Chevaliez Hcv  Virus Et Marqueurs
Upcoming SlideShare
Loading in...5
×
 

Like this? Share it with your network

Share

Chevaliez Hcv Virus Et Marqueurs

on

  • 3,656 views

 

Statistics

Views

Total Views
3,656
Views on SlideShare
3,598
Embed Views
58

Actions

Likes
2
Downloads
118
Comments
1

2 Embeds 58

http://www.du-hepatites-virales.org 44
http://www.slideshare.net 14

Accessibility

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
  • http://www.fioricetsupply.com is the place to resolve the price problem. Buy now and make a deal for you.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Chevaliez Hcv Virus Et Marqueurs Presentation Transcript

  • 1. VIRUS DE L’HEPATITE C L’HEPATITE & Marqueurs Stéphane Chevaliez Stéphane Centre National de Référence Centre National de Référence Des Hépatites B, C et delta Des Hépatites B, C et delta Laboratoire de Virologie & INSERM U955 Laboratoire de Virologie & INSERM U955 Hôpital Henri Mondor Hôpital Henri Mondor Université Paris XII Université Paris XII Créteil Créteil
  • 2. Virus de l’Hépatite C l’Hépatite I. Aspects Virologiques
  • 3. Virus de l’Hépatite C et Marqueurs Virus de l’Hépatite C l’Hépatite • Famille : Flaviviridae • Genre : Hepacivirus Phylogénie de la région codant la protéine NS5B Adapted from Simmonds et al., 1999; 2001.
  • 4. Virus de l’Hépatite C et Marqueurs Virus de l’Hépatite C l’Hépatite • Famille : Flaviviridae • Genre : Hepacivirus • Hôte naturel : Homme • Tropisme : Hépatocyte
  • 5. Virus de l’Hépatite C et Marqueurs Organisation Structurale
  • 6. Virus de l’Hépatite C et Marqueurs Organisation Génomique Génomique Protéines structurales Protéines non structurales Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 7. Virus de l’Hépatite C et Marqueurs Fonction des Protéines du VHC Protéines Protéines VHC Fonction Capside Nucléocapside F/ARF ? E1 Enveloppe, domaine de fusion E2 Enveloppe, liaison au récepteur P7/NS1 Canal ionique Ca-dépendant NS2 Autoprotéase NS2-3 NS3 Sérine protéase NTPase/hélicase NS4A Cofacteur de NS3 NS4B Inducteur de la formation du "membranous web" NS5A Indispensable à la réplication, transactivateur? NS5B ARN polymérase ARN-dépendante
  • 8. Virus de l’Hépatite C et Marqueurs Protéine de Capside Protéine – Composant essentiel de la particule virale (nucléocapside) – Formé de deux domaines D1 et D2 – Interaction avec le métabolisme lipidique . Inhibition de la MTP et de la sécrétion des VLDL . Interaction via le domaine D2 avec les gouttelettes lipidiques – Rôle dans la pathogenèse . Déterminant majeur des lésions hépatiques (stéatose, …)
  • 9. VHC génotype 1b Piodi et al., Hepatology 2008, 48(1): 16-27.
  • 10. y x z z x y Piodi et al., Hepatology 2008, 48(1): 16-27.
  • 11. Virus de l’Hépatite C et Marqueurs Protéine NS3 Protéine – Deux régions . Sérine protéase (région N-terminale) . NTPase/hélicase (région C-terminale) – Modulateur de la réponse interféron via les TLR3
  • 12. Virus de l’Hépatite C et Marqueurs Inhibition de la Production d’IFN d’IFN par NS3
  • 13. Virus de l’Hépatite C et Marqueurs Protéine NS3 Protéine – Deux régions . Sérine protéase (région N-terminale) . NTPase/hélicase (région C-terminale) – Modulateur de la réponse interféron via les TLR3 – Cibles de molécules antivirales . Telaprevir (VX-950, Vertex) . Boceprevir (SCH503034, Merck) . R7227 (ITMN191, Roche/Intermune)
  • 14. Site actif (His57, Asp81, Ser139) OPM Database, University of Michigan, College of Pharmacy.
  • 15. Boceprevir (SCH 503034) Telaprevir (VX-950) R7227 (ITMN 191)
  • 16. Virus de l’Hépatite C et Marqueurs Log HCV RNA reduction from baseline Activité Antivirale du TVR Activité 1 Baseline 0 Placebo (n=6) -0,21 -1 Telaprevir 450mg q8h -2 -2,21 (n=10) Telaprevir 1250mg -3 -2,37 q12h (n=10) -4 -4,41 Telaprevir 750mg q8h (n=8) -5 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Days on treatment Reesink et al., Gastroenterology 2006, 131: 997-1002.
  • 17. Virus de l’Hépatite C et Marqueurs Protéine NS5B: RdRp Protéine Lesburg et al., Nat struct Biol 1999, 6: 937-943; Bressanelli et al., Proc Natl Acad Sci USA 1999, 96: 13034-13039; Ago et al., Srructure Fold Des 1999, 7: 1417-1426.
  • 18. Virus de l’Hépatite C et Marqueurs Réplication Virale Réplication – Modèle du poliovirus . Virus à ARN monocaténaire de polarité positive Réplication De Clercq., Nature Review Drug Discovery, 2007; 6: 1001-18
  • 19. Virus de l’Hépatite C et Marqueurs Anti-polymérases Anti-polymérases • Analogues Nucléos(t)idiques – R7128 (Pharmasset) – IDX184 (Idenix Pharmaceuticals) • Analogues non nucléosidiques – Filibuvir (Pfizer) – ANA598 (Anadys Pharmaceuticals) – GS 9190 (Gilead) – ABT-333 (Abbott)
  • 20. Virus de l’Hépatite C et Marqueurs Cibles des Molécules Antivirales Molécules Site C (Palm) Site A (Thumb/fingertips) (A-837093) (JTK-109) Mutants: 411, 414, 448 Mutants: 495, 496, 499 A B E C D Site B (Thumb) HCV-371 Site E (Finger, hypothetical) Mutants: 419, 423, 482 GS-9190 Mutants: 445,448,452 Site D (Palm) (HCV796) Site Actif Mutants: 316 (R7128) Mutants: 282 Copyright © 2006 Merck & Co., Inc., Whitehouse Station, New Jersey, USA
  • 21. Virus de l’Hépatite C et Marqueurs Activité Antivirale du MK-0608 Activité MK-0608 wt S282R/T/I wt S282 MK-0608 at 1mg.kg-1 orally 7 6 HCV RNA (Log IU/mL) 5 4 3 2 - 4,6 - 4,1 LOQ 1 (20 IU/mL) TMA + + + + - - - - - - - - + + 0 -15 -10 -5 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 Days
  • 22. Virus de l’Hépatite C et Marqueurs Cycle Viral Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463
  • 23. Virus de l’Hépatite C et Marqueurs Cycle Viral Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463
  • 24. Virus de l’Hépatite C et Marqueurs Modèle d’Entrée Virale Modèle d’Entrée Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 25. Virus de l’Hépatite C et Marqueurs Cycle Viral Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 26. Virus de l’Hépatite C et Marqueurs Maturation de la Polyprotéine Polyprotéine Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 27. Virus de l’Hépatite C et Marqueurs Structure des Protéines NS Protéines Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 28. Virus de l’Hépatite C et Marqueurs Cycle Viral Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 29. Virus de l’Hépatite C et Marqueurs "Membranous Web" Huh7 naïves Huh7 infectées (réplicon) Gosert et al., J Virol 2003, 77(9): 5487-5492.
  • 30. Virus de l’Hépatite C et Marqueurs Cycle Viral Moradpour et al., Nature Reviews Microbiology, 2007; 5: 453-463.
  • 31. Virus de l’Hépatite C l’Hépatite II. Modèles d’Etude Modèles d’Etude
  • 32. Virus de l’Hépatite C et Marqueurs Modèles Animaux Modèles Souris transgéniques Souris SCID/uPA
  • 33. Virus de l’Hépatite C et Marqueurs Modèles Cellulaires Modèles • Pseudoparticules rétrovirales (HCVpp) • Réplicons génomiques et subgénomiques • Système productif (HCVcc)
  • 34. Virus de l’Hépatite C et Marqueurs Modèles Acellulaires Modèles • Modèles enzymatiques - Protéase NS3/4A - ARN polymérase ARN-dépendante (NS5B) - Cyclophyline B
  • 35. Virus de l’Hépatite C et Marqueurs Mesure de l’Activité Enzymatique l’Activité de RDRp Agent intercalant RdRp PAS DE FLUORESCENCE Matrice ARN simple-brin homopolymérique simple- homopolymé Agent intercalant FLUORESCENCE RdRp ARN double-brin double- - Simple - Sensible - Reproductible A. Ahmed-Belkacen, 2007. - Miniaturisé en microplaques 96 puits
  • 36. Virus de l’Hépatite C l’Hépatite III. Variabilité Génétique Variabilité Génétique
  • 37. Virus de l’Hépatite C et Marqueurs Dynamiques Virales du VIH, VHB et VHC HIV HBV HCV Daily virion production 1010 1012 - 1013 1012 Half-life of free virions (hr) 1 4 (<1) 2-3 Half-life of intracellular Days Months Hours virions Mutation rate Very high High Very high Viral reservoir Integrated cDNA cccDNA No Soriano et al., J Antimicrob Chemother 2008, 62: 1-4, Murray et al., Hepatology 2006, 44: 1117-1121; Dandri et al., Hepatology 2008, 48(4):1079-86.
  • 38. Virus de l’Hépatite C et Marqueurs ARN Polymérase ARN-dépendante Polymérase ARN-dépendante • Erreurs au cours de la réplication – Fréquentes . 10-4-10-4 mutations par nucléotide copié au cours de la réplication du VHC – Spontanées – Au hasard • Absence d’activité exonucléasique 3’⇒5’ ⇒ ("proofreading") – Accumulation de mutations • A l’origine de : – La diversification des types et des sous-types – La distribution en quasi-espèces
  • 39. Virus de l’Hépatite C et Marqueurs Diversification des Génotypes Génotypes Central Africa 7 Simmonds et al. Hepatology 2005; Murphy et al., AASLD, Hepatology, 2007.
  • 40. Virus de l’Hépatite C et Marqueurs Répartition Géographique Répartition Géographique 1a, Adapted from Fang J., et al. J. Clin Liver Dis., 1997.
  • 41. Virus de l’Hépatite C et Marqueurs Génotypes en France Génotypes 2% 9,5% 1a 1a 19% 60% 60% 1b 1b 11 9,5% G1 G2 G3 G4 G5
  • 42. Virus de l’Hépatite C et Marqueurs Intérêts de le Détermination des Intérêts Détermination Génotypes Génotypes • Détermination systématique du génotype – Facteur prédictif de la réponse au traitement – Conditionne . La dose de ribavirine . La durée du traitement (24 vs 48-72 semaines)
  • 43. Virus de l’Hépatite C et Marqueurs Distribution en Quasi-espèce Quasi-espèce Weiner et al., Virology 1991; 180:842-848; Martell et al., J Virol 1992;66:3225-36.
  • 44. Virus de l’Hépatite C et Marqueurs Mécanismes d’Evolution de la Mécanismes d’Evolution Quasi-espèce Quasi-espèce • Dérive génétique – Accumulation de mutations ponctuelles • Glissement génétique – Suite à la modification brutale de l’environnement réplicatif
  • 45. Virus de l’Hépatite C et Marqueurs Distribution en Quasi-espèce Quasi-espèce • Joue un rôle dans le maintien de l’infection chronique • Joue un rôle dans l’échec des traitements antiviraux • Joue un rôle dans la sévérité de la maladie Farci P, 2000; Science, 288: 339-344; Lavillette D, 2005; Journal of Virology, 79(10): 6023-6034; Farci P, 2002; PNAS, 99: 3081-3086; Chambers TJ et al., 2005; 79: 3071-3083; Sullivan et al., JID 2007, 196: 239-248.
  • 46. Virus de l’Hépatite C l’Hépatite IV. Exemples d’Application d’Application de la Variabilité Génétique Variabilité Génétique
  • 47. Virus de l’Hépatite C et Marqueurs Impacts de la Variabilité Génétique Variabilité Génétique du VHC • Diversification et diffusion du VHC • Transmission du VHC • Mécanismes de persistance et d’infection du VHC • Compartimentation tissulaire du VHC • Mécanisme d’échec thérapeutique et de résistance
  • 48. Virus de l’Hépatite C et Marqueurs Impacts de la Variabilité Génétique Variabilité Génétique du VHC • Diversification et diffusion du VHC • Transmission du VHC • Mécanismes de persistance et d’infection du VHC • Compartimentation tissulaire du VHC • Mécanisme d’échec thérapeutique et de résistance
  • 49. Virus de l’Hépatite C et Marqueurs Diversification des Génotypes Génotypes Central Africa 7 Murphy et al., AASLD, Hepatology, 2007.
  • 50. Virus de l’Hépatite C et Marqueurs Génotype & Mode de Transmission Génotype 100% 80% 60% 63% 3 52% 1b 40% 54% 1a Autres 20% 0% UDVI Transfusion Autres Pawlotsky et al., J Infect Dis, 1995; 171(6): 1607-10.
  • 51. Virus de l’Hépatite C et Marqueurs Génotype & Mode de Transmission Génotype 100% 80% 36% 4 60% 3 2 39% 1b 40% 1a 1nt 20% 27% 0% UDVI Transfusion Autres Payan et al., J Viral Hepat 2005;12: 405-13.
  • 52. JK049 HCV-3k TrKj Virus de l’Hépatite C et Marqueurs HCV-3b NE125 HCV-3f NE048 Génotype 3a HCV-3c 98 100 HCV-3a 62 Chez les UDVI 98 92 63 99 81 Argentine 60 Brézil Australie France USA, Côte Est 56 USA, Côte Ouest 52 71 95 0.1 substitution per site 62 83 75 72 79 Morice et al., J Med Virol 2006;78:1296-1303.
  • 53. Virus de l’Hépatite C et Marqueurs Impacts de la Variabilité Génétique Variabilité Génétique du VHC • Diversification et diffusion du VHC • Transmission du VHC • Mécanismes de persistance et d’infection du VHC • Compartimentation tissulaire du VHC • Mécanisme d’échec thérapeutique et de résistance
  • 54. Virus de l’Hépatite C et Marqueurs Transmission Nosocomiale "Mondorienne" • Mise en évidence d’une séroconversion VHC lors du dépistage et du suivi des patients hémodialysés en juillet 2005, à l’hôpital Henri Mondor • L’ensemble des patients hémodialysés ont été testés (anticorps anti-VHC et ARN viral) – Mise en évidence d’un 2nd cas au cours de la même période • Analyses génétique et phylogénique • Recherche du VHC dans l’environnement – Supports et surfaces inertes
  • 55. Virus de l’Hépatite C et Marqueurs Transmission Nosocomiale "Mondorienne" Identification de deux cas de séroconversion en 2004 au sein de l’unité d’hémodialyse de l’hôpital Henri Mondor : – Patient "1" infecté par un génotype 3a – Patient "2" infecté par un génotype 1
  • 56. Virus de l’Hépatite C et Marqueurs Genotype 4 4a_ED43 Genotype 3 100 3a_NLZ1 Analyse Genotype 6 Genotype 5 Genotype 2 5a_SA13 6a_EUHK2 Patient 1 2a_HCJ6 Phylogénique Phylogénique Patient 2** 100 Patient 2* Patient 3 1k_QC82 1k_QC68 1j_QC89 1j_QC2 1a_HCJ1 1a_HCVH 1a_HCV1 1g_EG024 1g_2152 1g_1382 Région NS5B (329 nt) 1e_QC172 CLUSTALX 1e_CAM1078 DNADist (PHYLIP 3.5) 1e_M4541N 1l_98CM1457 Matrice de distance: Kimura 2-parameter (Ts/Tv=2) 1l_98CM1427 Neighbor-Joining 1l_M5186N Bootstraping : 1000 replicates 1c_Khaja1 NJPlot 1c_SR031 1c_HCG9 1b_HCVBK G1 1b_HCP01 Patient 4 Patient 5 100 Patient 6 Patient 7 1b_HCJ4 Patient 8 1d_FR17 1d_BA107 Genotype 1 1d_HC1N16 1m_GUI24 1m_GUI11 1m_GUI17 1iQC181 Séroconversion VHC 1i_QC77 1i_FR16 Patients VHC chronique 1f_FR2 1h_98CM1357 0.05 1h_98CM1521 Girou et al., Clin Infect Disease 2008, 47(5): 627-633. 1h_FrSSD98
  • 57. Virus de l’Hépatite C et Marqueurs Analyse Phylogénique Phylogénique 4a_ED43 Patient 7 Patient 4 Patient 8 1b_AWV2C33 Patient 6 1a_HCT18X5 Région HVR1 (81 nt) 3a_CB CLUSTALX 2a_Q2B DNADist (PHYLIP 3.5) 1a_HCT27X5 Matrice de distance: Kimura 2-parameter (Ts/Tv=2) Neighbor-Joining Patient 3 (01/05) Bootstraping : 1000 replicates NJPlot Patient 3 (7/04) Patient 2 (9/04) Patient 2 (7/04) 100 Patient 3 (9/05) Patient 3 (7/05) 1b_HVR3812 5a_SA13 Patient 1 (7/04) 2b_JFH1 6a_33 Séroconversion VHC 0.2 Patients VHC chronique Girou et al., Clin Infect Disease 2008, 47(5): 627-633.
  • 58. Virus de l’Hépatite C et Marqueurs Analyse Phylogénique Phylogénique 4a_ED43 Patient 7 Patient 4 Patient 8 1b_AWV2C33 Patient 6 1a_HCT18X5 Région HVR1 (81 nt) 3a_CB CLUSTALX 2a_Q2B DNADist (PHYLIP 3.5) 1a_HCT27X5 Matrice de distance: Kimura 2-parameter (Ts/Tv=2) S1 (6/05) Neighbor-Joining Patient 3 (01/05) Bootstraping : 1000 replicates NJPlot S2 (6/05) S3 (6/05) S4 (6/05) Patient 3 (7/04) Patient 2 (9/04) Patient 2 (7/04) 100 Patient 3 (9/05) Patient 3 (7/05) S5 (7/05) 1b_HVR3812 5a_SA13 Patient 1 (7/04) 2b_JFH1 Surfaces inertes 6a_33 Séroconversion VHC 0.2 Patients VHC chronique Girou et al., Clin Infect Disease 2008, 47(5): 627-633.
  • 59. Virus de l’Hépatite C et Marqueurs Transmission Nosocomiale au Bénin Bénin • Screening de 64 patients hémodialysés à l’hôpital Hubert Kutuku Maga, Cotonou, Bénin (Afrique) – Détection anticorps anti-VHC – Détection ARN VHC (limite détection <50UI/mL) • Etude génétique et phylogénique de deux régions distinctes du génome viral – NS5B – Core-E1
  • 60. Virus de l’Hépatite C et Marqueurs Analyse Phylogénique Phylogénique 1mGUI24 1mGUI11 1mGUI17 1dBA107 1dHC1N16 1dFR17 99 Patient 26 Patient 52 59 Patient 60 98 Patient 48 Génotype 1, sous-type i 96 1iQC181 1iQC77 1iFR16 Patient 40 1bHCP01 34 100 1bHCVBK Génotype 1, sous-type b 1bHCJ4 Patient 7 Région NS5B (286 nt) Patient 8 Patient 17 CLUSTALX Patient 18 DNADist (PHYLIP 3.5) Patient 36 Matrice de distance: Kimura 2- 100 Patient 16 Patient 64 Génotype 1, sous-type ? parameter (Ts/Tv=2) Patient 28 Patient 2 Neighbor-Joining Patient 54 72 Patient 46 Bootstraping : 1000 replicates Patient 59 NJPlot 1fFR2 1l98CM1457 43 1l98CM1427 1lM5186N 1gEG024 1g2152 1g1382 1eQC172 1eCAM1078 1eM4541N Génotype 1 1kQC82 1kQC68 1jQC89 1jQC2 1aHCJ1 1aHCVH 1aHCV1 1cKhaja1 1cSR031 1cHCG9 1h98CM1521 1h98CM1357 Génotype 4 1hFrSSD98 4aED43 Génotype 3 100 Patient 62 0.05 Génotype 6 3aNLZ1 Génotype 3, sous-type a 6aEUHK2 Génotype 2 2aHCJ6 Patient 49 Génotype 2 Génotype 5 5aSA13
  • 61. Virus de l’Hépatite C et Marqueurs Transmissions Nosocomiales 1bHVR3812 1bAWV2C33 Patient 60 Patient 48 Patient 52 Patient 40 Patient 26 Région HVR1 (81 nt) CLUSTALX Patient 59 DNADist (PHYLIP 3.5) 5aSA13 Matrice de distance: Kimura 2- parameter (Ts/Tv=2) Patient 46 Neighbor-Joining Patient 54 NJPlot Patient 64 Patient 28 Patient 2 Patient 17 Patient 18 Patient 16 Patient 8 Patient 7 1aHCT27X5 4aED43 6a33 1aHCT18X5 2bJFH1 0.2 3aCB 2aQ2B
  • 62. Virus de l’Hépatite C et Marqueurs Assignation Provisoire d’un Nouveau Sous-type : Etude de la région NS5B 1c_AY051292 1c_AY051292 1c_D14853 1c_D14853 1a_M62321 1a_M62321 1a_M67463 1a_M67463 1k_AY434112 1k_AY434112 1k_AY434122 1k_AY434122 1j_AY434128 1j_AY434128 1j_AY434158 1j_AY434158 1h_AY434131 1g_AF271820 1i_AY434119 1g_AF271822 1b_D90208 1e_AY894555 1b_M58335 1b_D90208 MAXIMUM DE VRAISEMBLANCE 1d_L39299 PARCIMONIE 1b_M58335 1d_L39302 1d_L39299 1g_AF271820 1d_L39302 1g_AF271822 1i_AY434119 1e_AY894555 1h_AY434131 1f_L38350 1f_L38350 Patient 46 Patient 46 Patient 64 Patient 64 Patient 7 Patient 8 Patient 8 Patient 7 Patient 17 Patient 17 0.05 Patient 18 Patient 18 Patient 16 Patient 16
  • 63. Virus de l’Hépatite C et Marqueurs Assignation Provisoire d’un Nouveau Sous-type : Etude de la région Core-E1 1h_AY257087 1a_M62321 1h_AY434132 1a_M67463 1f_L38371 1j_AY434106 1a_M62321 1j_AY434129 1a_M67463 1k_AY434113 1j_AY434106 1k_AY434123 1j_AY434129 1e_L38361 1k_AY434113 1e_AY894553 1k_AY434123 1g_AF271798 1e_L38361 1g_AF271797 1e_AY894553 1c_D14853 1g_AF271798 1c_AY051292 1g_AF271797 1l_AY257083 1c_D14853 1l_AY257091 1c_AY051292 1f_L38371 1l_AY257083 MAXIMUM DE VRAISEMBLANCE 1b_D90208 PARCIMONIE 1l_AY257091 1b_L38372 1b_M58335 1b_M58335 1b_L38372 1i_L48495 1b_D90208 1i_AY434120 1i_L48495 1d_L38377 1i_AY434120 1h_AY257087 1d_L38377 1h_AY434132 Patient 8 Patient 8 Patient 17 Patient 7 Patient 16 Patient 17 Patient 18 Patient 16 Patient 46 Patient 18 Patient 64 Patient 46 0.02 Patient 64 Patient 7
  • 64. Virus de l’Hépatite C et Marqueurs Transmission Nosocomiale en Grèce Grèce • Epidémie à VHC au sein d’une unité d’hémodialyse en Grèce ("Papageorgiou General Hospital", Thessaloniki) Hospital • 17 patients hémodialysés contaminés en quelques mois • Analyses génétique et phylogénique • Etude de la réponse neutralisante – Système HCVpp Lavillette et al., J Virol 2005;79:6023-34
  • 65. Virus de l’Hépatite C et Marqueurs Analyse Phylogénique Phylogénique 1a HCV-1 HCV-H 1c SR052 HC-G9 SR037 HCV-1 HC-J4 HCV-BK BE90 Pt-16 Région HVR1 (81 nt) 1b Pt-2 CLUSTALX Pt-4 DNADist (PHYLIP 3.5) Pt-3 Matrice de distance: Kimura 2- parameter (Ts/Tv=2) Neighbor-Joining Pt-1 Pt-17 Souche A NJPlot Pt-7 Pt-6 Pt-8 Pt-11 Pt-10 0,1 substitution per site Pt-9 Pt-5 Pt-12 Pt-13 Souche B Pt-15 Lavillette et al., J Virol 2005;79:6023-34
  • 66. Virus de l’Hépatite C et Marqueurs Réponse Neutralisante - Groupe 1 Réponse • Absence de réponse neutralisante et absence de contrôle de l’infection ARN VHC % neutralisation (UI/mL) infection 1,E+08 100 200 Huh7 1,E+07 90 180 80 Patient-10 (souche B) 70 160 60 1,E+06 140 50 40 120 1,E+05 30 20 100 1,E+04 10 80 0 ARN VHC -10 60 1,E+03 -20 Réponse Neutralisante 40 -30 1,E+02 -40 20 -50 Contrôle Neutralisation 1,E+01 -60 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 ALAT Semaines Lavillette et al., J Virol 2005;79:6023-34
  • 67. Virus de l’Hépatite C et Marqueurs Réponse Neutralisante - Groupe 2 Réponse • Réponse neutralisante forte et spécifique • Réponse neutralisante inversement proportionnelle à la cinétique de la charge virale ARN VHC (UI/mL) % neutralisation infection 1,E+08 100 200 Huh7 90 180 Patient-1 (souche A) 1,E+07 80 160 1,E+06 70 140 60 120 1,E+05 50 100 1,E+04 40 80 ARN VHC 1,E+03 30 60 Réponse Neutralisante 20 40 1,E+02 10 20 Contrôle Neutralisation 1,E+01 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 0 ALAT Semaines Lavillette et al., J Virol 2005;79:6023-34
  • 68. Virus de l’Hépatite C et Marqueurs Impacts de la Variabilité Génétique Variabilité Génétique du VHC • Diversification et diffusion du VHC • Transmission du VHC • Mécanismes de persistance et d’infection du VHC • Compartimentation tissulaire du VHC • Mécanisme d’échec thérapeutique et de résistance
  • 69. Virus de l’Hépatite C et Marqueurs Histoire Naturelle Hépatite Aiguë Hépatite Chronique 50 - 80% Stéatose 20 - 30 ans Fibrose Cirrhose 20 - 30% Décompensation HCC 6 - 10% 4-5% par an Mortalité
  • 70. Virus de l’Hépatite C et Marqueurs Histoire Naturelle Hépatite Aiguë Hépatite Chronique 50 - 80% Stéatose 20 - 30 ans Fibrose Cirrhose 20 - 30% Décompensation HCC 6 - 10% 4-5% par an Mortalité
  • 71. Virus de l’Hépatite C et Marqueurs Histoire Naturelle Hépatite Aiguë Hépatite Chronique 50 - 85% 10 - 30 ans Cirrhose 20 - 30% Décompensation HCC 6 - 10% 4 - 5% par an Mortalité
  • 72. Virus de l’Hépatite C et Marqueurs Persistance Virale • Persistance virale – Echec de la réponse immune, pourtant présente et adaptée, à éliminer le virus ou les cellules qui l’abritent • Interface complexe
  • 73. Virus de l’Hépatite C et Marqueurs Processus Multi-étape Hépatite Aiguë Infection Chronique Hépatite Chronique 50 - 85% 1. Mise en place de l’infection aiguë 2. Etablissement de la persistance virale 3. Maintient de l’infection au cours du temps
  • 74. Virus de l’Hépatite C et Marqueurs Processus Multi-étape Hépatite Aiguë Infection Chronique Hépatite Chronique 50 - 85% 1. Mise en place de l’infection aiguë 2. Etablissement de la persistance virale ? 3. Maintient de l’infection au cours du temps
  • 75. Virus de l’Hépatite C et Marqueurs Persistance du VHC Adapted from Ferrari C, Gasroenterology 2007; 132(2): 801-805
  • 76. Virus de l’Hépatite C et Marqueurs Impacts de la Variabilité Génétique Variabilité Génétique du VHC • Diversification et diffusion du VHC • Transmission du VHC • Mécanismes de persistance et d’infection du VHC • Compartimentation tissulaire du VHC • Mécanisme d’échec thérapeutique et de résistance
  • 77. Virus de l’Hépatite C et Marqueurs Compartimentation Plasma-PBMC Plasma-PBMC Région 5’NC Région E1-E2 (Pt-3) (Pt-3) Roque-Afonso et al., J Virol 2005;79:6349-57)
  • 78. Virus de l’Hépatite C et Marqueurs Impacts de la Variabilité Génétique Variabilité Génétique du VHC • Diversification et diffusion du VHC • Transmission du VHC • Mécanismes de persistance et d’infection du VHC • Compartimentation tissulaire du VHC • Mécanisme d’échec thérapeutique et de résistance
  • 79. Virus de l’Hépatite C et Marqueurs Résistance du VHC Résistance • Résistance naturelle du VHC à l’interféron • Résistance du VHC à la thérapie par l’interféron • Résistance du VHC aux inhibiteurs spécifiques (DAA)
  • 80. HEPATITE C : Stratégie Stratégie Diagnostique & Suivi Virologique
  • 81. Virus de l’Hépatite C l’Hépatite I. Cinétique des Marqueurs Cinétique Virologiques
  • 82. Stratégie diagnostique & suivi virologique Marqueurs Virologiques Marqueurs indirects Anticorps anti-VHC totaux Marqueurs directs Ag de capside ARN VHC Génotype VHC
  • 83. Stratégie diagnostique & suivi virologique Cinétique des Marqueurs Cinétique Infection Aiguë Symptômes +/- Anti-VHC ARN VHC Titre ALAT Normal 0 1 2 3 4 5 6 12 24 36 48 Temps après contage (mois)
  • 84. Stratégie diagnostique & suivi virologique Cinétique des Marqueurs Cinétique Infection Chronique Anti-VHC Symptômes +/- ARN VHC Titre ALAT Normal 0 1 2 3 4 5 6 12 24 36 48 Temps après contage (mois)
  • 85. Virus de l’Hépatite C II. Tests Virologiques
  • 86. Stratégie diagnostique & suivi virologique Tests Virologiques Moléculaires Moléculaires Tests qualitatifs Tests quantitatifs Très sensibles Seuil de détection ≥ qualitatifs ≤ (≤ 50 IU/mL) Quelle quantité est présente ? Est-ce que le VHC est présent ? Détermination du Génotype Quel type de VHC est présent ?
  • 87. Stratégie diagnostique & suivi virologique Tests Virologiques Moléculaires Moléculaires Tests Qualitatifs - Quantitatifs Est-ce que le VHC est présent et en quelle quantité ? Détermination du Génotype Quel type de VHC est présent ?
  • 88. Stratégie diagnostique & suivi virologique Intérêts de la Détection - Intérêts Détection Quantification de l’ARN VHC l’ARN • Evaluation de la réplication virale chez des patients anticorps anti-VHC positifs • Evaluation de la réponse virologique au cours du traitement standard – Interféron pégylé alpha-2a ou -2b – Ribavirine
  • 89. Stratégie diagnostique & suivi virologique Cinétiques & Réponses au Traitement Peg-IFN-RBV 8 7 ARN VHC (Log10 UI/mL) 6 5 Diminution ≥ 2 Log 4 3 2 Limite de détection 1 (10-15 UI/mL) 0 0 4 8 12 Semaines
  • 90. Stratégie diagnostique & suivi virologique Cinétiques & Réponses au Traitement Peg-IFN-RBV 8 7 ARN VHC (Log10 UI/mL) 6 5 Diminution ≥ 2 Log 4 3 RV lente RVR 2 RVP Limite de détection 1 (10-15 UI/mL) 0 0 2 4 8 12 Semaines
  • 91. Stratégie diagnostique & suivi virologique Techniques Disponibles b-DNA PCR Branched DNA Polymerase chain reaction Amplification du signal Amplification de la cible Quantitative Quantitative
  • 92. Stratégie diagnostique & suivi virologique Principe des Techniques b-DNA PCR Branched DNA Polymerase chain reaction Amplification du signal Amplification de la cible Quantitative Quantitative
  • 93. Stratégie diagnostique & suivi virologique bDNA : Forces & Faiblesses • Forces – Quantification indépendante du génotype – Tolérance de polymorphismes nucléotidiques – Faible volume de prise d’essai – Large intervalle de quantification linéaire . ≥ 6,90 Log10 UI/mL • Faiblesses – Faible sensibilité . LLOD: 2,80 Log10 UI/mL – Faux positifs dans les faibles valeurs – Méthode semi-automatisée (Siemens system 440 analyzer) – 12 contrôles par run
  • 94. Stratégie diagnostique & suivi virologique Principe des Techniques b-DNA PCR Branched DNA Polymerase chain reaction Amplification du signal Amplification de la cible Quantitative Quantitative
  • 95. Stratégie diagnostique & suivi virologique Avantages Techniques de la PCR en Temps Réel – Diminution du risque de contamination – Amélioration de la sensibilité – Augmentation de l’intervalle de quantification linéaire – Précision et reproductibilité – Augmentation de débit à travers l’automatisation – Diminution des coûts
  • 96. Stratégie diagnostique & suivi virologique Intervalles de Quantification 10 102 103 104 105 106 107 108 Cobas Amplicor HCV Monitor v2.0 SuperQuant LCx HCV RNA Assay Versant HCV RNA 3.0 (bDNA)
  • 97. Stratégie diagnostique & suivi virologique Intervalles de Quantification 10 102 103 104 105 106 107 108 Cobas Amplicor HCV Monitor v2.0 SuperQuant LCx HCV RNA Assay Versant HCV RNA 3.0 (bDNA) TaqMan 48 HCV (Roche) HCV Quant ASR (Abbott) Versant HCV RNA 1.0 (kPCR, Siemens)* *en développement
  • 98. Stratégie diagnostique & suivi virologique Avantages Techniques de la PCR en Temps Réel – Diminution du risque de contamination – Amélioration de la sensibilité – Augmentation de l’intervalle de quantification linéaire – Précision et reproductibilité – Augmentation du débit à travers l’automatisation – Diminution des coûts
  • 99. Stratégie diagnostique & suivi virologique Avantages Cliniques de la PCR en Temps Réel • Remplace les techniques qualitatives de détection de l’ARN VHC • Quantifie l’ensemble des charges virales observées en pratique clinique – Faibles charges virales au cours du traitement • Surveille efficacement les cinétiques virales (évaluation précoce des réponses virologiques au traitement)
  • 100. Stratégie diagnostique & suivi virologique Quantification de l’ARN VHC (CTM, Roche) 8 HCV RNA level in CAP/CTM48 (Log10 IU/mL) 7 Genotype 1 (n=29) 6 Genotype 2 (n=27) Genotype 3 (n=29) 5 Genotype 4 (n=30) Genotype 5 (n=9) 4 Genotype 6 (n=2) r = 0.889; p < 0.0001 3 3 4 5 6 7 8 HCV RNA level in Versant HCV 3.0 Assay bDNA (Log10 UI/mL) Chevaliez et al., 2007; Hepatology, 46(1): 22-31.
  • 101. Stratégie diagnostique & suivi virologique Différences de Quantification Difference between HCV RNA levels measured in CAP/CTM and in bDNA (in Log10 UI/mL) CAP-CTM48 (Roche) versus bDNA 3.0 (Siemens) 1.5 1.0 0.5 Genotype 1 (n=29) 0.0 Genotype 2 (n=27) Genotype 3 (n=29) -0.5 Genotype 4 (n=30) -1.0 Genotype 5 (n=9) Genotype 6 (n=2) -1.5 15% 30%
  • 102. Stratégie diagnostique & suivi virologique Absence de Détection de l’ARN Viral de Patients Infectés par un VHC de Génotype 4 (Log10IU/mL) CAP/CTM96 m2000SP/m2000RT Versant 3.0 Patient 1 (4h) <1.08 5.4 5.0 Patient 2 (4l) <1.08 6.0 5.7 80 90 100 110 120 130 140 150 160 170 180 |.........|.........|.........|.........|.........|.........|.........|.........|.........|.........| F_7157 (4a): TAGCCATGGCGTTAGTATGAGTGTTGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATCGCCGG Patient 1 (4h): ...........................A.....................................A...................T............... Patient 2 (4l): ...........................A.....................................A...................T............... 190 200 210 220 230 240 250 260 270 .........|.........|......-...|.........| .........|.........|.........|.........| .........|........ F_7157 (4a): GATGACCGGGTCCTTTCTTGGATTAA-CCCGCTCAATGCCCGGAAATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCC Patient 1 (4h): ......................A.T.A.......................................................................... Patient 2 (4l): .......................C..-.......................................................C.......T.......... 280 290 300 310 320 330 340 |.........|.........|.........|.........|.........|.........|. F_7157 (4a): TTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACC Patient 1 (4h): ............................................................. Patient 2 (4l): ............................................................. Chevaliez et al., 2008; Hepatology, 49(4): 1397-1398.
  • 103. Stratégie diagnostique & suivi virologique Quantification de Transcrits d’ARN Sauvages ou Mutés en Position 145 et/ou 165 Measured HCV RNA levels (Log10 IU/mL) HCV 5’NC sequence Real-time PCR assays bDNA assay CTM m2000 Versant 3.0 Wild-type (G145 and 5.73±0.13 6.05±0.10 6.43±0.01 A165) Single mutant (G145A and 4.02±0.13 6.00±0.11 6.69±0.02 A165) Single mutant (G145 and 4.28±0.35 5.88±0.20 6.30±0.02 A165T) Double mutant (G145A <1.08* 5.95±0.25 6.60±0.18 and A165T) *Target not detected Chevaliez et al., Hepatology, 2009, 50(5): 1681.
  • 104. Stratégie diagnostique & suivi virologique Quantification de l’ARN VHC (m2000, Abbott) HCV RNA level in m2000SP/m2000RT (Log10 IU/mL) 8 7 Genotype 1 (n=55) 6 Genotype 2 (n=21) Genotype 3 (n=29) 5 Genotype 4 (n=24) Genotype 5 (n=9) 4 Genotype 6 (n=3) r = 0.972; p < 0.0001 3 3 4 5 6 7 8 HCV RNA level in Versant HCV 3.0 Assay bDNA (Log10 UI/mL) Chevaliez et al., J Clin Microbiol, 2009,47(6):1726-32.
  • 105. Stratégie diagnostique & suivi virologique Quantification de l’ARN VHC (kPCR, Siemens) 132 clinical samples David Sherman., Molecular Symposium, September 2007 (source: Siemens Medical Solutions Diagnostics).
  • 106. Stratégie diagnostique & suivi virologique Génotypes du VHC Génotypes Central Africa 7 Simmonds et al. Hepatology 2005; Murphy et al., AASLD, Hepatology, 2007.
  • 107. Stratégie diagnostique & suivi virologique Intérêts de la Détermination du Intérêts Détermination Génotype Génotype • Détermination systématique du génotype – Facteur prédictif de la réponse au traitement – Conditionne . La dose de ribavirine . La durée du traitement (24 vs 48 semaines)
  • 108. Stratégie diagnostique & suivi virologique Détermination du Génotype Détermination Génotype • Détermination moléculaire du génotype VHC (génotypage) • Détermination sérologique du génotype VHC (“sérotypage”)
  • 109. Stratégie diagnostique & suivi virologique Détermination du Génotype Détermination Génotype • Détermination moléculaire du génotype VHC (génotypage) • Détermination sérologique du génotype VHC (“sérotypage”)
  • 110. Stratégie diagnostique & suivi virologique Régions Virales Ciblées Régions Ciblées – Complete genome (new subtype identification) – NS5B coding region (the reference region) – Envelope E1 coding region (the second reference region) – 5’-untranslated region, 5’UTR (the most frequently used in practice)
  • 111. Stratégie diagnostique & suivi virologique Méthodes Moléculaires de Génotypage Méthodes Moléculaires Génotypage • Séquençage direct des produits d’amplification1 • Hybridation inverse des produits d’amplification sur support solide : Line Probe Assay (INNO-LiPA HCV, Innogenetics) • PCR en temps réel à l’aide de primers et/ou sondes génotype spécifiques • Autres méthodes : – Restriction fragment length polymorphism analysis (RFLP) – Single-strand conformation polymorphism analysis (SSCP) – Spectrométrie de masse MALDI-TOF après miniséquençage Arens et al., J Clin Virol, 2001; 22:11-29; Davidson et al., J Gen Virol 1995; 76: 1197-204; Lareu et al., 1997; Le Pogam et al., 1998; J Clin Microbiol; 36: 1461-3; Ilina et al., J Clin Miocrobiol, 2005; 43(6): 2810-15.
  • 112. Stratégie diagnostique & suivi virologique Analyse Après Séquençage Direct • The reference method • Direct sequence analysis of NS5B or, eventually , E1 is used for accurate genotype and subtype determination • Direct sequence analysis of the 5’UTR can be used in clinical practice.
  • 113. Stratégie diagnostique & suivi virologique TRUGENE® HCV 5’NC Genotyping (Siemens) • One-step RT-PCR generating a 244-bp fragment • PCR products are sequenced in both senses • Forward and reverse sequences are aligned with prototype reference strain sequences from the GeneLibrarian database • The HCV genotype is determined by sequence homology Young et al., J Clin Microbil, 1993; 31: 882-86; Roos et al., J Cli Microbiol, 2000; 38(10): 3581-84; Germer et al., J Clin Microbiol, 2003; 41(10): 4855-577
  • 114. Stratégie diagnostique & suivi virologique Analyse Après Séquençage Direct • Pros – Reference method for HCV genotype and subtype determination – Can be used, with the appropriate target region, for . Identification of new subtypes . Molecular epidemiology studies – Assays are available for use in clinical practice • Cons – Mixed genotype infections are not detected – Labor intensive and time-consuming – Costly
  • 115. Stratégie diagnostique & suivi virologique Hybridation Inverse • Line probe assay • Based on reverse hybridization of PCR products onto genotype-specific probes • Two generations of assays – 1st-generation assay: probes in the 5’UTR – 2nd-generation assay: probes in the 5’UTR and core region
  • 116. Stratégie diagnostique & suivi virologique Versant® HCV Genotype 2.0 Assay ® (INNO-LiPA) (INNO-LiPA)
  • 117. Stratégie diagnostique & suivi virologique Hybridation Inverse • Pros – Easy to use and potential semi-automation (Auto- LiPA) – Cheaper – Mixed genotype infections can be detected • Cons – Should not be used for identification of new subtypes or molecular epidemiology studies because of possible mis-subtyping
  • 118. Stratégie diagnostique & suivi virologique Intérêts de la Détermination du Intérêts Détermination Sous-Type ? Sous-Type • DAA drugs may have different antiviral efficacies on different HCV genotype 1 subtypes in vitro and in vivo • DAA drugs administration may be associated with different resistance profiles with different HCV genotype 1 subtypes in vitro and in vivo
  • 119. Stratégie diagnostique & suivi virologique Activité Antivirale Sous-Type Dépendant • BILB 1941, an NNI inhibitor of HCV RNA- dependent RNA polymerase, showed better antiviral efficacy in HCV subtype 1b than in subtype 1a – In vitro, EC50s: 84 nM in subtype 1a vs 153 nM in subtype 1b – In vivo, over 5 days of administration in HCV-infected patients Erhardt et al., Antivir Ther 2009, 14: 23-32.
  • 120. Stratégie diagnostique & suivi virologique Profil de Résistance Sous-Type Dépendant • HCV genotype 1 subtype-specific resistance to telaprevir – In vitro, R155K substitutions are selected only in genotype 1a replicons – In vivo, amino acid substitutions at positions 36 and 155 are selected only in patients infected with subtype 1a • HCV genotype 1 subtype-specific fitness of variants resistant to HCV-796 – In patients infected with subtype 1b, the C316Y substitution is found alone in fit resistant variants – In patients infected with subtype 1a, the C316Y substitution requires additional substitutions to gain full fitness Kieffer et al., hepatology 2007, 46: 631-639; Sarrazin et al., Gastroenterology 2007, 132: 1767-1777;; Delano et al., 1st International Workshop on HepC Resistance and New Compounds 2006; McCown et al., Antimicrob Agents Chemother 2009.
  • 121. Stratégie diagnostique & suivi virologique Importance de la Région Virale Région pour la Détermination du Sous-type Détermination Sous-type 1st Generation of 2nd Generation of Sequence Analysis RealTime HCV Line Probe Assay Line Probe Assay of the 5’NCR Genotype II (LiPA 1.0) (LiPA 2.0) GT 1a 77.6% 70.5% 97.5% 93.2% (n=237) (n=184) (n=167) (n=231) (n=220) GT 1b 90.5% 91.3% 96.2% 88.6% (n=263) (n=238) (n=240) (n=253) (n=233) Chevaliez et al., PLoS One 2009, 4(12): e820.
  • 122. Stratégie diagnostique & suivi virologique Intérêts des "Nouveaux" Tests Intérêts Sérologiques ? Sérologiques • Détection - quantification de l’antigène de capside (AgC) • Test de détection des antigènes et des anticorps (combo)
  • 123. Stratégie diagnostique & suivi virologique Antigène de Capside : Marqueur Indirect de la Réplication Virale r = 0.92; p < 0.0001 Bouvier-Alias et al., Hepatology 2002, 36(1): 211-218.
  • 124. Stratégie diagnostique & suivi virologique Intérêts de la Détection- Quantification de l’Ag de Capside • Diagnostic de l’infection virale C – Marqueur sérologique précoce . Réduction de la fenêtre sérologique à environ 20 jours . Génotype-indépendant – Facile à mettre en œuvre, rapide, bon marché (ELISA automatisée) – Trousse commerciale • Décision de traiter et Monitoring de l’efficacité du traitement – Marqueur indirect de la réplication virale . 1 pg d’Ag C ≈ 8 000 UI/mL ARN – Alternative aux méthodes moléculaires de quantification de l’ARN – Seuil de quantification équivalent à 20 000 UI/mL d’ARN Bouvier-Alias et al., Hepatology 2002, 36(1): 211-218; Mehdi et al., Clin Biochem. 2008, 41(18):1493.
  • 125. Stratégie diagnostique & suivi virologique Détection Simultanée Ag/Ac (Test Combo) • Diagnostic de l’infection virale C – Réduction de la fenêtre sérologique (~20 jours) . ~60 jours avec les dernières générations de trousses anticorps . ~40 jours ave les trousses Combo – Alternative aux méthodes de DGV – Facile à mettre en œuvre, rapide (ELISA automatisé) – Trousses commerciales – Pas aussi sensible que les méthodes qualitative de détection de l’ARN et de détection de l’Ag de capside Laperche et al. J Clin Micribiol 2005, 43(8): 3877-3883; Alzahrani AJ., J Med Virol 2008, 80(4): 603-6.
  • 126. Virus de l’Hépatite C III. Diagnostic Virologique
  • 127. Stratégie diagnostique & suivi virologique Diagnostic de l’Infection Aiguë l’Infection Aiguë Ac anti-VHC ARN VHC* Diagnostic - - Absence d’infection aiguë - + Infection aiguë C + - Probablement pas d’infection aiguë + + Difficile de conclure * Technique sensible seuil de détection ≤ 10-15 UI/mL
  • 128. Stratégie diagnostique & suivi virologique Diagnostic de l’Infection Aiguë l’Infection Aiguë • Facteurs supplémentaires à prendre en compte chez des populations à risque – Niveaux de charges virales – Variation de la charge virale 4 et 10 semaines après la suspicion de l’hépatite aiguë – Activité sérique des transaminases McGovern et al., CID 2009, 49: 1051-1060.
  • 129. Stratégie diagnostique & suivi virologique Algorithme pour le Diagnostic de l’Hépatite Aiguë* Suspicion d’hépatite aiguë ARN VHC Fluctuations ARN Fluctuations ARN Séroconversion < 5Log10 UI/mL >1 Log10 UI/mL <1 Log10 UI/mL ou ARN VHC > 5 Log10 UI/mL ALAT> 7xLSN ALAT> 7xLSN Probabilité Probabilité Probabilité Hépatite aiguë élevée modérée faible *population à risque (IDVU) McGovern et al., CID 2009, 49: 1051-1060.
  • 130. Stratégie diagnostique & suivi virologique Diagnostic de l’Infection Chronique l’Infection – Détection des anticorps anti-VHC totaux par ELISA – Recherche d’ARN du VHC par un test sensible* – Détection d’ARN du VHC* si le test ELISA est négatif chez des patients hémodialysés ou immunodéprimés * Technique sensible seuil de détection ≤ 10-15 UI/mL
  • 131. Virus de l’Hépatite C III. Prise en Charge Thérapeutique
  • 132. Stratégie diagnostique & suivi virologique Intérêts des Tests Virologiques en Intérêts Thérapeutique Thérapeutique – Décision de traiter – Optimisation du schéma thérapeutique – Etude de la réponse virologique au traitement Consensus conference: treatment of hepatitis C; 2002, Gastroenterol Clin Biol, 26(2): B303-20.
  • 133. Stratégie diagnostique & suivi virologique Classification des Patients Génotypes VHC Type Types Types 1 2, 3 4, 5, 6 Consensus conference: treatment of hepatitis C; 2002, Gastroenterol Clin Biol, 26(2): B303-20
  • 134. Stratégie diagnostique & suivi virologique Indications Actuelles du Traitement • Patients infectés par un VHC de génotype 1 – Interferon pégylé plus ribavirine (1000 - 1400 mg/j) – Durée : 48 semaines • Patients infectés par un VHC de génotype 2/3 – Interferon pégylé plus ribavirine (800 mg/j) – Durée : 24 semaines • Patients infectés par une VHC de génotype 4, 5 et 6 – Interferon pégylé plus ribavirine (1000 - 1400 mg/j) – Durée : 48 semaines Consensus conference: treatment of hepatitis C; 2002, Gastroenterol Clin Biol, 26(2): B303-20
  • 135. Génotype VHC VHC-1 (4,5,6) VHC-2,3 Quantification ARN Bithérapie Bithérapie 48 semaines 24 semaines Ribavirine 1000-1400 mg Ribavirine 800 mg Quantification ARN à S12 Diminution < 2 Log Diminution ≥ 2 Log diminution ≥ 2 Log ARN VHC + ARN VHC - Arrêt traitement poursuite avec Poursuite jusqu’à IFN pégylé pour S24 ralentir la progression de la Si ARN VHC - maladie Poursuite jusqu’à Poursuite jusqu’à hépatique S48 S48
  • 136. Stratégie diagnostique & suivi virologique Optimisation du Traitement en Fonction de la Réponse Virologique Réponse • Outils virologiques sensibles – Sensibilité : 10-15 UI/mL – Evaluation de la réponse au traitement • Répondeurs virologiques rapides – Raccourcissement de la durée de traitement • Répondeurs virologiques précoces partiels – Allongement de la durée de traitement
  • 137. Raccourcissement de la Durée de Traitement
  • 138. Stratégie diagnostique & suivi virologique Réponses aux Semaines 4 et 12 : Facteur Pronostique de la RVS RVR à S4 Absence de RVP à S24 (n=62) (n=228) (n=62) (n=228) (n=125) (n=125) (n=221) (n=221) Martinot-Peignoux et al., Ant Therapy 2009, 14: 501-511.
  • 139. Stratégie diagnostique & suivi virologique Réponses aux Semaines 2 et 4 : Facteur Pronostique de la RVS PegIFN alpha-2a 180µg/s + RBV 1000-1200 mg/j (n=98) AlbIFN 900µg/2s + RBV 1000-1200 mg/j (n=96) AlbIFN 1200µg/2s + RBV 1000-1200 mg/j (n=78) AlbIFN 1200µg/4s + RBV 1000-1200 mg/j (n=96) Neumannet al., J Hepatol 2009, 51: 21-28.
  • 140. Stratégie diagnostique & suivi virologique Réduction de l’ARN du VHC à J2 : Facteur Pronostique de la RVS Δ(to-t2) Log ° N° de patients ARN VHC RVS Pas de RVS VPP (%) VPN (%) Cutoff à 2,5 88 54 >2,5 29 4 ≤2,5 38 48 Cutoff à 0,8 67 95 >0,8 66 32 ≤0,8 1 20 Durante-Mangoni et al., Clin Infect Dis 2009, 49: 498-506.
  • 141. Stratégie diagnostique & suivi virologique Importance de la RVR • Analyse rétrospective de patients infectés par un VHC de génotype 1 traités pendant 48 semaines par pegIFN alfa-2a + RBV (N = 453) 100 91 80 66 RVS (%) 60 45 40 20 2 0 4 12 24 ARN VHC Semaine ARN négatif Positif À S24 Ferenci P, et al. J Hepatol. 2005;43:425-433.
  • 142. Stratégie diagnostique & suivi virologique Traitement Court : Génotype 1 Génotype • Patients par un VHC de génotype 1 – ARN VHC < 600,000 IU/ml – PegIFN-α2b + ribavirine – 24 semaines de traitement – Comparaison des données obtenus avec les résultats de l’étude pivot (Mann et al., Lancet 2001) Zeuzem et al., J Hepatol 2006;44:97-103.
  • 143. Stratégie diagnostique & suivi virologique Traitement Court : Génotype 1 Génotype 100 90 80 70 60 % SVR 24 weeks 50 48 weeks 40 (Mann et al., 30 2001) 20 10 0 Week 4 Week 12 Week 24 Time to first negative HCV RNA (< 50 IU/ml) Zeuzem et al., J Hepatol 2006;44:97-103.
  • 144. Stratégie diagnostique & suivi virologique Traitement court : Génotype 1 Génotype Peg-IFN alpha 2a 180 µg/semaine + RBV 800 ou 1000-1200 mg/j 100 89% 88% 91% 24-DF 80 73% 24-DS 48-DF % de RVS 60 48-DS 44% 40 35% 23% 20 16% 0 ARN VHC < 50 UI/mL à S4 ARN VHC > 50 UI/mL à S4 Jensen et al., Hepatology 2006;43:954-960
  • 145. Stratégie diagnostique & suivi virologique Etude ACCELERATE : Génotypes 2/3 Génotypes 100 p=<0.0001 p=0.1565 90 80 82% 70 60 71% % RVS 65% 65% 16 semaines 50 24 semaines 40 30 20 10 0 Génotype 2 Génotype 3 Shiffman et al., EASL 2006.
  • 146. Stratégie diagnostique & suivi virologique Etude ACCELERATE : Génotypes 2/3 Génotypes Rapid virological response No rapid virological response HCV RNA < 50 IU/ml at week 4 HCV RNA ≥ 50 IU/ml at week 4 100 100 90 90 80 90% 80 70 82% 70 60 16 semaines 60 50 24 semaines 50 40 40 49% 30 30 20 20 27% 10 10 0 0 SVR rate SVR rate Shiffman et al., EASL 2006.
  • 147. Stratégie diagnostique & suivi virologique Traitement court : Génotypes 2/3 Génotypes PegIFN-α2b % Sustained virological response 100 90 97% 93% 92% 80 84% 70 60 14 weeks 50 40 24 weeks 30 20 10 0 Genotype 2 Genotype 3 RVR (HCV RNA < 50 IU/ml at week 4) Dalgard et al., Hepatology 2008;47:35-42
  • 148. Stratégie diagnostique & suivi virologique Traitement court : Génotypes 2/3 Génotypes PegIFN-α2a 100 91% % Sustained virological response 90 80 71% 70 62% 60 50 12 weeks 41% 40 24 weeks 30 20 10 0 N 120 111 68 71 RVR No RVR Lagging et al., Hepatology 2008;47:1837-45.
  • 149. Stratégie diagnostique & suivi virologique Résumé Résumé • Durée de traitement de 6 mois chez tous les patients avec une RVR indépendamment du génotype • Raccourcissement de la durée de traitement à 12 ou 16 semaines chez les patients infectés par une génotype 2/3 avec un ARN indétectable à S1 ou S2 (?)
  • 150. Allongement de la Durée de Traitement
  • 151. Stratégie diagnostique & suivi virologique Traitement Long : Génotypes 2/3 Génotypes • Older age • Male gender • High BMI • Fibrosis ≥ F3
  • 152. Stratégie diagnostique & suivi virologique Génotype 1 : Traitement Long Génotype 100 90 80 70 % SVR 60 50 40 53% 54% 30 20 10 0 48 weeks 72 weeks (n=230) (n=225) Berg et al., Gastroenterology 2006;130:1086-97
  • 153. Stratégie diagnostique & suivi virologique Génotype 1 : Traitement Long Génotype 100 NS NS 80 48 semaines % de RVP 60 NS 72 semaines 40 P<0.05 20 0 S4 S 12 S4 S 12 ARN VHC < 50 UI/ml ARN VHC ≥ 50 UI/ml Berg et al., Gastroenterology 2006;130:1086-97
  • 154. Stratégie diagnostique & suivi virologique Résumé Résumé • Allongement de la durée de traitement à 72 semaines améliore la RVS : – Chez les patients avec une RVP partielle – Chez les non-répondeurs à un premier traitement par une bi-thétrapie standard qui sont retraités