Your SlideShare is downloading. ×
0
Natural history of hepatitis B                                                         Acute infection    Resolved    infe...
Déclaration obligatoire       de l’hépatite B en France : résultats des 12 premiers mois de notificationDenise Antona, E D...
Incidence of acute hepatitis B in France                Sentinel networks 1991-1996 et Lyon (COURLY) 1983-1997            ...
Circuit de l’information                               Feuillets 2 et 3                   Médecin    Biologiste           ...
Results
Age distribution: comparison of the different periods          1991-94 versus 03/2003 - 02/2004% de cas40%         years 1...
Risk exposure within 6 months preceding the acute case        Source : obligatory declaration 2003-04
Hépatites virales B: épidémiologie- Vaccin mais 400 millions de porteurschroniques dans le monde-  280 000 porteurs chroni...
LE VIRUS DE L ’HEPATITE B	•  FAMILLE : Hepadnaviridae, seul représentant humain•VIRUS RESISTANT :      - 7 jours dans l’en...
HBsAgfilament                                    S       small surface protein                           sphere           ...
The HBV genome                 Tiollais, Nature 1985
The viral replication cycleZoulim & Locarnini, Gastroenterology 2009
Réplication du génome viral. Implication pour la 	         persistance virale et l’intégration du génome viral	           ...
The animal models of HBV infection                   Transgenic mice                   Humanized mice                     ...
HIV              HCV               HBV                      (Ritonavir )       (IFN- )         (Lamivudi n e )Plasma virus...
HBV replication and its role in HCC development	                                             Wands, NEJM 2004
Role du VHB dans l’oncogénèse hépatique                                              !                 REACTION INFLAMMATO...
Immunopathology
The level of viral antigen presented by hepatocytes              influences CD8 T-cell function•  Hepatocyte antigen prese...
Wieland S et al, PNAS 2004
10 3      10 4          10 310 2          10 210 1          10 110 0          10 010 -1     -2          10 -110          1...
Inactive HBV carrier                   ●  Not virologically inactive:                                      –  low levels o...
HISTOIRE NATURELLE ET  VIROLOGIE CLINIQUE
Seeger, Zoulim, Mason;Fields Virology; 2007
HEPATITE B AIGUE
Laboratory Diagnosis of Acute Hepatitis B                                                          HBsAg                  ...
HEPATITE B PROLONGEE
Laboratory Diagnosis of Chronic Hepatitis B                                                associated with wild type virus...
Laboratory Diagnosis of Transition of Chronic                                                 Hepatitis B to The inactive ...
Laboratory Diagnosis of HBeAg negative                                                              Chronic Hepatitis B   ...
1000                                                                           ALAT9 log                                  ...
Dynamic ranges of quantification                          of HBV DNA assaysAmplicor HBV Monitorv2.0 (Roche)HBV Hybrid-Capt...
Formes cliniques
Pathophysiologic Cascade of                Chronic HBV InfectionAdapted from: Lavanchy D. Journal of Viral Hepatitis, 2004...
Charge virale et incidence de la cirrhose                                    .4                                           ...
Survie chez les patients au stade cirrhose                                      100              Patients Surviving, %    ...
AgHBeAg et risque de CHC   •  11,893 Taiwanese men; 92,359 person-years      follow-up                                    ...
Charge virale et incidence du CHC                        Chen et al; JAMA 2006
REVEAL-Incidence of HCC                         Increases with Increasing HBV DNA                                 Baseline...
High Baseline Serum HBV DNA Levels are     Associated with Increased Risk of HCC Mortality               in HBsAg-Positive...
Relationship Between Persistent Viremia and HCC:                         Argument For Antiviral Therapy           •       ...
Impact Clinique de la Variabilité       du Génome Viral
B6     D1      World J Gastroenterol 2007; 13: 14-21
Zoulim et al J Viral Hepatitis 2006
Impact du génotype sur la                                                       séroconversion                            ...
HBeAg and Precore Mutation                  G 1896A = stop codon, TAG            ATG          ATGCore gene
HBeAg and Precore Mutation              ATG     ATGCore gene
Main pre-c/core promoter mutations observed in vivo                                              Basic core promoter	     ...
2500200015001000 500   0   temps100 80 60 40 20  0    temps
Outcome of Chronic Anti-HBe Positive Hepatitis B400300200100  0400300200100  0400300200100  0
Augmentation de prévalence des hépatites     chroniques avec AgHBe négatif en France                            62%       ...
Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
Pichoud et al, J hepatol 200025                                      10000000000                                        10...
PreS2                                                                                      PreS1            HBs Ag        ...
Occult HBV Infection (OBI) Presence of HBV DNA in the liver (± serum) ofindividuals testing HBsAg negative by currently   ...
How to Detect Occult HBV Infection     Currently there is no standardized  diagnostic assay for occult HBV infection
Reported Prevalence of Occult HBV Infection in HIV Positive Patients                                                     O...
Cause(s) for the        failure of HBsAg detection      OBI                “false” OBI  Suppression of                    ...
Occult HBV Infection Is Associated to Hypermethylated and Deacetylated                     HBV cccDNA-bound histones      ...
HBV replication	                         HBV cccDNA	                        Integrated HBV DNA	           HBV mutants	    ...
Schematic representation of HBV serum marker profile in OBI and                          “false” OBI                      ...
Occult hepatitis BTorbenson M. & Thomas D.L., Lancet Inf Dis, 2002
Occult HBV infections: unresolved issues                                    Diagnostic  Specific                          ...
HBsAg	                            Immuno-active   Inactive phase                                      Occult infectionImmu...
Endpoints of therapyPersistence of high viral load is associated with a significant risk of progression of                ...
Antivirals approved for hepatitis BDrug Type                             Approved                 Phase 3             Phas...
Treatment failurePrimary non response                        Secondary treatment failurePartial response                  ...
Clinical definition of resistance•  Virologic Breakthrough: Rebound in serum HBV DNA levels   (e.g. 1 log10 above nadir)• ...
Laboratory Definition of HBV Resistance to AntiviralsLaboratory Investigations•  Phenotypic Resistance: Decreased suscepti...
The main differences between HIV,                      HBV and HCV                 HIV1                                   ...
Kinetics of emergence of HBV drug resistant mutantsSi Ahmed et al. Hepatology. 2000; Yuen et al Hepatology 2001; Locarnini...
Lamivudine Resistance Accelerates                                         Progression of Liver Disease                    ...
Biochemical and Histologic               Correlates of HBV Resistance  •  Rise in ALT levels        –  Mild ALT elevations...
ALT flares in patients with lamivudine         resistance over time                          Lok et al Gastroenterology 20...
Incidence of drug resistance over time                                          Resistance at year of therapy expressed as...
Zoulim & Locarnini, Gastroenterology, 2009
Determinants of viral persistenceZoulim & Locarnini, Gastroenterology, 2009
Bridges; Progress in Liver Disease 1995
The HBV life cycle                                            Nucleos(t)ide analogsZoulim & Locarnini, Gastroenterology 2009
uncoating!             CCC DNA!                   supercoiled DNA!                                                  minich...
Can we prevent cccDNA formation ?Nucleoside analogs in monotherapy orcombination therapy cannot prevent the denovo formati...
Zhu et al, J Virol 2001
ADV Associated Serum HBsAg Reductions are Similar in Magnitude to cccDNA Reductions                                      S...
Kinetics of spread and emergence of drug   resistant virus during antiviral therapy                                       ...
Kinetics of HBV drug resistance emergence                                                                                 ...
Partial response to adefovir dipivoxil is not due to the                       selection of DR mutants•       The top 25% ...
Amino acid substitutions result in conformation   changes of the polymerase catalytic site  Wild-type M204/L180           ...
Definition of fitness•  A parameter that quantifies the adaptation of an   organism or a virus to a given environment•  Fo...
Cross-resistance data for the main mutants                     and the commercially available drugs Pathway            Ami...
Archiving of viral variants                                                                                    Viral quasi...
Archiving of viral variants                                                                                     Viral quas...
Archiving of viral variants                                                                                     Viral quas...
Phenotyping of HBV clinical isolates                                                                                      ...
Maximising the barrier to resistance                                                                                     W...
Can we detect low frequency mutants prior to or                     during therapy ?Use of pyrosequencing to detectlow fre...
Important factors involved in selection of                   MDR mutants•  Use of inadequate sequential monotherapies and ...
The problem of sequential therapy with              nucleoside analogues                                                  ...
Drugs sharing cross-resistance characteristics:                                   Switching strategy  emergence of MDR mu...
Genotypic analysis of the viral quasi-species during lamivudine and entecavir therapy                                     ...
Role of cross-resistance, inefficacy of viral load suppression,      and replication space, in MDR mutant selection       ...
Lamivudine+adefovir treatment (months)      Accumulation of mutations and selection of a complex mutant                   ...
A single a.a. substitution at position rt181 may be                    responsible for multidrug resistanceLVD            ...
Impact on virus infectivity and fitnessImpact on virion release (intracellular       retention) and virologic monitoring o...
Potential risk of transmission of HBV DR mutantsClements et al, Bull WHO 2009
Conclusions – Main issues regarding      viral resistance and persistence1) Persistence of cccDNA      A major driver of v...
Management algorithm                                  Antiviral treatment                                                 ...
Management algorithm     Antiviral treatment                                     Viral load asssessment   Treatment respon...
Virologic Consequences of Persistent Viremia    Infection of new hepatocytes      slower kinetics of clearance infected ...
Comment adapter le traitement ?        Wild type                                 LAM                                    AD...
Patients with lamivudine resistance:                                                                     adefovir add-on s...
The problem of sequential therapy                          and switching strategy                                LAM      ...
Rescue therapy in patients with clinical breakthrough                                                         Drug ASerum ...
Rescue therapy in patients at the time of virologic breakthrough                                                          ...
Early add-on therapy to prevent drug resistance                                                             Drug A   Serum...
Very Early Add-on Therapy to Keep Viral         Load as Low as Possible1. Start with a drug having a high genetic barrier ...
Rationale for de novo Combination TherapyDrug B                                                       Drug Aresistantmutan...
De novo combination therapy to prevent drug resistance                                                            Drug A  ...
Preventing L-Nucleosides Resistance     with de novo Combination Therapy                                       100        ...
Study 106 – Treatment-Experienced Patients                                                                                ...
Study 106 – Treatment-Experienced Patients                                                                                ...
Study 106 – Treatment-Experienced Patients                               ‡Mean HBV DNA (log10c/mL) by Study Visit   Mean (...
Study 106 – Treatment-Experienced Patients   ‡                         Mean HBV DNA                 by Baseline LAM-R and ...
Study 106 – Treatment-Experienced Patients   ‡                         Mean HBV DNA                 by Baseline ADV-R and ...
Viral load                           100%                           90%                           80%                     ...
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Hépatite B.pdf
Upcoming SlideShare
Loading in...5
×

Hépatite B.pdf

3,178

Published on

F. Zoulim

1 Comment
2 Likes
Statistics
Notes
No Downloads
Views
Total Views
3,178
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
276
Comments
1
Likes
2
Embeds 0
No embeds

No notes for slide

Transcript of "Hépatite B.pdf"

  1. 1. Natural history of hepatitis B Acute infection Resolved infection Chronic infection: 400 million carriers ! 5% neonates 90% adults Chronic hepatitis Wild type virus HBeAg+ Pre-core mutant HBeAg- Inactive carrier Immune tolerance Reactivation Cirrhosis30-50 years Hepatocellular carcinoma Seeger, Zoulim, Mason; Fields Virology; 2007
  2. 2. Déclaration obligatoire de l’hépatite B en France : résultats des 12 premiers mois de notificationDenise Antona, E Delarocque-Astagneau, D Lévy-Bruhl département des maladies infectieuses
  3. 3. Incidence of acute hepatitis B in France Sentinel networks 1991-1996 et Lyon (COURLY) 1983-1997 25 20Taux /100 000 15 10 5 0 1983 1985 1987 1989 1991 1993 1995 1997 COURLY Réseau "Sentinelles"
  4. 4. Circuit de l’information Feuillets 2 et 3 Médecin Biologiste à compléter prescripteur Feuillet 1 : Relance Feuillet 2 : parties 1-2 et parties 3-4-5 6-7 renseignées MISP de DDASS du complétées département d’exercice Feuillets 1 et 2 complétés et validés InVSFiche de notification autocopiante à 4 feuilletsPartie 1 : code d’anonymat irréversible, caractéristiques du patientPartie 2 : information biologiqueParties 3-4-5 : information clinique et épidémiologiqueParties 6-7 : identification du médecin prescripteur et du biologiste déclarants
  5. 5. Results
  6. 6. Age distribution: comparison of the different periods 1991-94 versus 03/2003 - 02/2004% de cas40% years 1991- 94 n= 15130% March 03- February 04 n= 15820%10%0% 0-9 ans 10-19 ans 20-29 ans 30-39 ans 40-49 ans 50-59 ans Classes dâge Réseau "Sentinelles" Déclarations obligatoires ! 60
  7. 7. Risk exposure within 6 months preceding the acute case Source : obligatory declaration 2003-04
  8. 8. Hépatites virales B: épidémiologie- Vaccin mais 400 millions de porteurschroniques dans le monde-  280 000 porteurs chroniques en France (INVS)-  45% ignorent leur statut-  1 300 décès par an en France-  60 000 avec hépatite chronique active-  Environ 15 000 patients traités
  9. 9. LE VIRUS DE L ’HEPATITE B •  FAMILLE : Hepadnaviridae, seul représentant humain•VIRUS RESISTANT : - 7 jours dans l’environnement - pendant 5 mn à 100°C, 10 h à 60°C - à la congélation.
  10. 10. HBsAgfilament S small surface protein sphere Dane particle M middle surface protein v v L large surface protein core capsid protein HBeAg HBeAg secreted e antigen v pol polymerase HBx X protein (non-secreted)
  11. 11. The HBV genome Tiollais, Nature 1985
  12. 12. The viral replication cycleZoulim & Locarnini, Gastroenterology 2009
  13. 13. Réplication du génome viral. Implication pour la persistance virale et l’intégration du génome viral Membrane cellulaire ARN pg ds DNA 10% virion ss DNA 90% intégration cccDNA illégitime RC DNA cccDNA noyau virion
  14. 14. The animal models of HBV infection Transgenic mice Humanized mice Human Chimpanzee Gibbon baboons Tupaïa Woolley monkey Ground squirrel American woodchuck Pekin Duck Grey Heron
  15. 15. HIV HCV HBV (Ritonavir ) (IFN- ) (Lamivudi n e )Plasma virus Half-life 5.8 h 2.7 - 7.2 h 24 h Mean viral 2.7 d 3.8 - 7.3 d 24.7 dgeneration time Daily turnover 95% 94% - 99.8% 50% Daily production 1010 (1.1 - 1011(plasma) 12.7)*1011 Total load 1.2*109 (3.8 - 5.6)*1010 2*1011Infected cells Half-life 1.6 d 2.4 - 4.9 d 10 - 100 d Mean lifespan 2.3 d 3.5 - 7.1 d 23.3 d Daily turnover 38% 13% - 25% 1% - 7% (Tsiang et al. Hepatology 1999)
  16. 16. HBV replication and its role in HCC development Wands, NEJM 2004
  17. 17. Role du VHB dans l’oncogénèse hépatique ! REACTION INFLAMMATOIRE CHRONIQUE! REGENERATION HEPATIQUE! VHB! CARCINOGENES!INFECTION CHRONIQUE! CHC ! CO-FACTEURS! MUTAGENESE INSERTIONNELE! TRANSACTIVATION DE GENES CELLULAIRES! INTERACTIONS PROTEIQUES! INACTIVATION DE GENES SUPPRESSEURS DE TUMEUR!
  18. 18. Immunopathology
  19. 19. The level of viral antigen presented by hepatocytes influences CD8 T-cell function•  Hepatocyte antigen presentation was generally inefficient, and the quantity of viral antigen strongly influenced CD8 T-cell antiviral function.•  High levels of hepatitis B virus production induced robust IFN-gamma and TNF- alpha production in virus-specific CD8 T cells,•  while limiting amounts of viral antigen, both in hepatocyte-like cells and naturally infected human hepatocytes, preferentially stimulated CD8 T-cell degranulation.•  Virus-specific CD8 T-cell function is influenced by the quantity of virus produced within hepatocytes Gehring AJ, et al . J Virol 2007;81:2940-9.
  20. 20. Wieland S et al, PNAS 2004
  21. 21. 10 3 10 4 10 310 2 10 210 1 10 110 0 10 010 -1 -2 10 -110 10 -2 -310 10 -3 Werle et al, Gastroenterology 2004
  22. 22. Inactive HBV carrier ●  Not virologically inactive: –  low levels of viremia –  episomal HBV DNA in the liver Low-replicative or latent infection Epigenetic control Pollicino et al., Gastroenterology 2006 Sirt1 PCAF CBP p300 CBP HDAC1HDAC1 Sirt1 p300 PCAF Histones HistonesLOW-REPLICATIVE STATE HIGH-REPLICATIVE STATE –  spontaneously –  during immunosuppression Pollicino et al. Gastroenteroplogy 2006 Levrero et al. J Hepatol, 2009
  23. 23. HISTOIRE NATURELLE ET VIROLOGIE CLINIQUE
  24. 24. Seeger, Zoulim, Mason;Fields Virology; 2007
  25. 25. HEPATITE B AIGUE
  26. 26. Laboratory Diagnosis of Acute Hepatitis B HBsAg Anti-HBs Ab 1000 IU/L and million copies/ml HBeAg Anti-HBe Ab 900 800 ALT Total anti-HBc ALT and HBV DNA 700 600 Symptoms 500 400 HBV DNA IgM anti-HBc 300 200 100 Normal 0 0 1 2 3 4 5 6 12 24 36 48 60 Months After Exposure Seeger, Zoulim, Mason, Fields Virology 2007
  27. 27. HEPATITE B PROLONGEE
  28. 28. Laboratory Diagnosis of Chronic Hepatitis B associated with wild type virus infection HBsAg 800 HBeAg IU/L or million copies/ml 700 600ALT and HBV DNA 500 HBV DNA 400 300 200 ALT 100 Normal 0 0 1 2 3 4 5 6 12 24 36 48 60 Months After Exposure Seeger, Zoulim, Mason, Fields Virology 2007
  29. 29. Laboratory Diagnosis of Transition of Chronic Hepatitis B to The inactive Carrier State 800 HBsAg `` IU/L and million copies/ml 700 HBeAg Anti-HBe 600ALT and HBV DNA 500 400 HBV DNA 300 200 ALT 100 Normal 0 0 1 2 3 4 5 6 12 24 36 48 60 72 80 92 104 Months After Exposure Seeger, Zoulim, Mason, Fields Virology 2007
  30. 30. Laboratory Diagnosis of HBeAg negative Chronic Hepatitis B HBsAg HBeAg Anti-HBe IU/L and million copies/ml 450 400 ALTALT and HBV DNA 350 300 250 200 HBV DNA 150 100 50 Normal ALT levels 0 0 3 6 9 12 15 18 21 24 27 30 33 36 39 42 45 48 Months Seeger, Zoulim, Mason, Fields Virology 2007
  31. 31. 1000 ALAT9 log ADN- VHB8 log 1007 log 106 log 15 log4 log 0,13 log 0,012 log0,0011 log Tolérance hép chronique p. inactif mt pré-core VHB occulte
  32. 32. Dynamic ranges of quantification of HBV DNA assaysAmplicor HBV Monitorv2.0 (Roche)HBV Hybrid-Capture II(Digene)Ultra-sensitive HBVHybrid-Capture IIVersant HBV DNA3.0 (bDNA, Siemens)Cobas Taqman HBV(Roche)RealArt HBV LC PCR(Artus Biotech)Abbot Real-time HBV(Abbott)Versant HBV DNA 1.0(kPCR, Siemens)* *in development
  33. 33. Formes cliniques
  34. 34. Pathophysiologic Cascade of Chronic HBV InfectionAdapted from: Lavanchy D. Journal of Viral Hepatitis, 2004, 11, 97–107. Chen JC, et al. JAMA. 2006;295:65-73. Iloeje U. H, et al.Gastroenterology. 2006;130:678-86.
  35. 35. Charge virale et incidence de la cirrhose .4 P <0.001 37.1% Incidence cumulative de cirrhose 1.0 x 106 n=627 1.0-9.9x105 n=344 n=3774 1.0-9.9x104 n=649 .3 300-9.9x103 n=1210 <300 n=944 23.0% .2 .1 10.0% 6.3% 5.2% 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 Année de suiviR.E.V.E.A.L. – HBV Study Iloeje UH et al. Gastroenterology 2006; 130: 678-686
  36. 36. Survie chez les patients au stade cirrhose 100 Patients Surviving, % 80 60 Cirrhosis1 55% (n = 130) 40 20 Decompensated cirrhosis2 14% (n = 21) 0 0 1 2 3 4 5 Years1. Weissberg et al. Ann Intern Med. 1984;101:613.2. De Jongh et al. Gastroenterology. 1992;103:1630.
  37. 37. AgHBeAg et risque de CHC •  11,893 Taiwanese men; 92,359 person-years follow-up 12 Cumulative incidence (%) HBsAg+ 10 HBeAg+ 8 6 4 HBsAg+, HBeAg - 2 0 HBsAg -, HBeAg - 0 2 4 6 8 10 YearYang et al. N Engl J Med. 2002;347:168-174.
  38. 38. Charge virale et incidence du CHC Chen et al; JAMA 2006
  39. 39. REVEAL-Incidence of HCC Increases with Increasing HBV DNA Baseline Viral Level 20% % cumulative incidence of HCC 14.9% 15% 12.2% 10% 5% 3.6% 1.3% 1.4% 0% <300 >300 - 103 > 103 - 104 >104 - 106 ≥106 Baseline HBV DNA (copies/mL)Chen JC, et al. JAMA. 2006;295:65-73.
  40. 40. High Baseline Serum HBV DNA Levels are Associated with Increased Risk of HCC Mortality in HBsAg-Positive Patients HBV DNA Negative 100% Survival distribution function 96% 92% 88% p < 0.001 across viral 84% categories 80% 0 1 2 3 4 5 6 7 8 9 10 11 12 Survival time (Years)http://www.fccc.edu/docs/sci_report/Evans.pdf#search=%22haimen. Accessed 1/23/07.Chen G, et al. J Hepatology 2005; 42 (suppl 2):477A.Chen G, et al. Hepatology 2005; 40 (suppl 1):594A.
  41. 41. Relationship Between Persistent Viremia and HCC: Argument For Antiviral Therapy •  Persistent replication associated with greater risk of HCC •  Decreased risk when viral replication declines Rate Per 100,000HCC Incidence 1.2x104 10,108 1.0x104 8730 8.0x103 5882 6.0x103 4.0x103 1473 2.0x103 0 Baseline HBV DNA, (copies/mL) < 104 ≥105 ≥105 ≥105 Follow-up HBVDNA, copies/mL --- < 104 104 to <105 ≥105 Adjusted RR 1.0 3.6 6.9 9.1 (95% CI) (ref) (1.7-7.6) (3.4-13.8) (5.8-14.1) P Value -- < 0.001 < 0.001 < .001 Chen, et al. JAMA 2006
  42. 42. Impact Clinique de la Variabilité du Génome Viral
  43. 43. B6 D1 World J Gastroenterol 2007; 13: 14-21
  44. 44. Zoulim et al J Viral Hepatitis 2006
  45. 45. Impact du génotype sur la séroconversion PEG-IFN a-2b PEG-IFN a-2b HBeAg Loss 1 HBsAg Loss 2 47% 50 21 Percentage of patients (%) 44%Percentage of patients (%) 18 40 15% 15 28% 30 25% 12 20 9 8% 6 5% 10 3 0% 0 0 A B C D A B C D n=90 n=23 n=39 n=103 n=90 n=23 n=39 n=103 HBV genotype HBV genotype 1 Janssen, Lancet 2005; 2 Flink, Am J Gastro 2006
  46. 46. HBeAg and Precore Mutation G 1896A = stop codon, TAG ATG ATGCore gene
  47. 47. HBeAg and Precore Mutation ATG ATGCore gene
  48. 48. Main pre-c/core promoter mutations observed in vivo Basic core promoter LEF AGGTCA HNF4 GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCATAAATT GGTTAATNATTA HNF1 HNF3 WTRTTKRY Deletion 63-70 Insertion (RGTTAATYATTA) at 74/75 Insertion (TTG) at 66/67 Mutation AGG to TCA and insertion TA at 65/66
  49. 49. 2500200015001000 500 0 temps100 80 60 40 20 0 temps
  50. 50. Outcome of Chronic Anti-HBe Positive Hepatitis B400300200100 0400300200100 0400300200100 0
  51. 51. Augmentation de prévalence des hépatites chroniques avec AgHBe négatif en France 62% 48% HBeAg(+) N=119 HBeAg(-) N=164Zoulim et al, J Viral Hepatitis 2006
  52. 52. Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
  53. 53. Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
  54. 54. Lamivir cohort, Zoulim et al, J Viral Hepatitis 2006
  55. 55. Pichoud et al, J hepatol 200025 10000000000 100000000020 100000000 1000000015 1000000 10000010 10000 ALT pre-S1 10005 100 bDNA 10 PCR0 1 months 0 1 2 5 9 12 13 16
  56. 56. PreS2 PreS1 HBs Ag Pol S 0/3221 Brin(-) 3,2kb Brin(+) 2,4kbSHBs (S) TATAAMHBs (preS2+S) « a » determinant U5-like DR1 Enh2 Enh1 C DR2LHBs (preS2+preS2+S) S-S sP120T Pré-C X 137 S- S 138 149 107 S-S S-S 147 139 sG145R sD144H/A/E 99 NH2 S-S COOH « a » determinant induces the synthesis of anti-HBs neutralizing antibodies Tiollais P. et al., Nature 1985. Torresi J., J. Clin Virol 2002; Dryden KA. et al., Mol Cell 2006
  57. 57. Occult HBV Infection (OBI) Presence of HBV DNA in the liver (± serum) ofindividuals testing HBsAg negative by currently available assays Raimondo et al, J Hepatol 2008
  58. 58. How to Detect Occult HBV Infection Currently there is no standardized diagnostic assay for occult HBV infection
  59. 59. Reported Prevalence of Occult HBV Infection in HIV Positive Patients Occult Study Country N° of HBV Methods patients N° (%) Hofer, 1998 Switzerland 57 51 (89%) “nested” PCR (serial evaluation) Torres-Baranda, 2006 Mexico 35 7 (20%) “nested” PCR Filippini, 2006 Italy 86 17 (20%) single step PCR Mphahlele, 2006 South Africa 140 31 (22.%) “nested” PCR Pogany, 2005 Netherlands 93 4 (4%) single step PCR Neau, 2005 France 160 1 (0.6%) Cobas Amplicor HBV Monitor (Roche) Santos, 2003 Brazil 101 16 (16%) single step PCR Wagner, 2004 France 30 11 (37%) “nested” PCR Goncales, 2003 Brazil 159 8 (5%) “nested” PCR Nunez, 2002 Spain 85 0 Cobas Amplicor HBV Monitor (Roche) Piroth, 2000 France 37 13 (35%) single step PCR Raffa, 2007 Italy 101 42 (41%) “nested” PCR (liver) Raimondo et al, J Hepaol 2007, modified
  60. 60. Cause(s) for the failure of HBsAg detection OBI “false” OBI Suppression of Infection byHBV replication and S gene Variants gene expression
  61. 61. Occult HBV Infection Is Associated to Hypermethylated and Deacetylated HBV cccDNA-bound histones cccDNA-ChIP Input 1 2 3 4 5 6 IgG Occult HBV Overt HBV 1: HP1 4: HDAC1 2: SUV39 5: Ac.H3 3: MECP2 6: Ac.H4 Sirt1 Sirt1 MeCP2 HDAC1 HDAC1 HP1 Suv39 AcH3/AcH4 Core TF TF TF TF TF TF Histones Methylated H3/H4 H3/H4 and DNA Pollicino et al., unpublished
  62. 62. HBV replication HBV cccDNA Integrated HBV DNA HBV mutants Epigenetic control Immune surveillance Viral co-infections Occult HBV infection
  63. 63. Schematic representation of HBV serum marker profile in OBI and “false” OBI OBI „false“ OBI HBV DNA levels < 200 UI/ml Seropositive S gene Seronegative escape mutants Primary occult HBV DNA levels HBsAg lost comparable to after AH overt infectionHBsAg lost Progressive antibodyduring CH disappearence
  64. 64. Occult hepatitis BTorbenson M. & Thomas D.L., Lancet Inf Dis, 2002
  65. 65. Occult HBV infections: unresolved issues Diagnostic Specific To be treatments ? improved High prevalence Tools ?Co-infections ?Therapy? ROLE Worsen HCV in infection ? HCC Not fully understood ?
  66. 66. HBsAg Immuno-active Inactive phase Occult infectionImmunotolerant Reactivation phase phase Low replication phase HBeAg(+) HBeAg(-) / anti-HBe(+) HBV DNA109-1012 IU/mL >2000-<109 IU/mL <2000 IU/mL >2000 IU/mL ALAT Minimal CH Moderate to severe CH Remission Moderate to severe CH Cirrhosis Inactive cirrhosis Cirrhosis Treatment indicated Treatment indicated Adapted from Fattovich G. Sem Liver Dis. 2003
  67. 67. Endpoints of therapyPersistence of high viral load is associated with a significant risk of progression of the liver disease and of HCC Aim of antiviral therapy: HBV DNA < 10-15 IU/mL by real-time PCR assays Viral suppression No replication =Histological and clinical No resistance improvement Chen CJ, et al. JAMA 2006. Iloeje UH, et al. Gastroenterology 2006. Chen C, et al. Am J Gastroenterol 2006. Zoulim & Perrillo J Hepatol 2008. Zoulim & Locarnini Gastroenterology 2009
  68. 68. Antivirals approved for hepatitis BDrug Type Approved Phase 3 Phase 2Nucleoside analogs •  Lamivudine* •  Emtricitabine* •  Elvucitabine •  Entecavir •  Clevudine** •  Valtorcitabine •  Telbivudine •  Amdoxovir •  Racivir •  LB80380Nucleotide analogs •  Adefovir dipivoxil •  Alamifovir •  Tenofovir* •  PradefovirCytokines •  Interferon alfa •  IL7 •  Pegylated Interferon • IFN Lambda alfa-2a • Vaccine therapy *Currently approved for HIV **development on hold
  69. 69. Treatment failurePrimary non response Secondary treatment failurePartial response Antiviral drug resistanceHost factors Drug factorsDrug metabolism Barrier to resistancePatient’s compliance Viral factorsDrug factors Resistant mutantsAntiviral potency Zoulim & Perrillo J Hepatol 2008; EASL CPG J Hepatol 2009
  70. 70. Clinical definition of resistance•  Virologic Breakthrough: Rebound in serum HBV DNA levels (e.g. 1 log10 above nadir)•  Genotypic Resistance: Detection of mutations known to confer resistance while on therapy•  Virologic Breakthrough with Genotypic Resistance: Viral rebound associated with a mutation(s) known to cause resistance.•  Primary non response: <1log10 decrease of viral load after 3 months•  Partial response: detectable HBV DNA levels during therapy Zoulim & Perrillo, J Hepatol 2008; EASL CPG, J Hepatol 2009
  71. 71. Laboratory Definition of HBV Resistance to AntiviralsLaboratory Investigations•  Phenotypic Resistance: Decreased susceptibility (in vitro testing) to inhibition by anti-viral drugs associated with genotypic resistance.•  Cross Resistance: Mutants selected by one agent that also confer resistance to other antiviral agents Zoulim et al; Future Virology 2006
  72. 72. The main differences between HIV, HBV and HCV HIV1 HBV1,2 HCV1,3 Host cell Host cell Host cell HCV RNA cccDNA Host DNAHost DNA H Host DNA H H Proviral DNA Integrated DNA Nucleus Nucleus Nucleus Life-long suppression Long-term suppression Definitive viral clearance of viral replication of viral replication and SVR Adapted from 1. Sorriano V, et al. J Antimicrob Chemother 2008;62:1-4. 2. Locarnini S and Zoulim F. Antiviral Therapy 2010;15 (suppl 3):3-14. 3. Sarrazin C and Zeuzem S. Gastroenterology 2010;138:447-462.
  73. 73. Kinetics of emergence of HBV drug resistant mutantsSi Ahmed et al. Hepatology. 2000; Yuen et al Hepatology 2001; Locarnini et al Antiviral Therapy 2004; Villet et al Gastroenterology 2006 J Hepatol 2007 & 2008; Pallier et al J Virol 2007; Yim et al Hepatology 2006.
  74. 74. Lamivudine Resistance Accelerates Progression of Liver Disease 25 Placebo (N=215)% With disease progression YMDDm (N=209) (49%) Placebo 21% 20 Wild Type (N=221) 15 YMDDm 13% 10 WT 5% 5 0 0 6 12 18 24 30 36 Time after randomization (Months) Liaw YF et al. N Engl J Med. 2004;351:1521-1531
  75. 75. Biochemical and Histologic Correlates of HBV Resistance •  Rise in ALT levels –  Mild ALT elevations in most cases –  ALT flares with acute exacerbations and liver failure: especially patients with liver cirrhosis and/or pre-core mutant infection •  Progression of liver disease –  Progressive worsening of liver histology –  Clinical deterioration, liver decompensation, HCC developmentLai et al Clin Infect Dis 2003; 36: 687-696; Dienstag et al Gastroenterology 2003;124:105-117 ; Lok et al Gastroenterology2003; 125 : 1714-1722; Hadziyannis et al Hepatology 2000;32:847-851; Si Ahmed et al Hepatology 2000; Zoulim et al J ViralHepatitis 2006;13:278-288 ; Fung et al J Hepatol 2005;43:937-943; Liaw et al NEJM 2004;351:1521-1531.
  76. 76. ALT flares in patients with lamivudine resistance over time Lok et al Gastroenterology 2003; 125 : 1714-1722
  77. 77. Incidence of drug resistance over time Resistance at year of therapy expressed as percentage of patients Drug and patient population 1 2 3 4 5 6Lamivudine 23 46 55 71 80 -Telbivudine HBeAg-Pos 4.4 21 - - - -Telbivudine HBeAg-Neg 2.7 8.6 - - - -Adefovir HBeAg-Neg 0 3 6 18 29 -Adefovir (LAM-resistant) Up to 20% - - - - -Tenofovir 0 0 0 0 - -Entecavir (naïve) 0.2 0.5 1.2 1.2 1.2 1.2Entecavir (LAM resistant) 6 15 36 46 51 57 CL Lai Clin Infect Dis 2003; CL Lai NEJM 2007; Hadzyiannis Gastroenterology 2006; Marcellin NEJM 2008; CL Lai & Chang NEJM 2006; Zoulim & Locarnini Gastroenterology 2009
  78. 78. Zoulim & Locarnini, Gastroenterology, 2009
  79. 79. Determinants of viral persistenceZoulim & Locarnini, Gastroenterology, 2009
  80. 80. Bridges; Progress in Liver Disease 1995
  81. 81. The HBV life cycle Nucleos(t)ide analogsZoulim & Locarnini, Gastroenterology 2009
  82. 82. uncoating! CCC DNA! supercoiled DNA! minichromosome! Topoisomerase (TDP2) ?! Acetyl transferase ?! removal of protein primer! Histones! removal of RNA primer! completion of viral (+) strand DNA! ligation of DNA strands extremities!Antivirals ? Tuttleman et al Cell 1986 viral polymerase?! Le Guerhier et al AAC 2000 DNA repair protein?! Delmas et al AAC 2002 other cellular enzymes?! Kock et al Hepatology 2003 Cortes Ledesma et al Nature 2009 Boeck et al Plos Pathogen 2010
  83. 83. Can we prevent cccDNA formation ?Nucleoside analogs in monotherapy orcombination therapy cannot prevent the denovo formation of cccDNA in hepatocyteculture and in vivo in animal experiments(Delmas et al AAC 2000; Seigneres et al AAC 2002)Can we clear cccDNA from a chronicallyinfected cell ?The decrease of intrahepatic cccDNA duringnucleoside analog requires hepatocyte turnover in animal experiments(Zhu et al J Virol 2001; Litwin et al J Clin Virol 2005)
  84. 84. Zhu et al, J Virol 2001
  85. 85. ADV Associated Serum HBsAg Reductions are Similar in Magnitude to cccDNA Reductions Serum Total 0 HBV Intracellular cccDNA Serum Changes in HBV Markers (log 10 copies/cell(ml)) DNA DNA HBsAg -1 from Baseline -2 -3 -4 -5 -6 Werle et al, Gastroenterology 2004
  86. 86. Kinetics of spread and emergence of drug resistant virus during antiviral therapy antiviral wt mt    Free liver space  Mutant fitness  ni = non-infected wt = wild type  mt = mutant type  ni I II III IV INHIBITION OF WILD TYPE VIRUS REPLICATIONS DELAYED EMERGENCE OF DRUG RESISTANT VIRUSZhou T, et al. Antimicrobial Agents and Chemotherapy 1999; 43: 1947-1954.
  87. 87. Kinetics of HBV drug resistance emergence Drug-susceptible virus Treatment begins Naturally—occurring viral variants Drug-resistant variant Secondary resistance mutations HBV replication / compensatory resistance mutations Primary resistance mutations TimeSi Ahmed et al. Hepatology. 2000; Yuen et al Hepatology 2001; Locarnini et al Antiviral Therapy 2004; Villet et al Gastroenterology 2006J Hepatol 2007 & 2008; Pallier et al J Virol 2007; Yim et al Hepatology 2006.
  88. 88. Partial response to adefovir dipivoxil is not due to the selection of DR mutants•  The top 25% patients (quartile 1): > 4.91 log10 reduction in serum HBV DNA at week 48.•  In Q2: 3.52 to 4.90 log10 reduction of viral load.•  In Q3: 2.22 to 3.51 log10 reduction in viral load.•  The bottom 25% of patients (Q4):< 2.22 log10 reduction in HBV DNA levels at week 48.•  Phenotypic analysis of viral strains: Q4 as sensitive to ADV as Q1 strains•  Documented Drug Compliance (% of days without taking ADV) Virological Response Virological Response Virological Response Virological Response Q1 (best response) Q2 Q3 Q4 (worse response) (n=38) (n=38) (n=38) (n=38)Median 99% 99% 99% 97% arange 86-100% 41*-100% 91-100% 70-100%•  Wilcoxon rank sum test, P=0.01 Durantel et al, Antiviral Therapy, 2008
  89. 89. Amino acid substitutions result in conformation changes of the polymerase catalytic site Wild-type M204/L180 LVDr M204V/L180M L180 L180M M204 M204V LVD-TP LVD-TP LVDr M204V/L180M M204V reduces pocket size L180M Steric clash between lamivudine and V204 M204V Minimal steric clash between entecavir and ETV-TP V204 Langley DR, et al. J Virol. 2007;81:3992-4001.
  90. 90. Definition of fitness•  A parameter that quantifies the adaptation of an organism or a virus to a given environment•  For a virus, ability to produce infectious progeny relative to a reference viral clone, in a defined environment Esteban Domingo, In Fields Virology 2007
  91. 91. Cross-resistance data for the main mutants and the commercially available drugs Pathway Amino acid Lamivudine Telbivudine Entecavir Adefovir Tenofovir substitutions in the rt domain Wild type S S S S S L-nucleoside M204I R R I S S L-nucleoside L180M+M204V R R I S S Alkyl N236T S S S R I phosphonate Shared A181T/V I/R I/R S R I D-Cyclopentane L180M+M204V/I R R R S S (ETV) ±I169T±V173L ±M250V D-Cyclopentane L180M+M204V/I R R R S S (ETV) ±T184G±S202I/G MDR V173L+L180M R R S R S +A181V+N36TZoulim & Locarnini Gastroenterology 2009
  92. 92. Archiving of viral variants Viral quasispecies Liver Majority population Minority variants Resistant variants cccDNA variants •  cccDNA in the liver: –  Is propagated during the normal replication cycle of HBV –  Can serve as a template for the production of new virus Blood circulationZhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
  93. 93. Archiving of viral variants Viral quasispecies Liver Majority population Minority variants Resistant variants cccDNA variants •  cccDNA in the liver: –  Is propagated during the normal replication cycle of HBV –  Can serve as a template for the production of new virus •  It is believed that viral variants with antiviral resistance may be archived in this way Blood circulationZhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
  94. 94. Archiving of viral variants Viral quasispecies Liver Majority population Minority variants Resistant variants cccDNA variants •  cccDNA in the liver: –  Is propagated during the normal replication cycle of HBV –  Can serve as a template for the production of new virus •  It is believed that viral variants with antiviral resistance may be archived in this way Blood circulationZhou et al, AAC 1999; Zoulim F. Antivir Res. 2004. Zoulim F & Perillo R. J Hepatol. 2008
  95. 95. Phenotyping of HBV clinical isolates Southern blot analysis Whole genome HBV clones PCR Transfection cloning Patient HepG2 serum Huh7 lamivudine adefovir Cell culture plate RC - Wild-type virus SS - Patient’s Fold resistance virus IC50 mutant = IC50 reference strain Increasing antiviral concentration1. Durantel D, et al., Hepatology, 2004;40:855-64. 2. Yang H, et al., Antiv Ther, 2005;10:625-33.
  96. 96. Maximising the barrier to resistance Wild-type virus LAM rtM204V/I ± rtL180M LAM-resistant virus ADV-resistant virus ETV-resistant virus ADV rtN236T +/or rtA181V rtT184 or rtS202 or rtM250 ETV rtM204V/I +/- rtL180M LAM + TDF – what do we see? LAM rtT184 or rtS202 or rtM250then ETV rtM204V/I +/- rtL180M TDF: what can we expect? TDF
  97. 97. Can we detect low frequency mutants prior to or during therapy ?Use of pyrosequencing to detectlow frequency mutants• May detect mutants representingas low as 0.1% of the viralpopulation• The clinical significance fortreatment choice or adaptationneeds to be determined byprospective studies
  98. 98. Important factors involved in selection of MDR mutants•  Use of inadequate sequential monotherapies and inadequate treatment adaptation•  Incomplete viral suppression –  > Persistent replication in the presence of antiviral pressure•  Use of drugs sharing cross-resistance characteristics –  One mutation may confer resistance to several drugs –  > Persistent replication•  Accumulation of mutations•  Wide replication space (liver transplantation)
  99. 99. The problem of sequential therapy with nucleoside analogues ? Drug A Drug B Multiple drug resistant mutants+ one mutation + one mutation with complex pattern ofRisk of selection of MDR mutants by sequential therapy mutations -  drugs sharing cross-resistance characteristics -  incomplete viral suppression -  liver transplantation Yim et al, Hepatology al. J Hepatol. 2008;48:S2-19. Zoulim F, et 2006; Villet et al Gastroenterology 2006 & 2009
  100. 100. Drugs sharing cross-resistance characteristics: Switching strategy  emergence of MDR mutant adefovir IFNGenotype H entecavir lamivudine lamivudine 109 108 HBV DNA (copies/ml) 107 106 L180M+M204V 105 104 L180M+S202G+M204V 103 0 20 40 60 80 100 120 Treatment (months) Villet et al, J Hepatol 2007
  101. 101. Genotypic analysis of the viral quasi-species during lamivudine and entecavir therapy L180M+A181G+S202G+M204V 36 V173L+P177S+L180M+S202G+M204V L180M+S202G+M204V Entecavir Treatment (months) rebound entecavir L180M+A181G+S202G+M204V V173L+P177S+L180M+S202G+M204V 34 I169L+L180M+S202G+M204V L180M+S202G+M204V 1 V173L+L180M+M204V 11 L180M+M204V V173L+L180M+M204V Lamivudine lamivudine L180M+M204V 27/0 M204V rebound wt 0 wt 0 20 40 60 80 100 % clones in the quasi-species-  Lamivudine therapy: Selection of a main population harboring the V173L+L180M+M204Vmutations = primary resistance mutations-  Entecavir therapy: Selection of three populations, all harboring the L180M+S202G+M204Vmutations = secondary resistance mutations Villet et al, J Hepatol 2007
  102. 102. Role of cross-resistance, inefficacy of viral load suppression, and replication space, in MDR mutant selection HBIg tenofovir adefovir Genotype E lamivudine 108 Liver transplantation 107 HBV DNA (Meq/ml) 106 105 104 L180M+M204V V173L+L180M+A181V+N236T 103 102 0 500 1000 1500 2000 2500 3000 3500 days of treatment Villet et al Gastroenterology 2006
  103. 103. Lamivudine+adefovir treatment (months) Accumulation of mutations and selection of a complex mutant Time post-transplantation (months) 42 to 50 V173L+L180M+A181V+N236T 34 to 42 V173L+L180M+A181V+N236T 40 V173L+L180M+A181V 32 V173L+L180M+A181V+M204V+N236T V173L+L180M+A181V+M204V V173L+L180M+A181V+M204V+N236T 38 1 V173L+L180M+A181V+N236T 30 Viral rebound V173L+L180M+A181V+M204V 1 V173L+L180M+A181V+M204V 34 L180M+M204I 26 M204I V173L+L180M+A181V+M204V 24 I169V+L180M+T184I+M204V 16 V173L+L180M+A181V+N236T wt V173L+L180M+A181V+M204V 8 V173L+L180M+A181V+M204I 0 L180M+M204I 0 10 20 30 40 50 60 70 80 90 100 % of variants in the viral quasi-species Terminal Pol/RT spacer RNaseH Protein V173L L180M A181V N236T dominant HBV mutant Pre-S/S gene P120S
  104. 104. A single a.a. substitution at position rt181 may be responsible for multidrug resistanceLVD ADV LVD+ADV Patient #1 Patient #3 Patient #4 Patient #8 (67 months) (37 months) (31 months) (47 months) Patient #7 Patient #5 Patient #6 Patient #9 (30 months) (44 months) (36 months) (19 months)LVD+TDF Patient #2 LVD+ADV+TDF Patient #10 (23 months) (7 months) wt N236T + N238T A181V M204V A181T M204I A181V + N236T L80V A181T + N236T L80V + M204I N236T Villet S, et al. J Hepatol. 2008;48:747-55.
  105. 105. Impact on virus infectivity and fitnessImpact on virion release (intracellular retention) and virologic monitoring of breakthroughImpact on vaccine prophylaxis efficacyWarner et al Hepatology 2009Kamili et al Hepatology 2009Villet et al Gastroenterology 2009
  106. 106. Potential risk of transmission of HBV DR mutantsClements et al, Bull WHO 2009
  107. 107. Conclusions – Main issues regarding viral resistance and persistence1) Persistence of cccDNA A major driver of viral persistence Can we quantify HBsAg as a surrogate / non invasive marker ?2) Viral quasi-species Role of more sophisticated methodologies to detect HBV variants, i.e. Ultradeep sequencing ?3) Viral fitness A major determinant in the barrier to resistance Is monotherapy sufficient on the long-term to maintain a high barrier to resistance ?
  108. 108. Management algorithm Antiviral treatment Viral load asssessment Treatment failure Check compliance Viral genome sequence analysis Wild type virus HBV drug resistant mutantCheck compliance Primary non response Add-on therapy based on cross-resistance data Switch to more potent drug Zoulim and Perrillo, J Hepatol, 2008; EASL CPG J Hepatol 2009
  109. 109. Management algorithm Antiviral treatment Viral load asssessment Treatment responseCheck for HBe/HBs seroconversion on a regular basis (6 monthly) Zoulim and Perrillo, J Hepatol, 2008; EASL CPG J Hepatol 2009
  110. 110. Virologic Consequences of Persistent Viremia   Infection of new hepatocytes  slower kinetics of clearance infected cells and cccDNA   Increases the risk of occurrence and subsequent selection of HBV mutations responsible for drug resistance   On-treatment prediction of HBV drug resistanceLe Guerhier et al Antimicrob Agents Chemoter 2000;44:111-122; Delmas et al Antimicrob AgentsChemother 2002; 46:425-433; Kock et al Hepatology2003; 38:1410-1418; Richman Hepatology2000;32:866-867
  111. 111. Comment adapter le traitement ? Wild type LAM ADV LAM-R ADV-R LAM + ADVZoulim Antivir Res 2004; 64: 1-15. Villeneuve et al J Hepatol 2003. Lampertico et alGastroenterology 2007
  112. 112. Patients with lamivudine resistance: adefovir add-on strategy 3-yr cumulative probabilityPatients with virological breakthrough 100 Virologic breakthrough* 100 Virologic breakthrough* and ADV resistance** Patients with ADV-R 80 80 ADV mono ADV mono 60 ADV+LAM 60 ADV+LAM 40 40 P<0.001 30% P<0.001 20 20 16% 6% 0 0 0% 0 3 6 9 12 15 18 21 24 27 30 33 36 Months 0 3 6 9 12 15 18 21 24 27 30 33 36 273 268 256 225 201 158 61 Patients 229 225 217 194 179 146 57 255 238 223 213 200 177 103 still at risk 242 227 214 205 200 174 92 * > 1 log rebound of HBV DNA compared to on-treatment nadir ** N236T or A181T-V in patients with a virological breakthrough Lampertico P for the AISF ADV Study Group, 57th AASLD Meeting, October 27-31, 2006, Boston, USA. Oral presentation LB5. Hepatology. 2006;44(4, suppl 1):229A-30 (Abstract 110).
  113. 113. The problem of sequential therapy and switching strategy LAM LAM 10 ADV 300 9 250 8(Log10 copies/mL)Serum HBV DNA L180M 200 7 N236T +M204V ALT (IU/L) 6 Reverted to wild 150 type 5 100 4 50 3 2 janv-98 janv-99 janv-00 janv-01 janv-02 janv-03 janv-04 janv-05  HBV DNA Δ ALT Villeneuve et al, J Hepatol 2003
  114. 114. Rescue therapy in patients with clinical breakthrough Drug ASerum HBV DNA (Log10 copies/mL) Drug B 8 and ALT (x ULN) 6 4 2 0 M0 M6 ALT of therapy Month M12 M18 M24 M30 M36 ALT HBV DNA
  115. 115. Rescue therapy in patients at the time of virologic breakthrough Drug A Drug BSerum HBV DNA (Log10 copies/mL) 8 6 and ALT (x ULN) 4 2 0 M0 ALT M6 Month of therapy M12 M18 M24 M30 M36 ALT HBV DNA
  116. 116. Early add-on therapy to prevent drug resistance Drug A Serum HBV DNA (Log10 copies/mL) Drug B 8 and ALT (x ULN) 6 4 2 0 M0 ALT M6 Month of therapy M12 M18 M24 M30 M36 ALT HBV DNA
  117. 117. Very Early Add-on Therapy to Keep Viral Load as Low as Possible1. Start with a drug having a high genetic barrier for resistance2. Add a drug with a different cross-resistance profile 8 Serum HBV DNA (Log10 copies/mL) 7 6 5 4 MDR ? 3 2 M0 M3 M6 M9 M12 M15 M18 M21 M24 Month of therapy outgrowth of drug resistant mutant ?
  118. 118. Rationale for de novo Combination TherapyDrug B Drug Aresistantmutant wt Wild typeDrug A Drug BresistantmutantClavel et al NEJM 2004;350:1023-35 ; Zoulim Antiviral Res 2004;64: 1-15
  119. 119. De novo combination therapy to prevent drug resistance Drug A Serum HBV DNA (Log10 copies/mL) Drug B 8 and ALT (x ULN) 6 4 2 0 M0 ALT M6 Month of therapy M12 M18 M24 M30 M36 ALT HBV DNA
  120. 120. Preventing L-Nucleosides Resistance with de novo Combination Therapy 100 Incidence of resistance* (%) Marcellin 1 Lau 2 Lai 3 Sung 4 Lau 5 80 60 40 34% 21% 20% 18% 20 11% 12% 5% 2% 1% 0% 0% 0 LAM LAM LAM LAM LAM LAM LdT LAM LAM FTC FTC +Peg +Peg +LdT +ADV +ADV * After 1- year therapy1 Marcellin et al. N Engl J Med 2004; 351: 1206-17 3 Lai et al. Hepatology 2003;38:262A2 Lau et al. Hepatology 2004;40:171A 4 Sung et al. J Hepatol 2003 ;38 (suppl 2):25-26 5 Lau et al. Hepatology 2004:40:666A
  121. 121. Study 106 – Treatment-Experienced Patients ‡ Study 106: TDF Versus FTC/TDF for Treatment of CHB in Patients with Persistent Viral Replication Receiving ADV Double Blind RANDOMIZATION 1:1 Tenofovir DF 300 mg Blinded TDF Blinded TDF Blinded TDF (TDF) or or or End of Study OL FTC/TDF OL FTC/TDF OL FTC/TDF FTC 200 mg / Tenofovir Blinded FTC/TDF Blinded FTC/TDF Blinded FTC/TDF DF 300 mg or or or (FTC/TDF) OL FTC/TDF OL FTC/TDF OL FTC/TDF Final Study Results Week 24* Week 48 Week 96 Week 1682010) (AASLD *FromWeek 24 on, patients patients with confirmed4HBV DNA ≥ 400 HBV DNA ≥ 69IU/mL) had the option to add FTC (as fixed dose * From Week 24 on, with confirmed (within weeks) plasma copies/mL (69 IU/mL could switch toBerg T, et al., AASLD 2010; Oral# 136. FTC/TDF) or discontinueFTC/TDF trial and initiatefrom the trial and initiate therapy open label (OL) from the or discontinue commercially available commercially available therapy
  122. 122. Study 106 – Treatment-Experienced Patients ‡ Primary Efficacy Analysis: Comparison of the Two Treatment Strategies % of Patients with HBV DNA < 400 copies/mL (69 IU/mL) 82% FTC/TDF 82% TDF Percentage (%) ITT: NC=F* Two patients on study at Week 168 had HBV DNA ≥400 copies/mL *NC=F, Non-completer counted as failure in this ITT analysis, including patients who switched to open-label FTC/TDF fixed-dose combinationBerg T, et al., AASLD 2010; Oral# 136.
  123. 123. Study 106 – Treatment-Experienced Patients ‡Mean HBV DNA (log10c/mL) by Study Visit Mean (95% CI) HBV DNA (log10 copies/mL) 2.26 TDF 2.24 FTC/TDF * Includes patients who switched to open-label FTC/TDF fixed-dose combinationBert T, et al., AASLD 2010; Oral# 136.
  124. 124. Study 106 – Treatment-Experienced Patients ‡ Mean HBV DNA by Baseline LAM-R and TreatmentBerg T, et al., AASLD 2010; Oral# 136.
  125. 125. Study 106 – Treatment-Experienced Patients ‡ Mean HBV DNA by Baseline ADV-R and TreatmentBerg T, et al., AASLD 2010; Oral# 136.
  126. 126. Viral load 100% 90% 80% 70% 60% A181T 50% A181T + N236T 40% wt 30% LLOD 20% 10% 0% BL W4 W12 W24 W48Patient 1046 data:BL viral load = 6.85log Treatment: TDF Adherence : 68% Lavocat & Zoulim, AASLD 2010.
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×