΤΗΣΗ 207
  • 178. Θέμα 25οΟ λόγος Α+Τ / G + C ισούται με 0,5 σε μια αλυσίδα του DNA. Ποιος είναι ο αντίστοιχος λόγος για τη συμπληρωματική της αλυσίδα ; Ο λόγος A+G / Τ + C ισούται με 0,8 σε ένα κλώνο του DNA. Να βρεθεί ο ίδιος λόγος για τη συμπληρωματική αλυσίδα καθώς και στο δίκλωνο μόριο του DNAΑΠΑΝΤΗΣΗΘέμα 26οΜια αλυσίδα του DNA περιέχει 20 % Α ενώ η συμπληρωματική της περιέχει 20%C. Το δίκλωνο μόριο του DNA περιέχει 30 % Τ. Να βρεθεί η σύσταση των βάσεων σε κάθε αλυσίδαΑΠΑΝΤΗΣΗ
  • 179. Θέμα 27ο Ένα μόριο mRNA αποτελείται από 9603 βάσεις. Το μόριο αυτό περιέχει 2 εσώνια με Μοριακά Βάρη 760.000 και 440.000 καθώς και 2 αμετάφραστες περιοχές στο 5και 3 άκρο με συνολικό Μ.Β. ίσο με 240.000. Να βρεθεί το Μ.Β. της πρωτεΐνης που κωδικοποιείται από αυτό το μόριο αν το μέσο Μ.Β. του νουκλεοτιδίου είναι 200 και το μέσο Μ.Β. του αμινοξέως είναι 100.ΑΠΑΝΤΗΣΗΘέμα 28οΤο μόριο μιας βακτηριακής πρωτεΐνης αποτελείται από 216 αμινοξέα τα οποία συνδέονται μεταξύ τους και σχηματίζουν 4 πολυπεπτιδικές αλυσίδες ανά 2 όμοιες. Οι α αλυσίδες είναι διπλάσιες σε μήκος από τις β. Ποιος είναι ο αριθμός των νουκλεοτιδίων (μεταγραφόμενη αλυσίδα του DNA κάθε γονιδίου;ΑΠΑΝΤΗΣΗ 207
  • 180. Θέμα 29οΜια πρωτεΐνη συνίσταται από 1000 αμινοξέα. Μετά τη μετάφραση που οδήγησε στη σύνθεση της δεν παρατηρήθηκε αφαίρεση αμινοξέων από το αμινικό άκρο. Πόσα νουκλεοτίδια έχει το τμήμα του mRNA που μεταφράστηκε αν αυτή η αν αυτή η πρωτεΐνη περιλαμβάνει: α) μία πολυπεπτιδική αλυσίδα; β) δυο ίδιες πολυπεπτιδικές αλυσίδες; γ) δύο διαφορετικές πολυπεπτιδικές αλυσίδες;ΑΠΑΝΤΗΣΗ Θέμα 30οΔυο γονίδια ευκαρυωτικού κυττάρου συνίστανται συνολικά από 6000 νουκλεοτίδια. Οι αμετάφραστες περιοχές τους και τα εσώνιά τους αποτελούν το 50% του μήκους τους. Το καθένα από τα γονίδια αυτά κωδικοποιεί τη μία από τις δυο πολυπεπτιδικές αλυσίδες μιας πρωτεΐνης. Πόσα αμινοξέα αποτελούν την πρωτεΐνη αυτή;ΑΠΑΝΤΗΣΗ
  • 181. Θέμα 31οΗ αλληλουχία βάσεων μιας κωδικής αλυσίδας είναι: 5’- ΑΤΑ, TCC, ΑΤG, ΑΤG, ΑΤG, ΑΤG, ΑΤG, CCC, AAA, AAA, TAG, CCC, CCC- 3 α) Να γραφεί η συμπληρωματική αλυσίδα του DNA. β) Να υπολογιστεί το πλήθος των δεσμών υδρογόνου που αναπτύσσονται, γ) Να γραφεί το RNA που παράγεται. δ) Να υπολογιστεί ο αριθμός των αμινοξέων που κωδικοποιούνται, ε) Να γραφούν τα αντικωδικόνια των tRNA που θα χρησιμοποιηθούν.ΑΠΑΝΤΗΣΗΘέμα 32Δίνεται δίκλωνο μόριο DNA το οποίο περιέχει τμήμα ασυνεχούςγονιδίου που μεταγράφεται σε mRNA.α) Πού συναντάμε ασυνεχή γονίδια; (μονάδες 2)β) Να προσδιορίσετε τα 3΄ και 5΄ άκρα του παραπάνω μορίου DNA.(μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 4)γ) Να γράψετε το τμήμα του πρόδρομου mRNA και του ώριμου 207
  • 182. mRNA που προκύπτουν από τη μεταγραφή του παραπάνω μορίουDNA, χωρίς αιτιολόγηση. (μονάδες 2)δ) Πώς προκύπτει το ώριμο mRNA;(μονάδες 3)ε) Μπορεί η περιοριστική ενδονουκλεάση EcoRI να κόψει τοπαραπάνω τμήμα DNA; (μονάδα 1) Να αιτιολογήσετε την απάντησήσας. (μονάδες 3)στ) Ποιες κατηγορίες γονιδίων που υπάρχουν στο χρωμοσωμικό DNAενός κυτταρικού τύπου δεν κλωνοποιούνται σε cDNA βιβλιοθήκη;(μονάδες 8)Μονάδες 25
  • 183. ΕΠΑΝΑΛΗΨΗ ΣΤΑ ΚΕΦΑΛΑΙΑ 4 & 7Να βάλετε σε κύκλο την σωστή απάντηση 1. Οι περιοριστικές ενδονουκλεάσες έχουν τη δυνατότητα να κόβουν: α. το πλασμίδιο σε κατάλληλη θέση β. το ανασυνδυασµένο DNA σε κατάλληλη θέση γ. το γονιδίωµα του ευκαρυωτικού κυττάρου σε κατάλληλη θέση δ. σε όλες τις θέσεις που περιγράφονται στα α, β, γ. 2. Οι περιοριστικές ενδονουκλεάσες: α. περιορίζουν τη μεταγραφή γονιδίων β. είναι απαραίτητες για την έναρξη της αντιγραφής γ. μεταγράφουν το DNA των ιών σε RNA δ. κόβουν το DNA σε καθορισμένες θέσεις. 3. Μια γονιδιωματική βιβλιοθήκη περιέχει: α. αντίγραφα ενός µόνο ανασυνδυασµένου πλασµιδίου β. αντίγραφα του συνολικού γονιδιώματος ενός οργανισμού γ. αντίγραφα του mRNA του οργανισµού δότη δ. τα απαραίτητα ένζυμα για την παραγωγή ανασυνδυασµένου DNA. 4. Η αποδιάταξη του DNA γίνεται µε: α. τη χρήση των περιοριστικών ενδονουκλεασών β. αύξηση της θερμοκρασίας γ. ραδιενεργά σημασμένα µόρια τους ανιχνευτές δ. το ένζυμο DNA δεσμάση. 5. Για τις περιοριστικές ενδονουκλεάσες ισχύει: α. ότι παράγονται στα ευκαρυωτικά κύτταρα β. ότι κόβουν την κάθε αλυσίδα του DNA σε ίσα μέρη γ. ότι υδρολύουν φωσφοδιεστερικούς δεσμούς δ. ότι ανήκουν στα μόρια φορέων κλωνοποίησης 6. Τα βακτήρια με τις περιοριστικές ενδονουκλεάσες που διαθέτουν: α. πέπτουν το DNA των μικροοργανισμών που φαγοκυτταρώνουν β. αποκόπτουν τμήματα των μορίων mRNA που κατασκευάζουν προκαλώντας έτσι την ωρίμανση τους γ. βοηθούν στην ανταλλαγή τμημάτων DNA μεταξύ του πλασμιδίου και του κυρίου μορίου τους DNA δ. προστατεύονται από τη δράση των βακτηριοφάγων 7. Μετασχηματισμός είναι: α. η αλλαγή στη μορφή ενός βακτηρίου 207
  • 184. β. η εισαγωγή ιχνηθετημένων ανιχνευτών μορίων DNA ή RNA σεβακτήριογ. η είσοδος του DNA του φάγου σε βακτήριοδ. η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο8. Οι περιοριστικές ενδονουκλεάσες:α. βρίσκονται στα βακτήριαβ. αναγνωρίζουν ειδικές αλληλουχίες δίκλωνου DNA, μήκους 4-8 νουκλεοτιδίωνγ. συντίθενται στα ριβοσώματαδ. όλα τα παραπάνω9.Αν σε μια κλειστή καλλιέργεια αυξήσουμε τη συγκέντρωση των θρεπτικών συ-στατικών τότε:α. θα μειωθεί η χρονική διάρκεια της λανθάνουσας φάσηςβ. δεν θα παρατηρηθεί φάση θανάτουγ. θα αυξηθεί η χρονική διάρκεια της εκθετικής φάσηςδ. τα α και γ.10.Αν σε μια κλειστή καλλιέργεια μεταβάλλουμε τη θερμοκρασία, τότε:α. θα μεταβληθεί ο μέγιστος αριθμός των μικροοργανισμών που μπορούν να συ-ντηρηθούν στην καλλιέργεια.β. θα επιμηκυνθεί χρονικά η διάρκεια της στατικής φάσηςγ. θα επηρεαστεί η εκθετική φάσηδ. όλα τα παραπάνωε. τα α και β.11. Σε ποια φάση της καμπύλης ανάπτυξης ενός μικροοργανισμού παράγονταιτα επιθυμητά προϊόντα:α. σ όλες τις φάσεις εκτός από τη λανθάνουσα.β. μόνο στη στατική φάση.γ. στη στατική ή στην εκθετική φάση.δ. μόνο στην εκθετική φάση.12.Στις καλλιέργειες σε βιοαντιδραστήρες:α. όλα τα χρήσιμα προϊόντα όπως πρωτεΐνες, ιντερφερόνες και αντιβιοτικάβρίσκονται στα υγρά συστατικά.β. είναι απαραίτητη η διεργασία καθαρισμού του προϊόντος που παραλαμβάνεταιαπό το βιοαντιδραστήρα.γ. ο διαχωρισμός των υγρών από τα στερεά συστατικά γίνεται με εκχύλιση καιαπόσταξη.δ. όλα τα παραπάνω.13.Τα προϊόντα της ζύμωσης είναι:α. άμεσα διαθέσιμα στον άνθρωπο, χωρίς καμία περαιτέρω
  • 185. κατεργασίαβ. τα κύτταρα των μικροοργανισμών, που ονομάζονται βιομάζαγ. προϊόντα των κυττάρων, όπως οι πρωτεΐνες και τα αντιβιοτικάδ. όλα τα παραπάνωε. τα β και γ14.Για την κλειστή καλλιέργεια ισχύει:α. γίνεται προσθήκη συγκεκριμένης ποσότητας θρεπτικού υλικού, το οποίο δεν ανανεώνεταιβ. δεν μπορεί να γίνει έλεγχος και ρύθμιση των συνθηκών που αφορούν τηνκαλλιέργεια.γ. η στατική φάση έχει μικρότερη διάρκεια σε σχέση με τη συνεχή καλλιέργειαδ. όλα τα παραπάνωε. τα α και γ.15.Για τη συνεχή καλλιέργεια ισχύει:α. οι μικροοργανισμοί δεν παράγουν τοξικά προϊόντα από το μεταβολισμό τουςβ. γίνεται συνεχώς τροφοδότηση της καλλιέργειας με θρεπτικά συστατικάγ. ο αριθμός των μικροοργανισμών αυξάνεται συνεχώςδ. όλα τα παραπάνωε. τα β και γ.16.Το άγαρ:α. είναι απαραίτητο θρεπτικό συστατικό μιας καλλιέργειαςβ. χρησιμοποιείται για τον εμβολιασμό των καλλιεργειώνγ. είναι ρευστό σε θερμοκρασίες άνω των 45°C, αλλάστερεοποιείται σε μικρότερες θερμοκρασίεςδ. είναι απαραίτητο να προστεθεί σε καλλιέργειες αυτότροφωνοργανισμών διότι προέρχεται από φύκη.17. Ο εμβολιασμός μιας καλλιέργειας είναι:α. η προσθήκη μικροοργανισμών που έχουν χάσει την παθογένεια τους, αλλάδιατηρούν την ανοσογένειά τους.β. απαραίτητος για να μπορούν να διατηρηθούν οι καλλιέργειες σε αδρανή μορφήστην κατάψυξη (-80° C), για μεγάλα χρονικά διαστήματα.γ. απαραίτητος για την αποφυγή ανάπτυξης άλλων μικροοργανισμών.δ. είναι η προσθήκη μικρής ποσότητας κυττάρων στο θρεπτικό υλικό.18. Οι βιοαντιδραστήρες ή ζυμωτήρες:α. χρησιμοποιούνται για την καλλιέργεια μικροοργανισμών σεαναερόβιες συνθήκες.β. χρησιμοποιούνται για την καλλιέργεια μικροοργανισμών σε μεγάλη κλίμακα(βιομηχανικές καλλιέργειες).γ. επιτρέπουν τον έλεγχο και τη ρύθμιση των συνθηκών που αφορούν 207
  • 186. την καλλιέργεια (θερμοκρασία, ρΗ, συγκέντρωση Ο2, συγκέντρωση άγαρ,κ.τ.λ.).δ. τα β και γ.ε. όλα τα παραπάνω.19.Προαιρετικά αερόβιοι ονομάζονται οι οργανισμοί, οι οποίοι:α. προτιμούν να αναπτύσσονται απουσία Ο2, αλλά μπορούν να αναπτυχθούν καιπαρουσία Ο2.β. απουσία Ο2 αναπτύσσονται με ταχύτερο ρυθμό από ότι παρουσία Ο2γ. έχουν μικρότερο χρόνο διπλασιασμού όταν αναπτύσσονταιπαρουσία Ο2 και μεγαλύτερο όταν αναπτύσσονται απουσία Ο2.δ. τίποτα από τα παραπάνω.20. Για τα βακτήρια του γένους Clostridium ισχύει:α. είναι υποχρεωτικά αερόβιοι οργανισμοί.β. το Ο2 είναι τοξικό γι αυτούς.γ. αναπτύσσονται κοντά σε θερμοπηγές.δ. είναι αυτότροφοι οργανισμοί.ε. τα β και δ.21. Σήμερα με τον όρο ζύμωση εννοούμε:α. τη διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικόυλικό, σ οποιεσδήποτε συνθήκες (αερόβιες ή αναερόβιες).β. τη διαδικασία ανάπτυξης μικροοργανισμών σ υγρό ή στερεό θρεπτικό υλικό σοποιεσδήποτε συνθήκες (αερόβιες ή αναερόβιες).γ. τη διαδικασία ανάπτυξης μικροοργανισμών σ υγρό θρεπτικό υλικό,αποκλειστικά σ αναερόβιες συνθήκες.δ. τη διαδικασία ανάπτυξης μικροοργανισμών σ υγρό θρεπτικό υλικό,αποκλειστικά σ αερόβιες συνθήκες.22. Τα προϊόντα της ζύμωσης:α. μπορούν να αξιοποιηθούν μόνο όταν είναι απόλυτα καθαρά, δηλαδή όταν δενέχουν προσμείξεις.β. καθαρίζονται με μια πληθώρα βιοχημικών τεχνικών καθαρισμού όπως είναι ηφυγοκέντρηση και η διήθηση.γ. βρίσκονται πάντα μέσα στα ίδια τα κύτταρα δηλαδή στη βιομάζα,δ. τίποτα από τα παραπάνω.23. Η φυγοκέντρηση και η διήθηση είναι τεχνικές που χρησιμοποιούνται:α. για να γίνει ο τελικός καθαρισμός του προϊόντος της ζύμωσης,β. για να γίνει διαχωρισμός των στερεών από τα υγρά συστατικά της ζύμωσης.γ. μαζί με τη χρωματογραφία για την παραλαβή των ενδοκυτταρικών προϊόντωντης ζύμωσης.δ. τα β και γ
  • 187. 24. Μία από τις μεθόδους, η οποία μπορεί να χρησιμοποιηθεί για τηνείσοδο του «ξένου» DNA στο ζυγωτό ενός ζώου είναι:α. η διασταύρωση επιλεγμένων ατόμων που έχουν,συγκεκριμέναχαρακτηριστικάβ. η μικροέγχυσηγ. η μέθοδος PCRδ. η τεχνολογία του ανασυνδυασμένου DNA 207
  • 188. Ερωτήσεις Σωστού- Λάθους 1. Με την τεχνολογία του ανασυνδυασμένου DNA μπορούμε να ερευνήσουμε αλλά και να τροποποιήσουμε το γενετικό υλικό. 2. Το ανασυνδυασμένο μόριο DNA αποτελείται από DNA ενός 3. οργανισμού και RNA άλλου οργανισμού 4. 5. Το ένζυμο ECοR Ι αναγνωρίζει και κόβει την αλληλουχία βά- 6. σεων GAATTC μεταξύ Α και G. 7. Η επίδραση μιας συγκεκριμένης περιοριστικής 8. ενδονουκλεάσης έχει ως αποτέλεσμα όλα τα κομμάτια DNA, που προκύπτουν από τη δράση της, να έχουν το ίδιο μήκος και να κωδικοποιούν τις ίδιες πληροφορίες. 9. Τα ιχνηθετημένα μόρια ανιχνευτές περιέχουν 10. συμπληρωματικές αλληλουχίες βάσεων με το κλωνοποιημένο DNA. 11. Η διαδικασία δημιουργίας υβριδίων DNA - RNA ονομάζεται 12. μετασχηματισμός. 13. Με τη μέθοδο της αλυσιδωτής αντίδρασης PCR αντιγράφουμε ειδικές αλληλουχίες DNA in vitro. 14. Ο Παστέρ υπήρξε ο πρωτοπόρος για την ανάπτυξη του κλάδου της Βιοτεχνολογίας. 15. Οι μικροοργανισμοί είναι πάντα επικίνδυνοι για τον άνθρωπο. 16. Με την καλλιέργεια των μικροοργανισμών μπορούμε να πάρουμε πολλά χρήσιμα προϊόντα, όπως ποτά και τρόφιμα. 17. Η Βιοτεχνολογία είναι ένας διεπιστημονικός κλάδος (συνδυασμός Επιστήμης και Τεχνολογίας). 18. Η Μικροβιολογία αποτελεί τη βάση της Βιοτεχνολογίας.
  • 189. 19. Μία από τις πιο παλιές βιοτεχνολογικές μεθόδους είναι η 20. παραγωγή ψωμιού.21. Η ζύμωση είναι βιοτεχνολογική διαδικασία. 22.23. Εκθετική είναι η φάση ανάπτυξης των μικροοργανισμών κατά 24. την οποία ο πληθυσμός δεν αυξάνεται.25. Στις κλειστές καλλιέργειες οι μικροοργανισμοί βρίσκονται 26. συνεχώς σε εκθετική φάση ανάπτυξης.27. Η παραγωγή της πενικιλίνης γίνεται στους βιοαντιδραστήρες.28. Η διαθεσιμότητα των θρεπτικών συστατικών, το ρΗ, το Ο 2 και η θερμο- κρασία είναι οι κυριότεροι παράγοντες που επηρεάζουν το ρυθμό ανάπτυξης των μικροοργανισμών.29. Σε σχέση με την ανάγκη τους σε Ο2, οι μικροοργανισμοί ταξινομούνται στους υποχρεωτικά και στους προαιρετικά (δυνητικά) αερόβιους.30. Για την καλλιέργεια των μικροοργανισμών στο εργαστήριο, είναι απαραίτητη η χρήση ζυμωτήρων ή βιοαντιδραστήρων.31. Τα στερεά θρεπτικά υλικά προκύπτουν από την προσθήκη του πολυσακχαρίτη άγαρ στα υγρά θρεπτικά υλικά.32. Τα θρεπτικά υλικά που χρησιμοποιούνται για την καλλιέργεια των μικρο- οργανισμών, πρέπει οπωσδήποτε να περιέχουν Η2Ο, πηγή C, πηγή αζώτου και διάφορα ιόντα.33. Η αποστείρωση χρησιμοποιείται μόνο στην περίπτωση καλλιέργειας παθο- γόνων μικροοργανισμών.34. . Σήμερα με τον όρο ζύμωση εννοούμε τη διαδικασία ανάπτυξης μικροορ- γανισμών σ υγρό θρεπτικό μέσο, κάτω από οποιεσδήποτε συνθήκες (αε- ρόβιες ή αναερόβιες). 207
  • 190. Να συμπληρώσετε τα κενά1. Οι............... ............... παράγονται από τα βακτήρια και ο φυσιολογικός τους ρόλοςείναι να τα προστατεύουν από την εισβολή «ξένου» DNA. 2. Το σύνολο των βακτηριακών κλώνων που περιέχει το συνολικό DNA του οργανισμού δότη αποτελεί μια............... ............... . 3. Για να γίνει επιλογή ενός κλώνου που έχει το επιθυμητό γονίδιο, χρησιμοποιούνται ειδικοί................ 4. Η σύνθεση του cDNA γίνεται από το ένζυμο............... .............. 5. Για να κατασκευαστεί μια............... ............... απομονώνεται το ολικό mRNA από κύτταρα που εκφράζουν το συγκεκριμένο γονίδιο. 6. Η διαδικασία αποχωρισμού των δύο συμπληρωματικών αλυσίδων του DNA λέγεται................ 7. Η διαδικασία επανασύνδεσης δυο μονόκλωνων συμπληρωματικών αλυσίδων DNA ή συμπληρωματικών DNA-RNA λέγεται................ 8. Οι περιοριστικές ενδονουκλεάσεις αναγνωρίζουν …………..... δίκλωνου DNA. 9. Οι παράγοντες που επηρεάζουν το χρόνο διπλασιασμού και κατά συνέπεια το ρυθμό ανάπτυξης των μικροοργανισμών είναι η.......................... .............................. υλικών, το .................................., το ................................., και η ..................................
  • 191. 10. Υπάρχουν μικροοργανισμοί που για την ανάπτυξη τους απαιτούν μεγάλες συγκεντρώσεις ................................., και ονομάζονται..................... ............ ................................, άλλοι που αναπτύσσονται με ταχύτερο ρυθμό παρουσία................................., από ό,τι απουσία του και ονομάζονται .............................. και άλλοι στους οποίους το ................................., είναι ...................................και ονομάζονται.......................................................11. Για την αποφυγή ανάπτυξης άλλων μικροοργανισμών, εκτός από εκείνους που πρόκειται να καλλιεργηθούν, τα υλικά και οι συσκευές............. .................... πριν από την έναρξη της καλλιέργειας.12. Στην κλειστή καλλιέργεια οι φάσεις ανάπτυξης των μικροοργανισμών είναι κατά χρονική σειρά η.................................. η..............................................................η ................................ και η .............................. .13. Οι μικροοργανισμοί παράγουν συνήθως χρήσιμα προϊόντα κατά τη διάρκεια της..............................και της ..............................φάσης ανάπτυξης τους. 207
  • 192. Θέμα 1οΠόσα μόρια DNA θα προκύψουν από κόψιμο με ECOR I … E. Ενός δίκλωνου γραμμικού μορίου το οποίο φέρει μία θέση αναγνώρισης για το ένζυμο; F. Ενός δίκλωνου γραμμικού μορίου το οποίο φέρει δύο θέσεις αναγνώρισης για το ένζυμο; G. Ενός πλασμιδίου το οποίο φέρει μια θέση αναγνώρισης για το ένζυμο; H. Ενός πλασμιδίου το οποίο φέρει δύο θέσεις αναγνώρισης για το ένζυμο;ΑΠΑΝΤΗΣΗΘέμα 2ο Το τμήμα του DNA που φαίνεται παρακάτω εισάγεται σε βακτήριο E. Coli 5’ GAAGAATTCGGCAATGAATTCAGTGAATTCAA 3’ 3’ CTTCTTAAGCCGTTACTTAAGTCACTTAAGTT 5’ d. Ποιο είναι το προϊόν της δράσης της ECORI ; e. Πόσοι φωσφωδιεστερικοί δεσμοί διασπάστηκαν και πόσοι δεσμοί Υδρογόνου καταστράφηκαν;Αν θέλουμε να κλωνοποιήσουμε τα παραγόμενα τμήματα DNA πόσα πλασμίδιαπρέπει να χρησιμοποιήσουμε;ΑΠΑΝΤΗΣΗ
  • 193. Θέμα 3ο Ένα πλασμίδιο που χρησιμοποιείται ως φορέας κλωνοποίησης για την κατασκευή μιας γονιδιωματικής βιβλιοθήκης διαθέτει το γονίδιο ανθεκτικότητας στην αμπικιλίνη και την τετρακυκλίνη. Η μοναδική θέση αναγνώρισης από την ECO RI εμπεριέχεται στο γονίδιο της τετρακυκλίνης. Πώς μπορούμε να επιλέξουμε τα μετασχηματισμένα βακτήρια που δέχτηκαν το ανασυνδυασμένο πλασμίδιο;ΑΠΑΝΤΗΣΗ 207
  • 194. ΕΠΑΝΑΛΗΨΗ ΣΤΑ ΚΕΦΑΛΑΙΑ 5 & 6 Να βάλετε σε κύκλο την σωστή απάντηση 1. Όταν δύο αλληλόµορφα γονίδια εκφράζονται στο φαινότυπο των ετερόζυγων ατόμων ονομάζονται: α. επικρατή β. πολλαπλά αλληλόµορφα γ. συνεπικρατή δ. ατελώς επικρατή. 2. Ένα άτομο χαρακτηρίζεται ως ομόζυγο επικρατές όταν, για μια συγκεκριμένη ιδιότητα, έχει: α. δύο επικρατή αλληλόµορφα β. δύο υπολειπόμενα αλληλόµορφα γ. ένα επικρατές και ένα υπολειπόμενο αλληλόμορφο δ. δύο συνεπικρατή αλληλόµορφα. 3. Η β-θαλασσαιμία είναι µία ασθένεια που ελέγχεται από: α. υπολειπόμενα φυλοσύνδετα γονίδια β. πολλαπλά αλληλόµορφα γονίδια γ. δύο αλληλόµορφα γονίδια δ. ατελώς επικρατή γονίδια. 4. Κατά τη διασταύρωση ελέγχου ένα άτομο άγνωστου γονότυπου διασταυρώνεται µε ένα άτομο: α. ομόζυγο για το επικρατές αλληλόμορφο γονίδιο β. ετερόζυγο για το υπολειπόμενο αλληλόμορφο γονίδιο γ. ετερόζυγο για το επικρατές αλληλόμορφο γονίδιο δ. ομόζυγο για το υπολειπόμενο αλληλόμορφο γονίδιο. 5. Τα φυλοσύνδετα γονίδια βρίσκονται στο: α. Χ χρωμόσωμα και δεν έχουν αλληλόµορφα στο Υ χρωμόσωμα β. Υ χρωμόσωμα και δεν έχουν αλληλόµορφα στο Χ χρωμόσωμα γ. Υ χρωμόσωμα και είναι θνησιγόνα δ. Υ χρωμόσωμα και τα αλληλόμορφά τους βρίσκονται στο Χ χρωμόσωμα. 6.Ένα υπολειπόμενο γονίδιο: α. δεν εκφράζεται ποτέ στο φαινότυπο του ατόμου β. εκδηλώνεται μόνο σε ομόζυγη κατάσταση γ. δεν εκφράζεται στα θηλυκά άτομα δ. εκφράζεται μόνο σε ομόζυγη κατάσταση αν πρόκειται για αυτοσωμικό γονίδιο 7. Σε μια διασταύρωση πτηνών με μαύρο χρώμα πτερώματος με πτηνά με κίτρινο χρώμα πτερώματος, οι απόγονοι της F1 ήταν όλοι κίτρινοι. Αυτό σημαίνει ότι:
  • 195. α. οι κίτρινοι γονείς είναι ετερόζυγοιβ. οι μαύροι γονείς είναι ετερόζυγοιγ. οι μαύροι γονείς είναι ομόζυγοιδ. κανένα από τα παραπάνω8. Ο φυλοκαθορισμός στον άνθρωπο γίνεται (φυσιολογικά άτομα):α. από ένα ζευγάρι αυτοσωμικών ομόλογων χρωμοσωμάτωνβ. από ένα παραπάνω χρωμόσωμα που υπάρχει στα κύτταρα τωνθηλυκώνγ. από ένα ζεύγος ομοίων στα αρσενικά και ένα ζεύγος ανόμοιων χρωμοσωμάτωνστα θηλυκάδ. από δυο Χ χρωμοσώματα στα θηλυκά, και από ένα Χ και Υ χρωμόσωμα στααρσενικά9. Λέγοντας φυλοσύνδετη ασθένεια στον άνθρωπο εννοούμε ότι:α. η ασθένεια εμφανίζεται μόνο στο ένα φύλοβ. τα θηλυκά άτομα είναι συνήθως φορείς και δεν αρρωσταίνουνγ. η γενετική πληροφορία υπάρχει μόνο στα θηλυκά, οπότε τααρσενικά δεν κληρονομούν την ασθένειαδ. μόνο τα αρσενικά άτομα εκδηλώνουν τη νόσο10. Η εμφάνιση ενός φυλοσύνδετου χαρακτηριστικού στο φαινότυπο ενός άντραοφείλεται στο ότι:α. το κληρονόμησε από τη μητέρα τουβ. το κληρονόμησε από τον πατέρα τουγ. το γονίδιο υπάρχει στο Χ και Υ χρωμόσωμαδ. το αλληλόμορφο που υπάρχει στο Χ είναι πάντα υπολειπόμενο ως προς αυτόπου υπάρχει στο Υ11. Πόσοι διαφορετικοί γονότυποι θα μπορούσαν να προκύψουν από τη διασταύ-ρωση δύο ατόμων που είναι ετερόζυγοι ως προς δύο χαρακτήρες;α. 9β. 4γ. 8δ. 1612. Ένα ζευγάρι έχει τέσσερα παιδιά, όλα κορίτσια. Ποια η πιθανότητα τοπέμπτο παιδί να είναι αγόρι;α. 20%β. 50%γ. 75%δ. 100% 207
  • 196. 13. Τα δύο πρώτα παιδιά μιας οικογένειας ανήκουν στην ομάδα ΑΒ. Το τρίτο παι- δί είναι αγόρι και έχει ομάδα αίματος Ο. Ποιο από τα παρακάτω είναι σωστό; α. ο πατέρας έχει ομάδα αίματος Α και η μητέρα Β β. οι γονείς έχουν ομάδα αίματος ΑΒ γ. ο γιος είναι σίγουρα νόθος δ. ο πατέρας έχει ομάδα αίματος Α και η μητέρα Ο 14. H πιο συνηθισμένη αριθμητική χρωμοσωμική ανωμαλία είναι: α) το σύνδρομο Down β) το σύνδρομο Kleinefelter γ) το σύνδρομο Turner δ) η τρισωμία 13 15. Στις ανευπλοειδίες των φυλετικών χρωμοσωμάτων δεν περιλαμβάνεται: α) η τρισωμία 13 β) η τρισωμία 18 γ) η τρισωμία 21 δ) καμία από τις παραπάνω 16. Πότε κυρίως αυξάνεται η πιθανότητα γέννησης ατόμου με σύνδρομο Down; α) όσο αυξάνεται η ηλικία του πατέρα β) οσο αυξάνεται η ηλικία της μητέρας γ) όσο μειώνεται η ηλικία της μητέρας δ) όταν οι γονείς έχουν στενή συγγένεια. 17. Δεν αληθεύει ότι το σύνδρομο Kleinefelter και το σύνδρομο Turner: α) είναι ανευπλοειδίες β) προκαλούν στειρότητα γ) έχουν παρόμοιο φαινότυποδ) υπακούουν σε όλα τα προηγούμενα 18. Η μοναδική μονοσωμία που φαίνεται ότι είναι βιώσιμη στον άνθρωπο είναι: α) το σύνδρομο Kleinefelter β) το σύνδρομο Turner γ) το σύνδρομο Down δ) το σύνδρομο Edwards 19. Οι χρωμοσωμικές ανωμαλίες οφείλονται σε παράγοντες οι οποίοι κατ’ αρχήν προκαλούν στα χρωμοσώματα: α) θραύσεις β) μετατοπίσεις γ) αναστροφές δ) διπλασιασμούς
  • 197. 20. Ποια χρωμοσωμική ανωμαλία μπορεί να αυξήσει την ποσότητα του γενετικούυλικού σε ένα χρωμόσωμα;α) η μετατόπισηβ) ο διπλασιασμόςγ) η αμοιβαία μετατόπισηδ) όλες οι προηγούμενες.21.Το σύνδρομο φωνή της γάτας οφείλεται:α) σε έλλειψη του χρωμοσώματος 5β)σε έλλειψη μεγάλου τμήματος του μικρού βραχίονα του χρωμοσώματος 5γ) σε αναστροφή του μικρού βραχίονα του χρωμοσώματος 5δ)σε κάποιο από τα προηγούμενα22. Ο καρυότυπος δεν προσφέρεται για τον εντοπισμό:α) δομικών χρωμοσωμικών ανωμαλιώνβ) αριθμητικών χρωμοσωμικών ανωμαλιώνγ) γονιδιακών μεταλλάξεωνδ) όλων των προηγουμένων τύπων μεταλλάξεων ,23. Ανάλογα με την έκταση τους, οι μεταλλάξεις κατατάσσονται σε:α) μεγάλες και μικρέςβ) γονιδιακές και χρωμοσωμικέςγ) βαριές και ήπιεςδ) αριθμητικές και δομικές24. Μια μετάλλαξη μπορεί να κληροδοτείται στις επόμενες γενιές ατόμων:α) αν συμβεί σε σωματικό κύτταροβ) είτε συμβεί σε σωματικό κύτταρο είτε συμβεί σε γεννητικόγ) αν συμβεί σε σωματικό κύτταρο και ταυτόχρονα σε γεννητικόδ) αν συμβεί σε γεννητικό κύτταρο25. Δεν περιλαμβάνονται στις γονιδιακές μεταλλάξεις:α) η αναστροφή βάσηςβ) η αντικατάσταση βάσηςγ) η προσθήκη βάσηςδ) η έλλειψη βάσης26. Σε ποιο είδος γονιδιακής μετάλλαξης συνήθως δεν αλλάζει το μήκος τουανοικτού πλαισίου ανάγνωσης;α) στην αντικατάσταση βάσης.β) στην προσθήκη βάσης.γ) στην έλλειψη βάσης.δ) σε όλες τις προηγούμενες. 207
  • 198. 27.Ποιες από τις επόμενες αλλαγές στο γενετικό υλικό δεν επιδρούνουσιαστικά στον φαινότυπο;α) οι ουδέτερες μεταλλάξειςβ) οι σιωπηρές μεταλλάξειςγ) αυτές που συμβαίνουν σε περιοχές που δεν έχουν πληροφορίεςδ) όλες οι προηγούμενες.28.Οι περισσότερες αλλαγές στο γενετικό υλικό παρατηρούνται στις:α) κωδικοποιούσες περιοχέςβ) περιοχές που μεταγράφονται για να γίνει μετάφρασηγ) περιοχές που δεν έχουν γενετικές πληροφορίεςδ) περιοχές που έχουν γονίδια29.Ποια είναι σχεδόν πάντα η αιτία της α - θαλασσαιμίας;α) οι ελλείψεις βάσεων.β) οι ελλείψεις ολόκληρων γονιδίων.γ) οι ελλείψεις χρωμοσωμικών τμημάτων.δ) όλες οι προηγούμενες.30.Όταν μια μετάλλαξη θίγει τη σύνθεση κάποιου ενζύμου:α) προκαλείται αλφισμόςβ) προκαλείται φαινυλκετονουρίαγ) διαταράσσεται ο μεταβολισμόςδ) τότε προκαλείται κληρονομική νόσος31.Ο αλφισμός γενετικά οφείλεται:α) στην έλλειψη της μελανίνηςβ) στη μειωμένη ενεργότητα του ενζύμου που εξασφαλίζει τη σύνθεση τηςμελανίνηςγ) σε υπολειπόμενο αλληλόμορφο του αυτόσωμικού γονιδίου που ελέγχει τησύνθεση του ενζύμου που εξασφαλίζει τη σύνθεση της μελανίνηςδ) σε μια χρωστική32. Οι χρωμοσωμικές ανωμαλίες διακρίνονται σε:α) αντικαταστάσεις, προσθήκες και ελλείψειςβ) αριθμητικές και δομικέςγ) διάσπαρτες και εντοπισμένεςδ) όλες τις προηγούμενες κατηγορίες33. Πώς δημιουργούνται οι χρωμοσωμικές ανωμαλίες;α) από λάθος διαχωρισμό των ομόλογων χρωμοσωμάτων.β) από λάθος διαχωρισμό των αδελφών χρωματίδων.
  • 199. γ) από λάθος διαχωρισμό είτε των ομόλογων χρωμοσωμάτων είτε των αδελφώνχρωματίδων.δ) από λάθος διαχωρισμό των ομόλογων χρωμοσωμάτων και κατόπιν τωναδελφών χρωματίδων.34. Ανευπλοειδία ονομάζεται:α)η περίσσεια μικρού αριθμού χρωμοσωμάτωνβ) η έλλειψη μικρού αριθμού χρωμοσωμάτωνγ) η περίσσεια είτε η έλλειψη μικρού αριθμού χρωμοσωμάτωνδ) η περίσσεια είτε η έλλειψη χρωμοσωμάτων 207
  • 200. Ερωτήσεις Σωστού- Λάθους 1. Οι περιοριστικές ενδονουκλεάσες είναι γονίδια που κωδικοποιούν ένζυμα, τα οποία κόβουν το DNA σε ορισμένες περιοχές. 2. Οι περιοριστικές ενδονουκλεάσες αναγνωρίζουν ειδικές αλληλου-χίες δίκλωνου DNA και το κόβουν σε ορισμένη θέση. 3. Η απομόνωση των περιοριστικών ενδονουκλεασών επέτρεψε στους ερευνητές να αναπτύξουν την τεχνολογία του ανασυνδυασμένου DNA. 4. Ως φορέας κλωνοποίησης χρησιμοποιείται DNA ευκαρυωτικών κυττάρων. 5. Ως φορείς κλωνονοποίησης χρησιμοποιούνται πλασμίδια, βακτη-ριοφάγοι και ιοί. 6. Οι απόγονοι φυσιολογικών ατόμων είναι πάντοτε φυσιολογικοί. 7. Όλα τα γονίδια του Χ χρωμοσώματος είναι φυλοσύνδετα. 8. Με τη διασταύρωση ελέγχου βρίσκουμε το φαινότυπο γνωρίζοντας το γονότυπο. 9. Κατά τη διάρκεια της μείωσης γίνεται διαχωρισμός των ομόλογων χρω- μοσωμάτων, των αδελφών χρωματίδων και των αλληλομόρφων. 10. Ο φαινότυπος είναι η έκφραση του γονότυπου ενός οργανισμού. 11. Οι γαμέτες παράγονται κατά τη μείωση. 12. Αν ένα αλληλόμορφο δεν είναι επικρατές, τότε είναι υπολειπόμενο. 13. Ο νόμος του διαχωρισμού των αλληλομόρφων δεν ισχύει για ατελώς επικρατή γονίδια. 14. Τα αμιγή άτομα μετά από αυτογονιμοποίηση δίνουν άτομα με την ίδια ιδιότητα. 15. Το μοσχομπίζελο δεν αναπτύσσεται εύκολα, εμφανίζει όμως μεγάλη ποικιλότητα σε πολλούς χαρακτήρες.
  • 201. 16. Μονοϋβριδισμός είναι ο τρόπος κληρονόμησης μιας ιδιότητας, μόνο στους απλοειδείς οργανισμούς.17. Κατά τον πρώτο νόμο του Μέντελ, το γονίδιο που ελέγχει μία ιδιότητα δεν επηρεάζει τη μεταβίβαση του γονιδίου που ελέγχει άλλη ιδιότητα.18. Η διασταύρωση ελέγχου χρησιμοποιείται για τον έλεγχο του γονότυπου, όταν γνωρίζουμε το φαινότυπο.19. Στις τροποποιημένες φαινοτυπικές αναλογίες των απογόνων δεν ισχύουν οι νόμοι του Μέντελ.20. Τα γονίδια που καθορίζουν τις ομάδες αίματος δημιουργούν πολλά είδη φαινοτύπων, λόγω των διαφορετικών συνδυασμών που γίνονται.21. Για την ασθένεια β-θαλασσαιμία και την ιδιότητα προσκολλημένοι λοβοί αυτιών, υπεύθυνα είναι αυτοσωμικά υπολειπόμενα γονίδια.22. Οι αυτοσωμικές υπολειπόμενες ασθένειες εκφράζονται μόνο στα ομόζυγα άτομα.23. Όταν και οι δυο γονείς είναι φορείς, η πιθανότητα γέννησης παιδιού που πάσχει είναι 50%.24. Ο Mendel πραγματοποίησε την πρώτη επιστημονική μελέτη της κληρονομικότητας κατά την οποία, σε κάθε πείραμα, μελέτησε μία ή δύο διαφορετικές ιδιότητες του μοσχομπίζελου.25. Ο γονότυπος ενός ατόμου αναφέρεται στην επικράτηση ή όχι ενός χαρακτηριστικού.26. Τα γονίδια που καθορίζουν την ομάδα αίματος σύμφωνα με το σύστημα ΑΒΟ είναι δύο αλληλόμορφα γονίδια. 207
  • 202. 27. Το γενεαλογικό δέντρο είναι η διαγραμματική απεικόνιση διάφορων χαρακτηριστικών των μελών μιας οικογένειας για πολλές γενεές.28. Η αιμορροφιλία Α είναι μία ασθένεια που ελέγχεται από αυτοσωμικα υπολειπόμενα γονίδια.29. Στη μελέτη του τρόπου μεταβίβασης των κληρονομικών χαρααρα- κτήρων θα πρέπει να λαμβάνουμε υπόψη μας ότι κάθε κύηση είναι ένα ανεξάρτητο γεγονός, το οποίο δε σχετίζεται με τα απoτελέσματαματα άλλων κυήσεων.30. Τα μέλη μιας οικογένειας που είναι φυσιολογικά έχουν πάντοτε φυσιολογικούς απογόνους.31. Ο Mendel επέλεξε για τα πειράματά του το μοσχομπίζελο και συ- νεπώς οι νόμοι που πρότεινε ισχύουν μόνο για τους φυτικούς ορ- γανισμούς.32. Η β-θαλασσαιμία είναι μία ασθένεια που ελέγχεται από πολλαπλά αλληλόμορφα γονίδια.
  • 203. 1. Οι μεταλλάξεις δημιουργούν ένα διαφορετικό φαινότυπο. 2. ( )3. Η χρωμοσωμική ανωμαλία ταυτίζεται με την έννοια της γονιδιακής μετάλλαξης. 4. ( )5. Όλες οι μεταλλάξεις μεταβιβάζονται από τη μια γενιά στην άλλη. 6. ( )7. Η δρεπανοκυτταρική αναιμία οφείλεται σε μία χρωμοσωμική ανωμαλία. 8. ( )9. Μόνο οι μεταλλάξεις των γεννητικών κυττάρων μεταβιβάζονται από τη μια γενιά στην άλλη. 10. ( )11. Η αλλαγή της στερεοδιάταξης της αιμοσφαιρίνης HbA στη δρεπανοκυτταρική αναιμία οφείλεται σε μία μετάλλαξη. 12. )13. Το γεγονός ότι ο γενετικός κώδικας είναι εκφυλισμένος μειώνει την πιθανότητα εμφάνισης των δυσμενών επιπτώσεων μιας μετάλλαξης. 14. (15. . Οι μεγάλης έκτασης αλλαγές στο γονιδίωμα αποτελούν τις χρωμοσωμικές ανωμαλίες. 16.17. Όλες οι μεταλλάξεις είναι βλαβερές. 18. )19. Η μοναδική μονοσωμία που βρέθηκε στον άνθρωπο είναι τοο σύνδρομο Turner. 20. Η έλλειψη γονιδίων α επηρεάζει όλες τις αιμοσφαιρίνες. 21. ( ) 207
  • 204. Να συμπληρώσετε τα κενά1. Οι αλλαγές στην αλληλουχία του DNA ονομάζονται.................... Εάν η αλλαγή αφορά................... αριθμό νουκλεοτιδίων ονομάζεται γονιδιακή.2. Εάν αφορά αλλαγές σε μεγάλο τμήμα του ................... ονομάζεται.................. ανωμαλία.3. Στη δρεπανοκυτταρική αναιμία τα ερυθροκΰτταρα έχουν...................σχήμα. Η αιμοσφαιρίνη S διαφέρει από την αιμοσφαιρίνη Α γιατί το .............................. αντικαθίστασται από................... στη θέση 6.4. Η προσθήκη ενός νουκλεοτιδίου στην αλληλουχία του DNA διαταράσσει το ........................................... των τριπλετών και συνεπώς την αλληλουχία των....................5. Η κύρια αιμοσφαιρίνη κατά την εμβρυϊκή ηλικία είναι η ................... με σύσταση .................... Κατά την ενήλικη ζωή η κύρια αιμοσφαιρίνη είναι η ................... με σύσταση ....................6. Η β-θαλασσαιμία προκαλείται από .......................................................7. Όταν δυο γονείς είναι φορείς της β-θαλασσαιμίας η πιθανότητα να αποκτήσουν παιδί που να πάσχει είναι....................... Όταν ο ένας είναι φορέας της β- θαλασσαιμίας και ο άλλος της δρεπανοκυτταρικής αναιμίας η πιθανότητα να αποκτήσουν παιδί που να πάσχει είναι...........................8. Η γονιμοποίηση μη φυσιολογικών ως προς τον αριθμό χρωμοσωμάτων γαμετών έχει ως αποτέλεσμα τη δημιουργία ................... με λανθασμένη ποσότητα 207
  • 205. γενετικού υλικού. Τα άτομα που προκύπτουν έχουν...................ή ................... μικρού αριθμού χρωμοσωμάτων και ονομάζονται ανευπλοειδή.9. Ο καρυότυπος του φυλετικού ζεύγους χρωμοσωμάτων των ανθρώπων με σύνδρομο Kleinefelter είναι....................... Τα άτομα αυτά παρουσιάζουν χαρακτηριστικά.......................... ατόμου, είναι όμως.........................
  • 206. Θέμα 1ο ΑΠΑΝΤΗΣΗ 207
  • 207. Θέμα 2ο
  • 208. Θέμα 3ο 207
  • 209. ΘΕΜΑ 5Ο 207
  • 211. Θέμα 7οΑ. Στα παρακάτω γενεαλογικά δέντρα μελετάται ο τρόποςκληρονόμησης κοινού μονογονιδιακού χαρακτηρισμού σε δύοδιαφορετικές οικογένειες 1 και 2.Στην 1η οικογένεια φέρουν το χαρακτηριστικό τα άτομα Ι2 , ΙΙ2, ΙΙ3(μαυρισμένα) ενώ στην 2η οικογένεια φέρουν το χαρακτηριστικό ταάτομα ΙΙ2, ΙΙ3 (μαυρισμένα).Να προσδιορίστε τον τρόπο κληρονόμησης του χαρακτηριστικού μεβάση τα παραπάνω στοιχεία, αιτιολογώντας την απάντησή σας με τις 207
  • 212. κατάλληλες διασταυρώσεις (Να μην ληφθεί υπόψη η περίπτωσημετάλλαξης και να μην εξεταστεί η περίπτωση τουφυλισύνδετουεπικρατούς γονιδίου). (μονέδες 8) Να γράψετε τους γονότυπους όλωντων ατόμων. (μονάδες 5)Μονάδες 13Β. Να υποδείξετε ένα πιθανό μηχανισμό που μπορεί να εξηγήσει τηγέννηση ατόμου με σύνδρομο Turner από γονείς με φυσιολογικόαριθμό χρωμοσωμάτων. (μονάδες 6) Να περιγράψετε τη διαδικασία μετην οποία μπορούμε να απεικονίσουμε τα χρωμοσώματα του ατόμουμε σύνδρομο Turner, μετά τη γέννησή του. (μονάδες 6)Μονάδες 12
  • 213. 207
  • 214. ΕΠΑΝΑΛΗΨΗ ΣΤΑ ΚΕΦΑΛΑΙΑ 8 & 9 1. Για τα διαγονιδιακά ζώα ισχύει: α. το γενετικό τους υλικό έχει τροποποιηθεί με την προσθήκη γονιδίων, που προέρχονται πάντα από κάποιο άλλο είδος. β. χρησιμοποιούνται αποκλειστικά για την παραγωγή φαρμακευτικών πρωτεϊνών γ. η σημαντικότερη μέθοδος για τη δημιουργία τους είναι η μέθοδος της μικροέγχυσης δ. όλα τα παραπάνω. 2. Για τη βελτίωση της ζωϊκής παραγωγής: α. επιλέγονται ζώα που έχουν συγκεκριμένα χαρακτηριστικά, και στη συνέχεια διασταυρώνονται β. τροποποιεί το γενετικό υλικό των ζώων με την προσθήκη γονιδίων γ. γονιμοποιείται το ωάριο του ζώου στο εργαστήριο και στη συνέχεια αυτό τοποθετείται στη μήτρα μιας «θετής» μητέρας δ. το α και το β. 3. Η χρησιμοποίηση διαγονιδιακών φυτών και ζώων για την αύξηση της ζωικής και φυτικής παραγωγής, παρουσιάζει έναντι της κλασικής μεθόδου των ελεγχόμενων διασταυρώσεων, τα εξής πλεονεκτήματα: α. επιλογή και προσθήκη μόνο των επιθυμητών ιδιοτήτων με ταυτόχρονη διατήρηση των παλαιών επιθυμητών χαρακτηριστικών β. δημιουργία βελτιωμένων φυτών και ζώων σε μικρό χρονικό διάστημα γ. δυνατότητα μεταβίβασης των νέων ιδιοτήτων στους απογόνους δ. όλα τα παραπάνω ε. τα α και β. 4. Η μικροέγχυση είναι η εισαγωγή: α. ανασυνδυασμένου DNA σε βακτηριακό κύτταρο β. γενετικά τροποποιημένου ιού στα κύτταρα γ. «ξένου» DNA στο γονιμοποιημένο ωάριο ενός ζώου με ειδική μικροβελόνα δ. γενετικά τροποποιημένων κυττάρων στον οργανισμό 5. Ο όρος «gene pharming» σημαίνει: α. τη δημιουργία γενετικά τροποποιημένων ζώων και φυτών β. την παραγωγή φαρμακευτικών πρωτεϊνών από γενετικά τροποποιημένους οργανισμούς γ. την παραγωγή φαρμακευτικών πρωτεϊνών από γενετικά τροποποιημένα ζώα δ. τίποτα από τα παραπάνω 6. Το γενετικά τροποποιημένο καλαμπόκι στο οποίο ενσωματώθηκε το γονίδιο της ανθεκτικότητας στα έντομα: α. ανήκει στις ποικιλίες Βt β. μεταβιβάζει το γονίδιο της ανθεκτικότητας στους απογόνους του
  • 215. γ. όλα του τα κύτταρα περιέχουν το ξένο γονίδιοδ. όλα τα παραπάνω.7. Φορέας κλωνοποίησης μπορεί να είναι:α. ένα κύτταρο-ξενιστήςβ. το γενετικό υλικό ιούγ. το γενετικό υλικό βακτηρίουδ. όλα τα παραπάνω8. Διαγονιδιακά ονομάζονται τα ζώα εκείνα στα οποία έχει τροποποιηθείτο γενετικό τους υλικό:α. με την προσθήκη γονιδίων, συνήθως από κάποιο άλλο είδοςβ. με υπεριώδη ακτινοβολίαγ. με τη χρήση των τεχνικών γενετικής μηχανικήςδ. το α και γ 9.Για τη δημιουργία διαγονιδιακών ή γενετικά τροποποιημένων φυτώνχρησιμοποιείται το βακτήριο:α. Bacillus thuringiensisβ. Escherichia coliγ. Agrobacterium tumefaciensδ. Streptomyces10. Ως φορέας για την εισαγωγή γονιδίων στα φυτά χρησιμοποιείται:α. ο βακτηριοφάγος λβ. ένας αδενοϊόςγ. το πλασμίδιο από Ε. coliδ. το πλασμίδιο Τι11. Τα διαγονιδιακά ζώα:α. προέρχονται από διασταύρωση ατόμων που φέρουν το ξένογονίδιοβ. προέρχονται από το ζυγωτό που φέρει το ξένο γονίδιογ. είναι πανομοιότυπα με τα άτομα από τα οποία προήλθε το ωάριοδ. τα α και β12. Για τη μικροέγχυση ισχύει:α. ότι είναι τρόπος παραγωγής πρωτείνης από ένα κύτταροβ. ότι είναι η είσοδος ξένου DNA στα κύτταρα ενός ζώου με τηχρήση μικροβελόναςγ. ότι είναι μέθοδος κατεργασίας του κυτταρικού τοιχώματος τουβακτηρίου για την είσοδο του DNAδ. όλα τα παραπάνω13. Για την παραγωγή της ATT: 207
  • 216. α. απομονώθηκε το φυσιολογικό γονίδιο της ΑΤΤ από κύτταρα του παγκρέατοςτου ανθρώπουβ. το φυσιολογικό γονίδιο της ΑΤΤ με μικροέγχυση τοποθετήθηκε στο ωάριοπροβάτουγ. το γενετικά τροποποιημένο γονιμοποιημένο ωάριο του προβάτου δίνει έναδιαγονιδιακό ζώοδ. τίποτε από τα παραπάνω
  • 217. Ερωτήσεις Σωστού- Λάθους 1. Η “γονιδιακή θεραπεία” στηρίζεται στην ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA”. 2. Με την ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA παράγονται πολλές πρωτεΐνες αλλά σε μικρές ποσότητες και με μεγάλο κόστος. 3. Η “γονιδιακή θεραπεία”, όταν εφαρμόζεται στο ζυγωτό κύτταρο, δε μεταβιβάζεται στους απογόνους. 4. Η “γονιδιακή θεραπεία”, όταν εφαρμόζεται σε ορισμένα σωματικά κύτταρα ασθενών, δε μεταβιβάζεται στους απογόνους. 5. Τα αντισώματα είναι πρωτεϊνικά μόρια που παράγονται από τα Β λεμφοκύτταρα του ανοσοποιητικού μας συστήματος. 6. Ένας κλώνος Β λεμφοκυττάρων μπορεί να παράγει πολλά διαφορετικά αντισώματα. 7. Το αντίσωμα, που παράγεται από έναν κλώνο Β λεμφοκυττάρων, ονομάζεται μονοκλωνικό. 8. Με τη γονιδιακή θεραπεία αντιμετωπίζονται ασθένειες, που οφείλονται σε μικροοργανισμούς οι οποίοι είναι ανθεκτικοί στα εμβόλια. 9. Τα εμβόλια υπομονάδες στηρίζονται στην παραγωγή μόνο ορισμένων πρωτεϊνών των μικροοργανισμών, που έχουν αντιγονική δράση. 10. Εx vivo γονιδιακή θεραπεία, είναι ο τρόπος θεραπείας κατά τον οποίο τα κύτταρα ενός οργανισμού τροποποιούνται με έξυπνους φορείς μέσα στον ίδιο τον οργανισμό. 11. Η Βιοτεχνολογία συμβάλλει στη διάγνωση, πρόληψη και θεραπεία πολλών ασθενειών. 12. Η ινσουλίνη είναι μια ορμόνη, η οποία παράγεται σε μεγάλες ποσότητες και με μικρό κόστος από την εκχύλιση ιστών παγκρέατος των βοοειδών. 207
  • 218. 13. Τα μονοκλωνικά αντισώματα χρησιμοποιούνται ως διαγνωστικά για την ανίχνευση ασθενειών.14. Τα μονοκλωνικά αντισώματα δεν χρησιμοποιούνται για την καταστροφή καρκινικών κυττάρων, διότι στην εξωτερική επιφάνεια αυτών δεν υπάρχουν αντιγόνα.15. Η χειρουργική επέμβαση για την αφαίρεση καρκινικών κυττάρων είναι προτιμότερη από την καταστροφή αυτών, με τη χορήγηση των κατάλληλων μονοκλωνικών αντισωμάτων.16. Η χημική σύνθεση αντιβιοτικών είναι ευκολότερη και οικονομικότερη από την μικροβιακή σύνθεση αυτών.17. Το DNA δεν είναι δυνατόν να χρησιμοποιηθεί ως εμβόλιο.18. Τα αντιβιοτικά παράγονται από τα Β λεμφοκύτταρα του ανοσοποιητικού μας συστήματος.
  • 219. 1. Οι οργανισμοί που προέρχονται από διασταυρώσεις ονομάζονται διαγονιδιακοί.2. Τα φυτά που έχουν υποστεί γενετική τροποποίηση ονομάζονται διαγονιδιακά.3. Το πλασμίδιο Τι περιέχεται στο βακτήριο Agrobacterium tumefaciens.4. Τα διαγονιδιακά φυτά δεν μεταβιβάζουν τις νέες ιδιότητες στους απογόνους.5. Η εισαγωγή ξένου DNA στα κύτταρα ενός ζώου επιτυγχάνεται με τη μέθοδο της μικροέγχυσης στα ωάρια ενός ζώου. 207
  • 220. 6. Το διαγονιδιακό ζώο μοιάζει με τη “θετή” μητέρα, στην οποία αναπτύχθηκε το έμβρυο. 7. Τα διαγονιδιακά ζώα μπορούν να παράγουν ανθρώπινες πρωτεΐνες 8. Το πλασμίδιο Τι ενσωματώνεται στο γενετικό υλικό των φυτικών κυττάρων. 9. Έχουν παραχθεί ντομάτες που αντέχουν σε πολύ χα θερμοκρασίες. 10. Έχουν εισαχθεί γονίδια στα φυτά, που τα καθιστούν ανθεκτικά στα ζιζανιοκτόνα. 19. Οι ιντερφερόνες είναι πρωτείνες με αντιβακτηριακή δράση.20. Τα Β-λεμφοκύτταρα δεν μπορούν να διατηρηθούν σε κυτταροκαλλιέρ-γειες για μεγάλο χρονικό διάστημα.21. Τα κύτταρα των οργάνων έχουν στην επιφάνεια τους ειδικάαντισώματα επιφάνειας.22. Το γονίδιο που εισάγεται στα κύτταρα με τη βλάβη, στη γονιδιακή θεραπεία, μεταβιβάζεται στους απογόνους.23. Σήμερα έχουν κλωνοποιηθεί περισσότερα από 300 γονίδια φαρμακευτικών πρωτεϊνών.24. Οι ιντερφερόνες είναι αντιϊκοί και πιθανόν αντικαρκινικοί παράγοντες.
  • 221. 25. Αντιγονικός καθοριστής είναι μία μόνο περιοχή του αντιγόνου.26. Η τεχνική ανίχνευσης ουσιών με τη βοήθεια των μονοκλωνικων αντισωμάτων είναι γρήγορη, απλή και ακριβής.27. Για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανάμεσα στα ένζυμα28. που χρησιμοποιούνται περιλαμβάνονται η DNA πολυμεράση , η DNA δεσμάση, η αντίστροφη μεταγραφάση και η RNA πολυμεράση.29. Οι ιντερφερόνες είναι αντιϊκές πρωτεΐνες που παράγονται από κύτταρα που έχουν μολυνθεί από ιούς, παρέχοντας τους αποτελεσματική προστασία έναντι των ιών.30. Για ένα αντιγόνο μπορούν να χρησιμοποιηθούν πολλά διαφορετικά είδη μονοκλωνικών αντισωμάτων.31. To τμήμα του αντιγόνου που αναγνωρίζεται από κάποιο αντίσωμα ονομά ζεται αντιγονικός καθοριστής.32. Τα υβριδώματα δημιουργούνται από την ανάμειξη των Β-λεμφοκυττάρων με καρκινικά κύτταρα.33. To αντίσωμα που παράγεται από μια σειρά παρόμοιων Β-λεμφοκυττάρων και έχει εξειδίκευση για έναν μόνο αντιγονικό καθοριστή, ονομάζεται μονοκλωνικό αντίσωμα.34. Τα μονοκλωνικά αντισώματα χρησιμοποιούνται για την έγκαιρη εξακρίβωση μιας πιθανής κύησης.35. Με τα μονοκλωνικά αντισώματα μπορεί να γίνει έλεγχος συμβατότητας λήπτη και δότη πριν από μία μεταμόσχευση. 207
  • 222. 36. Τα μονοκλωνικά αντισώματα χρησιμοποιούνται ευρύτατα για την έγκαιρη διάγνωση μιας ασθένειας.37. Η προϊνσουλίνη είναι μια πολυπεπτιδική αλυσίδα.
  • 223. 207