• Like
Hépatite C_ stratégie diagnostique et suivi virologique.ppt
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

Hépatite C_ stratégie diagnostique et suivi virologique.ppt

  • 3,539 views
Published

S. Chevaliez

S. Chevaliez

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
No Downloads

Views

Total Views
3,539
On SlideShare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
203
Comments
0
Likes
1

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. HEPATITE C Stratégie Diagnostique & Suivi Virologique
  • 2. Marqueurs Virologiques Stratégie diagnostique & suivi virologique Marqueurs indirects Anticorps anti-VHC totaux Marqueurs directs Ag de capside (AgC) ARN VHC Génotype VHC Profil de résistance
  • 3. Tests Sérologiques Stratégie diagnostique & suivi virologique
    • Détection et quantification de l’Ag de capside
    • Test “Combo”
      • Détection simultanée de l’Ag de capside et des anticorps anti-VHC
    • Détection des anticorps anti-VHC à l’aide d’une trousse de 3 ème génération
  • 4. Antigène de Capside : un Marqueur de la Réplication Bouvier-Alias et al., Hepatology 2002, 36(1): 211-218. Stratégie diagnostique & suivi virologique r = 0.92; p < 0.0001
  • 5.
    • Spécificité
      • 99,2% à 100%
    • Sensitivité
      • ≤ 10 fmol/L (i.e ~ 500 to 3 000 UI/mL d’ARN VHC)
      • Tous les génotypes (excepté génotype 2)
    • Intervalle de quantification
      • 10 à 20 000 fmol/L (≤ 7,8 Log 10 UI/mL d’ARN VHC)
    • Stable à 37°C pendant 96 heures
    Performances Analytiques de la Trousse Architect (Abbott) Ross et al., J Clin Micribiol 2010, 48(4): 1161-8; Mederacke et al., J Clin Virol 2009, 46(3): 210-5; Miedouge et al., J Clin Virol 2010, 48(1):18-21. Stratégie diagnostique & suivi virologique
  • 6. Trousse Architect : Monitoring des Cinétiques Virales RVR (G1b) SVR (G1b) Relapser (G1b) NR (G1a) Ross et al., J Clin Microbiol 2010, 48(4): 1161-8. Stratégie diagnostique & suivi virologique Core Ag RNA
  • 7. Intér êts Cliniques de la Quantification de l’AgC
    • Diagnostic de l’infection
      • Trousses commerciales
      • Facile à utiliser, automatisée, peu couteux (20% par rapport à une charge virale VHC)
    • Décision de traiter et suivi de l’efficacité des traitements antiviraux
      • Quantitatif (≤20,000 fmol/L*)
      • Alternative aux techniques de détection quantification de l’ARN du VHC
    (*Abbott Architect HCV Ag Assay) Stratégie diagnostique & suivi virologique
  • 8. Tests Virologiques Moléculaires Stratégie diagnostique & suivi virologique Tests quantitatifs Seuil de détection ≥ qualitatifs Quelle quantité est présente ? Tests qualitatifs Très sensibles (  50 IU/mL) Est-ce que le VHC est présent ? Détermination du Génotype Quel est le génotype du virus ? Détection de la résistance Quel type de VHC est présent ?
  • 9. Tests Virologiques Moléculaires Stratégie diagnostique & suivi virologique Est-ce que le VHC est présent et en quelle quantité ? Tests Qualitatifs-Quantitatifs Détermination du Génotype Quel est le génotype du virus ? Détection de la résistance Quel type de VHC est présent ?
  • 10. Intervalle de Quantification Stratégie diagnostique & suivi virologique 10 10 2 10 3 10 4 10 5 10 6 10 7 10 8 Cobas Amplicor HCV Monitor v2.0 SuperQuant LCx HCV RNA Assay Versant HCV RNA 3.0 (bDNA)
  • 11. Avantages Techniques de la PCR en Temps Réel
    • Diminution du risque de contamination
    • Amélioration de la sensibilité
    • Augmentation de l’intervalle de quantification linéaire
    • Amélioration précision et reproductibilité
    • Augmentation de débit à travers l’automatisation
    Stratégie diagnostique & suivi virologique
  • 12. Intervalle de Quantification Stratégie diagnostique & suivi virologique 10 10 2 10 3 10 4 10 5 10 6 10 7 10 8 *in development TaqMan 48 HCV (Roche) HCV Quant ASR (Abbott) Artus HCV QS-RGQ (Qiagen)* Versant HCV RNA 1.0 (kPCR, Siemens)* Cobas Amplicor HCV Monitor v2.0 SuperQuant LCx HCV RNA Assay Versant HCV RNA 3.0 (bDNA)
  • 13. Plates-formes CAP-CTM96 (ROCHE) kPCR (SIEMENS) m 2000 SP - m 2000 RT (ABBOTT) Stratégie diagnostique & suivi virologique
  • 14.
    • Remplace les techniques qualitatives de détection de l’ARN VHC
    • Quantifie l’ensemble des charges virales observées en pratique clinique
      • Charges élevées préthérapeutiques
      • Faibles charges virales au cours du traitement
    • Surveille efficacement les cinétiques virales (évaluation précoce des réponses virologiques au traitement)
    Avantages Cliniques de la PCR en Temps Réel Stratégie diagnostique & suivi virologique
  • 15. Stratégie diagnostique & suivi virologique Quantification ARN du VHC (CTM, Roche) Chevaliez et al., 2007; Hepatology, 46(1): 22-31. HCV RNA level in Versant HCV 3.0 Assay bDNA (Log 10 IU/mL) r = 0.889; p < 0.0001 HCV RNA level in CAP/CTM48 (Log 10 IU/mL) Genotype 1 (n=29) Genotype 2 (n=27) Genotype 3 (n=29) Genotype 4 (n=30) Genotype 5 (n=9) Genotype 6 (n=2) 8 7 6 5 4 3 8 7 6 5 4 3
  • 16. 80 90 100 110 120 130 140 150 160 170 180 |.........|.........|.........|.........|.........|.........|.........|.........|.........|.........| F_7157 (4a): TAGCCATGGCGTTAGTATGAGTGTTGT G CAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGT A CACCGGAATCGCCGG Patient 1 (4h): ...........................A.....................................A...................T............... Patient 2 (4l): ...........................A.....................................A...................T............... 190 200 210 220 230 240 250 260 270 .........|.........|...... - ...|.........| .........|.........|.........|.........| .........|........ F_7157 (4a): GATGACCGGGTCCTTTCTTGGA T T A A - CCCGCTCAATGCCCGGAAATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCC Patient 1 (4h): ......................A.T.A.......................................................................... Patient 2 (4l): .......................C..-.......................................................C.......T.......... 280 290 300 310 320 330 340 |.........|.........|.........|.........|.........|.........|. F_7157 (4a): TTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACC Patient 1 (4h): ............................................................. Patient 2 (4l): ............................................................. Chevaliez et al., 2008; Hepatology, 49(4): 1397-1398. Stratégie diagnostique & suivi virologique Absence de Détection de l’ARN Viral de patients Fortement Virémiques Infectés par un Génotype 4 (Log 10 IU/mL) CAP/CTM96 m 2000 SP / m 2000 RT Versant 3.0 Patient 1 (4h) <1.08 5.4 5.0 Patient 2 (4l) <1.08 6.0 5.7
  • 17. Quantification de Transcrits d’ARN Sauvages ou Mutés en Position 145 et/ou 165 Chevaliez et al., Hepatology, 2009, 50(5): 1681. *Target not detected Stratégie diagnostique & suivi virologique 5.95±0.25 5.88±0.20 6.00±0.11 6.05±0.10 m 2000 6.60±0.18 <1.08* Double mutant (G145 A and A165 T ) 6.30±0.02 4.28±0.35 Single mutant (G145 and A165 T ) 6.69±0.02 4.02±0.13 Single mutant (G145 A and A165) 6.43±0.01 5.73±0.13 Wild-type (G145 and A165) Versant 3.0 CTM bDNA assay Real-time PCR assays Measured HCV RNA levels (Log 10 IU/mL) HCV 5’NC sequence
  • 18. Stratégie diagnostique & suivi virologique Quantification ARN du VHC ( m 2000, Abbott) Chevaliez et al., J Clin Microbiol, 2009 ,47(6):1726-32 . r = 0.972; p < 0.0001 HCV RNA level in m 2000 SP / m 2000 RT (Log 10 IU/mL) HCV RNA level in Versant HCV 3.0 Assay bDNA (Log 10 IU/mL) 8 7 6 5 4 3 8 7 6 5 4 3 Genotype 1 (n=55) Genotype 2 (n=21) Genotype 3 (n=29) Genotype 4 (n=24) Genotype 5 (n=9) Genotype 6 (n=3)
  • 19. Stratégie diagnostique & suivi virologique Quantification ARN du VHC (kPCR, Siemens) David Sherman., Molecular Symposium, September 2007 (source: Siemens Medical Solutions Diagnostics). 132 clinical samples
  • 20.
    • En pratique clinique, la quantification de l’ARN du VHC doit être réalisée à l’aide d’une technique de PCR en temps réel
      • Avec une limite de détection de l’ordre de 10 à 15 UI/mL
    Stratégie diagnostique & suivi virologique Résumé
  • 21. Génotypes du VHC Simmonds et al. Hepatology 2005. Stratégie diagnostique & suivi virologique
  • 22. Répartition des Génotypes Stratégie diagnostique & suivi virologique Adapted from Fang J., et al. J. Clin Liver Dis., 1997. 1a,
  • 23. Détermination du Génotype
    • Méthodes moléculaires (genotyping)
      • Analyse de la séquence après séquençage direct
      • Hybridation inverse des produits d’amplification sur des supports solides comportant des sondes génotype sépcifique : Line Probe Assay (INNO-LiPA HCV, Innogenetics)
      • PCR en temps réel à l’aide d’amorces et de sondes génotype spécifique
    • Méthodes sérologiques (“serotyping”)
      • ELISA compétitif
    Arens et al., J Clin Virol, 2001; 22:11-29; Davidson et al., J Gen Virol 1995; 76: 1197-204; Lareu et al., 1997; Le Pogam et al., 1998; J Clin Microbiol; 36: 1461-3; Ilina et al., J Clin Miocrobiol, 2005; 43(6): 2810-15. Stratégie diagnostique & suivi virologique
  • 24. Arens et al., J Clin Virol, 2001; 22:11-29; Davidson et al., J Gen Virol 1995; 76: 1197-204; Lareu et al., 1997; Le Pogam et al., 1998; J Clin Microbiol; 36: 1461-3; Ilina et al., J Clin Miocrobiol, 2005; 43(6): 2810-15.
    • Méthodes moléculaires (genotyping)
      • Analyse de la séquence après séquençage direct
      • Hybridation inverse des produits d’amplification sur des supports solides comportant des sondes génotype sépcifique : Line Probe Assay (INNO-LiPA HCV, Innogenetics)
      • PCR en temps réel à l’aide d’amorces et de sondes génotype spécifique
    • Méthodes sérologiques (“serotyping”)
      • ELISA compétitif
    Détermination du Génotype Stratégie diagnostique & suivi virologique
  • 25. Versant ® HCV Genotype 2.0 Assay (INNO-LiPA) Stratégie diagnostique & suivi virologique
  • 26. Intérêt de la Détermination du Sous-Type ?
    • Direct Acting Antivirals (DAAs) pourraient avoir des efficacités antivirales différentes selon les sous-types de VHC de génotype 1 in vitro et in vivo
    • Le traitement par DAAs pourrait être associé à des profiles de résistance différents selon les sous-types de VHV de génotype 1 in vitro et in vivo
    Stratégie diagnostique & suivi virologique
  • 27. Profils de Résistance du BMS-70052, in vitro Fridell et al. Antimicrob Agents Chemother. 2010; 54(9): 3641-50 Stratégie diagnostique & suivi virologique Substitution amino acidique EC50 fold-change Niveau de Replication (%) Génotype 1b L31 F /V 5-23 146±44 P32L 17 18±6 Y93H/N 19-28 20 ±7 Génotype 1a M28T 683 31±23 Q30E/H/R 1 450-24 933 130±56 L31 M /V 350-3 350 117±29 P32L 233 18±5 Y93 C /H/N 1 850-47 017 18±11
  • 28. Profils de Résistance du Telaprevir (PROVE-2 trial), in vivo Génotype 1b Génotype 1a Chevaliez et al. International HIV&HEPATITIS VIRUS Drug Resistance Workshop and Curative Strategies 2010 . Stratégie diagnostique & suivi virologique Pt-1 Pt-2 Pt-3 Pt-4 Pt-5 Pt-6 R26K V36L/M V36A V36A T42S A40T A40T T54S T54S T54A Y56F T91A R155K R155K R155K /E R155T/A G174S
  • 29. Détermination du Sous-Type par une Méthode de Référence* *HCV genotype determination by means of phylogenetic analysis of a portion of the gene encoding the NS5B region was used as the reference method Chevaliez et al., PLoS One 2009, 4(12): e820. Stratégie diagnostique & suivi virologique
  • 30. Détermination du Sous-Type Chevaliez et al., PLoS One 2009, 4(12): e820. 1 st Generation of Line Probe Assay (LiPA 1.0) 2 nd Generation of Line Probe Assay (LiPA 2.0) RealTi m e HCV Genotype II Sequence Analysis of the 5’NCR GT 1a (n=237) GT 1b (n=263) 77.6% (n=184) 90.5% (n=238) 70.5% (n=167) 91.3% (n=240) 97.5% (n=231) 96.2% (n=253) 93.2% (n=220) 88.6% (n=233) Stratégie diagnostique & suivi virologique
  • 31.
    • Dans les essais cliniques évaluant les DAAs et probablement en pratique clinique, le détermination du sous-type des souches de génotype 1 est nécessaire pour la stratification et l’interprétation des profils de résistance
    • La détermination du génotype sur la seule région 5’NC doit être proscrite
    • La 2 nd génération de Line Probe Assay qui utilise des sondes dirigées contre la région core en plus de la région 5’NC est la meilleure méthode permettant de distinguer les sous-types 1a et 1b
    Résumé Stratégie diagnostique & suivi virologique
  • 32. rs12979860 En amont du géne de l’IL28B, codant l’IFN-  3 Ge et al., Nature 2009; 461: 399-401. IL28B “Single Nucleotide Polymorphism” (SNP) Stratégie diagnostique & suivi virologique
  • 33. Réponse virologique soutenue (%) Thompson et al., Gastroenterology 2010; 139(1): 120-129. RVS à la Bithérapie Standard en Fonction du Génotype IL28B Stratégie diagnostique & suivi virologique Caucasians (n=1171) African-Americans (n=300) Hispanics (n=116) Combined (n=1587) 51% 37% 12 49% 14 37% 48% 29% 22%
  • 34.
    • En pratique clinique, SNPs en amont du gène de l’ IL28B (rs12979860 et rs8099917) sont les facteurs prédictifs les plus robustes de la RVS à la bithérapie
    • Cependant, leur valeur prédictive à l’échelon individuel n’est pas suffisante pour la prise en compte dans les décisions thérapeutiques
    • La détermination du génotype IL28B en association à d’autre paramètres, comme la réponse virologique à S4, pourrait être utile pour adapter le traitement, éventuellement des patients sous triple combinaison
    Ge et al., Nature 2009; 461: 399-401; Tanaka et al., Nat Genet 2009; 41(10): 1105-9; Afdhal et al, Hepatology in press . Stratégie diagnostique & suivi virologique Résumé
  • 35. Intér êts des Tests Virologiques en Thérapeutique Consensus conference: treatment of hepatitis C; 2002, Gastroenterol Clin Biol, 26(2): B303-20
    • Décision de traiter
    • Optimisation du schéma thérapeutique
    • Etude de la réponse virologique au traitement
    Stratégie diagnostique & suivi virologique
  • 36. Traitement de l’Hépatite Chronique C
    • Traitement standard
      • Interféron pégylé alpha-2a or alpha-2b et ribavirine à doses fixe ou adaptée au poids
    • Durée de traitement
      • 16 à 72 semaines en fonction du génotype et de la réponse virologique
    Stratégie diagnostique & suivi virologique
  • 37. Intér êts de la Détermination du Génotype
    • Détermination systématique du génotype
      • Facteur prédictif de la réponse au traitement
      • Conditionne
        • . La dose de ribavirine
        • . La durée du traitement
    Stratégie diagnostique & suivi virologique
  • 38. Dose de Ribavirine Stratégie diagnostique & suivi virologique Ribavirine 0,8 g/j Ribavirin 1,0 – 1,2 g/j Hadziyannis et al., Ann Intern Med 2004;140: 346-355. Proportion de patients avec RVS (%)
  • 39. Durée de Traitement Stratégie diagnostique & suivi virologique Hadziyannis et al., Ann Intern Med 2004;140: 346-355. 24 semaines 48 semaines Proportion de patients avec RVS (%)
  • 40. Intér êts de la Détection - Quantification de l’ARN VHC
    • Evaluation de la réplication virale chez des patients anticorps anti-VHC positifs
    • Evaluation de la réponse virologique au cours du traitement pegIFN - RBV
      • Réponse virologique rapide (semaine 4)
      • Réponse virologique précoce (semaine 12)
      • Réponse fin de traitement (EoT)
      • Réponse virologique soutenue (semaine 24 post-Rx)
    Stratégie diagnostique & suivi virologique
  • 41. Réponses au Traitement en Fonction des Cinétiques Virales 0 4 8 12 Semaines Detection cut-off (10-15 IU/mL) -6 -5 -4 -3 -2 -1 0 +1 HCV RNA reduction from baseline (Log 10 IU/mL) SOC Stratégie diagnostique & suivi virologique Diminution ≥ 2 Log
  • 42. Réponse Virologique Précoce : Facteur Prédictif de la RVS EoT RVS Rechute Adapted from Ferenci et al., J Hepatol 2005, 43: 425-433. Diminution >2 Log ou ARN indétectable à S12 Diminution <2 Log à S12 Stratégie diagnostique & suivi virologique
  • 43. Réponses au Traitement en Fonction des Cinétiques Virales 0 4 8 12 Semaines RVR Slow VR RVP SOC 2 Detection cut-off (10-15 IU/mL) -6 -5 -4 -3 -2 -1 0 +1 HCV RNA reduction from baseline (Log 10 IU/mL) Diminution ≥ 2 Log Stratégie diagnostique & suivi virologique
  • 44. Taux de RVS SVR 43/45 38/42 37/44 64/72 33/41 62/83 227/300 234/292 250/355 68/156 77/157 72/203 542/1019 500/1016 667/1035 406/1019 386/1016 423/1035 Semaines avec un ARN du VHC indétectable Week to first undetectable HCV RNA ViraferonPeg 1.5µg/kg/w + RBV 1000-1400 mg/d ViraferonPeg 1.0µg/kg/w + RBV 1000-1400 mg/d PegIFN alpha-2a 180µg/w + RBV 1000-1200 mg/d McHutchinson et al., New Engl J Med 2009, 361(6): 580-593. Stratégie diagnostique & suivi virologique
  • 45. Longer Treatment Duration Genotype 1, Slow virological responders >2 Log drop at week 12, but detectable HCV RNA Berg et al., Gastroenterology 2006, 130: 1086-97. 48 weeks 72 weeks HCV RNA <50 IU/mL HCV RNA >50 IU/mL 34/51 27/35 104/130 90/119 78/179 94/190 17/100 31/106 p =0.040 121/230 121/225 Rate of SVR (%) Stratégie diagnostique & suivi virologique
  • 46. Genotype 1 and 4, Slow virological responders >2 Log drop at week 12, but detectable HCV RNA Ferenci et al., Gastroenterology 2010, 138: 503-512. HCV RNA <50 IU/mL Rate of relapse (%) HCV RNA >50 IU/mL p <0.01 p <0.05 48 weeks 72 weeks 20/35 9/29 16/72 11/81 Longer Treatment Duration Stratégie diagnostique & suivi virologique
  • 47. Shorter Treatment Duration
    • A recent meta-analysis suggested that
      • In patients infected with HCV genotype 1 with an RVR, 24 weeks of therapy with SOC should be considered only in subjects with low baseline viral loads
      • The optimal cut-off defining low baseline HCV RNA level (400,000-800,000 IU/mL) is not clearly defined
    Moreno et al., J Hepatol 2010; 52: 25-31. Stratégie diagnostique & suivi virologique
  • 48. Shorter Treatment Duration Genotype 2 and 3, Rapid virological responders (<50 IU/mL at week 4) Rate of SVR (%) 16 weeks 24 weeks p <0.001 p <0.001 375/458 368/405 197/243 115/212 181/215 174/193 Diago et al., Hepatology. 2010; 51(6): 1897-903. Stratégie diagnostique & suivi virologique
  • 49. Shorter Treatment Duration Genotype 2 and 3, Rapid virological responders with a low baseline viral load (<400,000 IU/mL) Rate of SVR (%) 16 weeks 24 weeks p =0.20 111/122 95/100 Diago et al., Hepatology. 2010; 51(6): 1897-903. Stratégie diagnostique & suivi virologique
  • 50. HCV genotype HCV-1 (4,5,6) RNA quantification HCV-2,3 SOC 24 weeks Ribavirin (800 mg.d -1 ) SOC 48 weeks Ribavirin (1000-1400 mg.d -1 ) Decrease < 2 Log Decrease  2 Log HCV RNA detectable Stop antiviral treatment Continue Rx until W24 If HCV RNA undetetectable Continue Rx Until W72 Decrease  2 Log HCV RNA undetectable Continue Rx until W48 RNA quantification at W4 HCV RNA undetectable HCV RNA detectable Continue Rx until W24 Consider 16 weeks of therapy 2 1 In patients with a low viral load at baseline (<400,000 IU/mL); 2 In patients with a low viral load at baseline (400,000-600,000 IU/mL) RNA quantification at W4 RNA quantification at W12 HCV RNA undetectable HCV RNA detectable Consider 24 weeks of therapy 1
  • 51. Future HCV Therapy
    • Future standard treatment
      • Pegylated interferon alpha-2a or alpha-2b
      • Ribavirin
      • Specific inhibitor of the NS3/4A protease
        • . Telaprevir
        • . Boceprevir
    Stratégie diagnostique & suivi virologique
  • 52. Weeks on therapy T12PR N = 363 T8PR N = 364 PR48 N = 350 36 0 24 12 TVR +PR Follow-up 48 TVR+PR PR PR Follow-up 60 72 8 PR Follow-up no eRVR PR Follow-up PR Follow-up no eRVR *eRVR = undetectable HCV RNA at week 4 and week 12 ADVANCE Trial Telaprevir, Naïve, Genotype 1 Jacobson et al., AASLD 2010, Abstract 211. Stratégie diagnostique & suivi virologique
  • 53. p <0.0001 Proportion of Patients with SVR (%) p <0.0001 SVR Rates Jacobson et al., AASLD 2010, Abstract 211. Stratégie diagnostique & suivi virologique
  • 54. SPRINT-2 Trial Boceprevir, Naïve, Genotype 1 Weeks on therapy 36 0 24 12 48 60 72 *VR = HCV RNA undetectable between weeks 8 and 24 BOC + PR Follow-up PR LI Follow-up 4 Follow-up PR Follow-up no VR BOC+ PR LI VR 28 BOC/RGT N = 368 BOC/PR48 N = 366 PR48 N = 363 Poordad et al., AASLD 2010, Abstract LB-4. Stratégie diagnostique & suivi virologique
  • 55. Poordad et al., AASLD 2010, Abstract LB-4. Taux de RVS How to use molecular techniques to optimize management of chronic heptitis C p <0.0001 Proportion of Patients with SVR (%) p <0.0001
  • 56. Résumé
    • Duration of triple therapy with pegylated IFN, ribavirin and a protease inhibitor will be tailored to the virological response at week 4 or earlier
    • Response-guided therapy is associated with high rates of SVR in genotype-1 treatment na ïve patients
    • The ideal time points, frequency, and the feasibility in real-life practice need to be further evaluated
    Stratégie diagnostique & suivi virologique