Chevalier  du 2012.ppt
Upcoming SlideShare
Loading in...5
×
 

Chevalier du 2012.ppt

on

  • 1,379 views

 

Statistics

Views

Total Views
1,379
Views on SlideShare
1,379
Embed Views
0

Actions

Likes
0
Downloads
83
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Chevalier  du 2012.ppt Chevalier du 2012.ppt Presentation Transcript

  • Hépatite CVirus & Marqueurs Stéphane Chevaliez Centre  Na)onal  de  Référence   des  Hépa)tes  Virales  B,  C  et  delta   Laboratoire  de  Virologie  &  INSERM  U955   Hôpital  Henri  Mondor   Université  Paris-­‐Est   Créteil  
  • Hépatite C : virus et marqueurs Virus de l’Hépatite C •   Découvert  par  Houghton  en  1989   •   1ère  cause  d’hépa)te  chronique  et  de  cirrhose  en   Europe  et  en  Amérique  du  Nord   •   1ère  indica)on  de  transplanta)on  hépa)que  dans  les   pays  industrialisés  Afdhal,  NH.  2004;  Sem  Liv  Dis,  24(Supp  2):  3-­‐8  
  • Hépatite C : virus et marqueursVirus de l’Hépatite C•  Famille  :  Flaviviridae  •  Genre  :  Hepacivirus   Phylogénie  de  la  région  codant  la  protéine  NS5B  Adapted from Simmonds et al., 1999; 2001.
  • Hépatite C : virus et marqueursVirus de l’Hépatite C•  Famille  :  Flaviviridae  •  Genre  :  Hepacivirus  •  Hôte  naturel  :  Homme  •  Tropisme  :  Hépatocyte  
  • Hépatite C : virus et marqueursOrganisation Structurale
  • Hépatite C : virus et marqueursOrganisation Génomique des Flaviviridae 0   1800   3600   5400   7200   9000   10800   Hepa//s  C  virus   5’UTR   3’UTR   C   E1   E2   NS2   NS3   NS4B NS5A     NS5B   p7   4A   Pes/virus   5’UTR   3’UTR   C E0 E1       E2   NS2   NS3   NS4B   NS5A   NS5B   Npro   4A   p7   Yellow  fever  virus   5’UTR   3’UTR   prM   Cap C     E   NS1   2A 2B     NS3   NS4A 4B     NS5  
  • Hépatite C : virus et marqueursOrganisation Génomique Protéines structurales Protéines non structuralesPopescu  and  Dubuisson,  Bio.  Cell  2010,  102(1):  63-­‐74.  
  • Hépatite C : virus et marqueursOrganisation GénomiqueBartenschlager  et  al,  Trends  Microbiol,  in  press.  
  • Hépatite C : virus et marqueursIRES et TraductionFrom  Department  of  Structural  Biology,  Stanford  University  Medical  School,  USA.  
  • Hépatite C : virus et marqueursRéseaux d’InteractionsPark  et  al,  BMC  BioinformaTcs  2010,  11(Suppl  1):  S23.  
  • Hépatite C : virus et marqueursProtéine de CapsideBoulant  et  al,  J  Virol  2005,  79(17):  11353-­‐11365.  
  • VHC G1bPiodi  et  al.,  Hepatology  2008,  48(1):  16-­‐27.  
  • Hépatite C : virus et marqueurs Capside et LipidesBartenschalger  et  al.,  Tends  Microbiol,  in  press.  
  • Hépatite C : virus et marqueurs Interaction entre la Capside et DGAT-1 *Diacylglycérol diacyltransférase-1Herker  et  al.,  Nat  Med  2010,  16(11):  1295-­‐1298.  
  • Hépatite C : virus et marqueurs Glycoprotéine E2 •  Hétérodimère avec E1 •  Régions hypervariables –  HVR1 –  HVR2 –  igVR •  Rôles –  HVR2 et igVR indispensables au “folding“ E1-E2 –  Étapes précoces (interaction avec CD81, peptide de fusion)Krey  et  al.,  PLoS  Pathog.  2010,  6(2):  e1000762;  McCaffrey  et  al.,  J  Gen  Virol  2011,  92:  112-­‐121.  
  • Hépatite C : virus et marqueursÉtape Précoce : Entrée du VHCPopescu  et  al.,  Bio  Cell  2010,  102:  63-­‐74.  
  • Hépatite C : virus et marqueursHVR1 Région HVR1 (27 amino-acides) Ø  80% de divergence nucléotidique entre génotypes Ø  Epitope majeur de neutralisationTimm  et  al.,  World  J  Gastroenterol  2007;  13(36)4808-­‐4817.    
  • Hépatite C : virus et marqueursTransmission du VHC
  • Hépatite C : virus et marqueursAnalyse Phylogénique 4a_ED43 Patient 7 Patient 4 Patient 8 1b_AWV2C33 Patient 6 1a_HCT18X5 Région HVR1(81 nt) 3a_CB CLUSTALX 2a_Q2B DNADist (PHYLIP 3.5) 1a_HCT27X5 Matrice de distance: Kimura 2-parameter (Ts/Tv=2) S1 (6/05) Neighbor-Joining Bootstraping : 1000 replicates Patient 3 (01/05) NJPlot S2 (6/05) S3 (6/05) S4 (6/05) Patient 3 (7/04) Patient 2 (9/04) Patient 2 (7/04) 100 Patient 3 (9/05) Patient 3 (7/05) S5 (7/05) 1b_HVR3812 5a_SA13 Patient 1 (7/04) 2b_JFH1 Surfaces inertes 6a_33 Séroconversion VHC 0.2 Patients VHC chroniquesGirou  et  al.,  Clin  Infect  Disease  2008,  47(5):  627-­‐633.  
  • Hépatite C : virus et marqueursProtéine p7•  Viroporine  dont  la   structure  3D  a  été   récemment  déterminée  par   ME  •  Rôle(s)  in  vivo  ?  •  Cible  thérapeu)que   poten)elle   Luik  et  al.,  Proc  Natl  Acad  Sci  2009,  4;106(31):  12712-­‐6;  Griffin  S,  Proc  Natl  Acad  Sci  2009,  106(31):  12567-­‐68.  
  • Hépatite C : virus et marqueursActivité Antivirale du BIT225•  IC50  de  314  nM  dans  le  modèle  du  BVDV  •  Ac)vité  synergique   Luscombe  et  al.,  AnTviral  Res  2010  May;86(2):144-­‐53.  
  • Hépatite C : virus et marqueursProtéine NS2•  NS2  (région  N-­‐ter)   –  Rôle  dans  l’organisaTon  de   la  formaTon  des   nucléocapsides  •  NS2pro  (région  C-­‐ter)   Jirasko  et  al.,  PLoS  pathog  2010  Dec  16;6(12):  e1001233;  Ivo  et  al.,  Nature  2006,  442:  831-­‐835.  
  • Hépatite C : virus et marqueursProtéine NS3-4ARaney  et  al.,  J  Biol  Chem  2010,  285(30):  22725-­‐731.  
  • Hépatite C : Nouvelles Hepatite C : virus et marqueursInhibition de la Production d’IFN par NS3
  • Hépatite C : virus et marqueursProtéase NS3Raney  et  al.,  J  Biol  Chem  2010,  285(30):  22725-­‐731.  
  • Hépatite C : virus et marqueursEtudes de Phase III Présentées à l’AASLD™2010•  SPRINT-­‐2   BOCEPREVIR  (BOC)  •  RESPOND-­‐2  •  ADVANCE  •  ILLUMINATE   TELAPREVIR  (TVR)  •  REALIZE  
  • Hépatite C : virus et marqueurs SPRINT-2—BOC + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : Design de l’Etude S4 S28 S48 S72 48  PR   PR     PR  +  placebo   Suivi   n  =  363   Lead-­‐in   ARN-­‐VHC  indétectable  à  S8-­‐24     Suivi  S24  BOC/TGR   PR     PR  +  boceprevir   ARN-­‐VHC  détectable  à  S8-­‐24     n  =  368   Lead-­‐in   P/R  +  placebo   Suivi  BOC/PR48   PR     n  =  366   Lead-­‐in   PR  +  boceprevir   Suivi   *BOC  800  mg  q8h;  pegIFN  alfa-­‐2b  1,5  µg/kg/s;  RBV  600-­‐1400  mg/j  adaptée  au  poids.   Poordad F, et al. N Engl J Med. 2011;364:1195-1206.
  • Hépatite C : virus et marqueursSPRINT-2—BOC + PegIFN + RBV chez des Patients Naïfs deGénotype 1 : Caractéristiques des Patients Cohorte 1 (caucasiens) [n=938] PR48 BOC/RGT BOC/PR48 n=311 n=316 n=311 Sexe masculin [n(%)] 171 (55) 198 (63) 187 (60) Age (années) [moyenne] 48 49 49 IMC (kg/m2) [moyenne (±DS)] 27 (±5) 28 (±5) 27 (±5) ARN du VHC >400,000 UI/mL [n(%)] 286 (92) 287 (91) 289 (93) Type/sous-type du VHC [n(%)]* 1a 186 (60) 196 (62) 196 (63) 1b 112 (36) 110 (35) 102 (33) Fibrose sévère/Cirrhose 22 (7) 25 (8) 37 (12) (METAVIR F3/F4) [n(%)] *La  déterminaTon  du  type  et  du  sous-­‐type  a  été  réalisée  par  séquençage  d’une  porTon  de  la  région  NS5B  codant  l’ARNpol  (méthode  de  référence)  Poordad F, et al. N Engl J Med. 2011;364:1195-1206.
  • Hépatite C : virus et marqueursSPRINT-2—BOC + PegIFN + RBV chez desPatients Naïfs de Génotype 1 : RVS et Taux deRechute p  <0,0001   p  <0,0001   Taux de RVS Propor)on  de  pa)ents  (%)   Taux de rechute 125/311   37/311   213/311   21/232   211/316   18/230  Poordad F, et al. N Engl J Med. 2011;364:1195-1206.
  • Hépatite C : virus et marqueurs ADVANCE—TVR + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : Design de l’Etude S8   S12   S24   S36   S48   S72   PR48   Placebo     PR   Suivi  (n  =  361)   +  P/R   eRVR+   Suivi   T12PR   (n  =  363)   TVR  +  PR   PR   PR   Suivi   eRVR+   Suivi   T8PR   TVR       Pbo(n  =  364)   +   PR   +  PR   PR   PR   Suivi   eRVR-­‐   *TVR  750  mg  q8h;  pegIFN  alfa-­‐2a  180  µg/s;  RBV  1000-­‐1200  mg/j  adaptée  au  poids.   eRVR  :  réponse  virologique  rapide  étendue  (ARN  indétectable  à  S4  et  à  S12)   Jacobson IM, et al. N Engl J Med. 2011;364:2405-2416.
  • Hépatite C : virus et marqueursADVANCE—TVR + PegIFN + RBV chez des Patients Naïfs deGénotype 1 : Caractéristiques des Patients T12PR (n = 363) T8PR (n = 364) PR (n = 361) Sexe masculin [n (%)] 214 (59) 211 (58) 211 (58) Origine ethnique Caucasiens [n (%)] 325 (90) 315 (87) 318 (88) Afro-Américains 26 (7) 40 (11) 28 (8) Hispaniques 35 (10) 44 (12) 38 (11) Âge (années) [médiane (intervalle)] 49 (19-69) 49 (19-68) 49 (18-69) IMC (kg/m2) [médiane (intervalle)] 26 (18-47) 26 (17-46) 26 (17-48) ARN du VHC > 800 000 UI/ml* [n (%)] 281 (77) 279 (77) 279 (77) Type/sous-type du VHC** [n (%)] 1a 213 (59) 210 (58) 208 (58) 1b 149 (41) 151 (41) 151 (42) 1 non sous-typable 1 (< 1) 3 (1) 2 (1) Stade de fibrose, n (%) Fibrose en ponts 52 (14) 59 (16) 52 (14) Cirrhose 21 (6) 26 (7) 21 (6) *La  charge  virale  (ARN  du  VHC,  UI/ml)  a  été  déterminée  par  PCR  en  temps  réel  (TaqMan®  Roche),  avec  une  limite  de  quanTficaTon  de  25  UI/mL   **La  déterminaTon  du  génotype  viral  a  été  réalisée  par  hybridaTon  inverse,  INNO-­‐LiPA  v1.0  Jacobson IM, et al. N Engl J Med. 2011;364:2405-2416.
  • Hépatite C : virus et marqueurs ADVANCE—TVR + PegIFN + RBV chez des Patients Naïfs de Génotype 1 : RVS et Taux de Rechute p  <0,0001   p  <0,0001  Propor)on  de  pa)ents  (%)   Taux  de  RVS   Taux  de  rechute   265/363   27/314   243/364   28/295   158/361   64/229  Jacobson IM, et al. N Engl J Med. 2011;364:2405-2416.
  • Hépatite C : virus et marqueurs RESPOND-2—BOC + PegIFN + RBV chez des Patients en échec Thérapeutique de G1 : Design de l’Etude S4   S28   S48   S72   PR48   PR     PR  +  placebo   Suivi   n  =  80   Lead-­‐in   ARN-­‐VHC  indétectable  à  S8     Suivi  S24   BOC/TGR   PR     PR  +  boceprevir  S32   ARN-­‐VHC  détectable  à  S8     n  =  162   Lead-­‐in   PR  +   Suivi   placebo  BOC/PR48   PR     n  =  162   Lead-­‐in   PR  +  boceprevir   Suivi   *BOC  800  mg  q8h;  pegIFN  alfa-­‐2b  1,5  µg/kg/s;  RBV  600-­‐1400  mg/j  adaptée  au  poids.   Bacon BR, et al. N Engl J Med. 2011;364:1207-1217.
  • Hépatite C : virus et marqueursRESPOND-2—BOC + PegIFN + RBV chez des Patients enéchec Thérapeutique de G1 : RVS en Fonction de laRéponse Antérieure à la Bithérapie Pégylée Propor)on  de  pa)ents  (%)   (TGR)   17/80   95/162   107/161   2/29   23/57   30/58   15/51   72/105   77/103   17/80   8/25   95/162   17/111   107/161   14/121  Bacon BR, et al. N Engl J Med. 2011;364:1207-1217.
  • Hépatite C : virus et marqueursREALIZE—TVR + PegIFN + RBV chez des Patients en EchecThérapeutique de G1 : Design de l’Etude S4   S8   S12   S16   S48   S72   48  PR   PR  +  placebo   PR   Suivi  n  =  130   PR  n  =  260   PR  +  TVR   (Ll)   PR   Suivi   PR  n  =  260   (LI)   PR  +  TVR   PR   Suivi  *TVR  750  mg  q8h;  pegIFN  alfa-­‐2a  180  µg/s;  RBV  1000-­‐1200  mg/j  adaptée  au  poids.   Zeuzem S, et al. N Engl J Med. 2011;364:2417-2428.
  • Hépatite C : virus et marqueursREALIZE—TVR + PegIFN + RBV chez des Patients en EchecThérapeutique de G1 : RVS en Fonction de la RéponseAntérieure à la Bithérapie Pégylée *   *   Propor)on  de  pa)ents  (%)   *   *   *   *   21/72   25/75   4/27   26/48   26/48   16/68   124/141   121/145   17/80   2/37   8/25   95/162   17/111   107/161   14/121   *p  <0,0001  contre  PR48  Zeuzem S, et al. N Engl J Med. 2011;364:2417-2428.
  • Hépatite C : virus et marqueurs TMC435 Administré en Monothérapie chez des Patients de Génotype 2, 3, 4, 5 et 6 Diminu)on  moyenne  de  l’ARN     du  VHC  (Log  UI/mL)   J3 J7Manns  et  al.,  AASLD  2010,  Abstract  82.  
  • Nouvelles Hépatite C : virus et marqueurs Protéine NS5B: RdRpLesburg  et  al.,  Nat  struct  Biol  1999,  6:  937-­‐943;  Bressanelli  et  al.,  Proc  Natl  Acad  Sci  USA  1999,  96:  13034-­‐13039;  Ago  et  al.,  Srructure  Fold  Des  1999,  7:  1417-­‐1426.    
  • Hépatite C : virus et marqueursRéplication Virale –   Modèle  du  poliovirus   .   Virus  à  ARN  monocaténaire  de   polarité  posiTve   RéplicaTon  De  Clercq.,  Nature  Review  Drug  Discovery,  2007;  6:  1001-­‐18    
  • Hépatite C : virus et marqueursVariabilité Génétique  •  Erreurs  au  cours  de  la  réplica)on   –  Fréquentes     •  10-­‐4-­‐10-­‐4  mutaTons  par  nucléoTde  copié  au  cours  de  la  réplicaTon  du  VHC   –  Spontanées   –  Au  hasard  •  Absence  d’ac)vité  exonucléasique   3’⇒5’  ("proofreading")   –  AccumulaTon  de  mutaTons  •  A  l’origine  de  :     –  La  diversificaTon  des  types  et  des  sous-­‐types   –  La  distribuTon  en  quasi-­‐espèces    
  • Hépatite C : virus et marqueursDiversification des GénotypesSimmonds  et  al.,  Hepatology  2005,  42(4):962-­‐73.    
  • Hépatite C : virus et marqueursDistribution des Génotypes 1a,Adapted  from  Fang  J.,  et  al.  J.  Clin  Liver  Dis.  1997.    
  • Hépatite C : virus et marqueurs Distribution en Quasi-espèceDomingo, E. Cell 1978, 13 (4):735-744.
  • Hépatite C : virus et marqueursCibles des Molécules Antivirales Site  C  (Palm)   Site  A  (Thumb/finger)ps)    (A-­‐837093)   (JTK-­‐109)   Mutants:  411,  414,  448   Mutants:  495,  496,  499   A B E C D Site  B  (Thumb)   HCV-­‐371   Site  E  (Finger,  hypothe)cal)   Mutants:  419,  423,  482   GS-­‐9190   Mutants:  445,448,452   Site  D  (Palm)   (HCV796)   Site  Ac)f   Mutants:  316   (R7128)   Mutants:  282  Copyright  ©  2006  Merck  &  Co.,  Inc.,  Whitehouse  StaTon,  New  Jersey,  USA      
  • Hépatite C : virus et marqueursActivité Antivirale du MK-0608 wt  S282R/T/I   wt  S282   MK-­‐0608    at  1mg.kg-­‐1  orally   7   6   HCV  RNA  (Log  IU/mL)   5   4   3   2    -­‐  4,6    -­‐  4,1   LOQ     1   (20  IU/mL)   TMA    +  +  +  +        -­‐    -­‐      -­‐          -­‐            -­‐              -­‐      -­‐        -­‐              +            +     0   -­‐15   -­‐10   -­‐5   0   5   10   15   20   25   30   35   40   45   50   55   60   65   70   Days  
  • Hépatite C : virus et marqueurs Cycle ViralAdapted  from  Lindenbach  and  Rice,  Nature  (2005),  436:  933-­‐938.  
  • Quasi-espèces virales: exemple du VHC "Membranous Web" Huh7  naïves   Huh7  infectées   (réplicon)  Gosert et al., J Virol 2003, 77(9): 5487-5492.
  • Hépatite CStratégie Diagnostique & Suivi Virologique Stéphane Chevaliez Centre  Na)onal  de  Référence   des  Hépa)tes  Virales  B,  C  et  delta   Laboratoire  de  Virologie  &  INSERM  U955   Hôpital  Henri  Mondor   Université  Paris-­‐Est   Créteil  
  • Stratégie diagnostique & suivi virologiqueMarqueurs Virologiques Marqueurs  indirects                      AnTcorps  anT-­‐VHC  totaux   Marqueurs  directs   Ag  de  capside  (AgC)                      ARN  VHC                      Génotype  VHC   Profil  de  résistance  
  • Diagnostic de l’infection par le VHCTests Sérologiques•  Détec)on  et  quan)fica)on  de  l’an)gène  de  capside   (AgC)  •  Tests  “Combo”   –  DétecTon  simultanée  de  l’AgC  et  des  anTcorps  anT-­‐VHC  •  Détec)on  of  des  an)corps  an)-­‐VHC  par  EIA  de  3ème   généra)on  
  • Stratégie diagnostique & suivi virologiqueAntigène de Capside : un Marqueurde la Réplication r = 0.92; p < 0.0001Bouvier-­‐Alias  et  al.,  Hepatology  2002,  36(1):  211-­‐218.  
  • Diagnostic de l’infection par le VHCIntérêts Cliniques de la Quantification del’AgC•  Diagnos)c  de  l’infec)on   –  Trousses  commerciales   –  Facile  à  uTliser,  automaTsé,  peu  coûteux  (20%  par   rapport  à  une  charge  virale  VHC)  •  Décision  de  traiter  et  suivi  de  l’efficacité  des   traitements  an)viraux   –  QuanTtaTf  (≤20,000  fmol/L*)   –  AlternaTve  aux  techniques  de  détecTon-­‐quanTficaTon   de  l’ARN  du  VHC  
  • Diagnostic de l’infection par le VHCPerformances Analytiques de la TrousseArchitect (Abbott)•  Spécificité   –  99,2%  à  100%  •  Sensibilité     –  ≤10  fmol/L  (i.e   500  to  3  000  UI/mL  d’ARN  VHC)   –  Tous  les  génotypes  (excepté  génotype  2)  •  Intervalle  de  quan)fica)on   –  10  à  20  000  fmol/L  (≤  7,8  Log10  UI/mL  d’ARN  VHC)  •  Stable  à  37°C  pendant  96  heures  Ross et al., J Clin Micribiol 2010, 48(4): 1161-8; Mederacke et al., J Clin Virol 2009, 46(3): 210-5; Miedouge et al., J Clin Virol 2010, 48(1):18-21.
  • Diagnostic de l’infection par le VHCTrousse Architect : Monitorage desCinétiques Virales RVR  (G1b)   RVS  (G1b)   Rechuteur  (G1b)   Non-­‐répondeur  (G1a)   Core Ag RNARoss et al., J Clin Microbiol 2010, 48(4): 1161-8.
  • Diagnostic de l’infection par le VHC Performances de la Trousse Architect chez les Patients Hémodialysés n=90   r=0,9041;  p<0,0001  Mediouge et al., J Clin Virol 2010 May;48(1):18-21
  • Diagnostic de l’infection par le VHCTest “Combo“ (AgC/Anti-VHC)•  Diagnos)c  de  l’infec)on  par  le  VHC   –  Trousses  commerciales   –  Faciles  à  uTliser,  automaTsés   –  DiminuTon  de  la  fenêtre  sérologique  d’environ   20-­‐30  jours   –  Moins  sensibles  que  les  tests  de  3ème  généraTon   pour  la  détecTon  des  anTcorps  anT-­‐VHC  
  • Diagnostic de l’infection par le VHCDétection des Anticorps Anti-VHC•  Diagnos)c  de  l’infec)on  par  le  VHC   –  Trousses  commerciales   –  Faciles  à  uTliser,  automaTsées   –  A  l’aide  d’un  test  de  3ème  généraTon   .  ADVIA  Centaur  (Siemens)   .  VITROS  ECi  (Ortho-­‐Clinical  DiagnosTc)   .  AXSYM  HCV  3.0  (Abbo{)   .  Cobas  Elecsys  Modular  HCV  (Roche)   .  INNOTEST  HCV  Ab  IV  (InnogeneTcs)   .  Monolisa  anT-­‐HCV  Plus  version  2  (Bio-­‐Rad)  
  • Diagnostic de l’infection par le VHCTests Virologiques Moléculaires Tests  Qualita)fs-­‐Quan)ta)fs   Est-­‐ce  que  le  VHC  est  présent  et  en  quelle  quan)té  ?   Détec)on  de  la  résistance   Détermina)on   du  Génotype     Quel  est  le  génotype  du  VHC  ?   Quel  type  de  VHC  est  présent  ?  
  • Stratégie diagnostique & suivi virologiqueAvantages Techniques de la PCR enTemps Réel -  Diminu)on  du  risque  de  contamina)on   -  Améliora)on  de  la  sensibilité   -  Augmenta)on  de  l’intervalle  de  quan)fica)on   linéaire   -  Améliora)on  précision  et  reproduc)bilité   -  Augmenta)on  de  débit  à  travers  l’automa)sa)on  
  • Stratégie diagnostique & suivi virologique Intervalles de Quantification 10   102   103   104   105   106   107   108  Cobas  Amplicor  HCV  Monitor  v2.0  SuperQuant  LCx  HCV  RNA  Assay  Versant  HCV  RNA  3.0  (bDNA)  Cobas  TaqMan  HCV  v1.0  (Roche)  RealTime™  HCV  (Abbov)  Cobas  TaqMan  HCV  v2.0  (Roche)*  Artus  HCV  QS-­‐RGQ  (Qiagen)*  Versant  HCV  RNA  1.0  (kPCR,  Siemens)*   *in  development  
  • Stratégie diagnostique & suivi virologiquePlates-formes CAP-CTM96 (ROCHE) kPCR (SIEMENS) m2000SP-m2000RT (ABBOTT)
  • Stratégie diagnostique & suivi virologiqueApplications et Bénéfices de la PCR enTemps Réel•  Remplace  les  techniques  qualita)ves  de  détec)on  de   l’ARN  du  VHC  •  Quan)fie  l’ensemble  des  charges  virales  observées   en  pra)que  clinique   –  Charges  virales  élevées  avant  traitement   –  Faibles  charges  virales  au  cours  du  traitement  •  Surveille  efficacement  les  ciné)ques  virales  afin   d’évaluer  l’efficacité  virologique  du  traitement  
  • Stratégie diagnostique & suivi virologiqueQuantification ARN du VHC(CTM, Roche) 8   HCV  RNA  level  in  CAP/CTM48  (Log10  IU/mL)   7   Genotype  1  (n=29)   6   Genotype  2  (n=27)   Genotype  3  (n=29)     5   Genotype  4  (n=30)   Genotype  5  (n=9)   4   Genotype  6  (n=2)   r  =  0.889;  p  <  0.0001   3   3   4   5   6   7   8   HCV  RNA  level  in  Versant  HCV  3.0  Assay  bDNA   (Log10  IU/mL)    Chevaliez  et  al.,  2007;  Hepatology,  46(1):  22-­‐31.  
  • Stratégie diagnostique & suivi virologiqueAbsence de Détection de l’ARN Viral de patientsFortement Virémiques Infectés par un Génotype 4 (Log10 IU/mL) CAP/CTM96 m2000SP/m2000RT Versant 3.0 Patient 1 (4h) <1.08 5.4 5.0 Patient 2 (4l) <1.08 6.0 5.7 80 90 100 110 120 130 140 150 160 170 180 |.........|.........|.........|.........|.........|.........|.........|.........|.........|.........|F_7157 (4a): TAGCCATGGCGTTAGTATGAGTGTTGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATCGCCGGPatient 1 (4h): ...........................A.....................................A...................T...............Patient 2 (4l): ...........................A.....................................A...................T............... 190 200 210 220 230 240 250 260 270 .........|.........|......-...|.........| .........|.........|.........|.........| .........|........F_7157 (4a): GATGACCGGGTCCTTTCTTGGATTAA-CCCGCTCAATGCCCGGAAATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCPatient 1 (4h): ......................A.T.A..........................................................................Patient 2 (4l): .......................C..-.......................................................C.......T.......... 280 290 300 310 320 330 340 |.........|.........|.........|.........|.........|.........|.F_7157 (4a): TTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACCPatient 1 (4h): .............................................................Patient 2 (4l): .............................................................Chevaliez  et  al.,  2008;  Hepatology,  49(4):  1397-­‐1398.  
  • Stratégie diagnostique & suivi virologiqueQuantification de Transcrits d’ARN Sauvages ouMutés en Position 145 et/ou 165 Measured  HCV  RNA  levels  (Log10  IU/mL)   HCV  5’NC  sequence   Real-­‐)me  PCR  assays   bDNA  assay   CTM   m2000   Versant  3.0   Wild-­‐type  (G145  and  A165)   5.73±0.13   6.05±0.10   6.43±0.01   Single  mutant  (G145A  and   4.02±0.13   6.00±0.11   6.69±0.02   A165)   Single  mutant  (G145  and   4.28±0.35   5.88±0.20   6.30±0.02   A165T)   Double  mutant  (G145A  and   <1.08*   5.95±0.25   6.60±0.18   A165T)   *Target  not  detected  Chevaliez  et  al.,  Hepatology,  2009,  50(5):  1681.  
  • Diagnostic de l’infection par le VHC Quantification de l’ARN du VHC (CTM v2.0, Roche) 10,000  cp/mL  (input)  Mean  )ter  (Log10  cp/mL)   WT  G1   A165T   G145A+A165T   G4   A142G+G145A+A165T   Vermehren et al., 2011; J Clin Microbiol, 49(9): 3309-3315.
  • Diagnostic de l’infection par le VHC Quantification de l’ARN du VHC (CTM v2.0, Roche) 10,000  cp/mL  (input)  Mean  )ter  (Log10  cp/mL)   WT  G1   A165T   G145A+A165T   G4   A142G+G145A+A165T   Vermehren et al., 2011; J Clin Microbiol, 49(9): 3309-3315.
  • Stratégie diagnostique & suivi virologiqueQuantification ARN du VHC(m2000, Abbott) 8   HCV  RNA  level  in  m2000SP/m2000RT  (Log10  IU/mL)   7   Genotype  1  (n=55)   6   Genotype  2  (n=21)   Genotype  3  (n=29)     5   Genotype  4  (n=24)   Genotype  5  (n=9)   4   Genotype  6  (n=3)   r  =  0.972;  p  <  0.0001   3   3   4   5   6   7   8   HCV  RNA  level  in  Versant  HCV  3.0  Assay  bDNA   (Log10  IU/mL)    Chevaliez  et  al.,  J  Clin  Microbiol,  2009,47(6):1726-­‐32.  
  • Stratégie diagnostique & suivi virologiqueQuantification ARN du VHC(kPCR, Siemens) 132 clinical samplesDavid  Sherman.,  Molecular  Symposium,  September  2007  (source:  Siemens  Medical  SoluTons  DiagnosTcs).  
  • Stratégie diagnostique & suivi virologique LLOD & LOQ : Laquelle Utiliser pour Prédire la RVS ? Traitement  An)viral  Charge  virale  VHC  (Log10  UI/mL)   8   Détectable/   Rendu des Résultats quan)fiable   6   Quantifiable (toute valeurs > LOQ) 4   Détectable non 2   quantifiable (LLOD<ARN <LOQ) LOQ   Détectable/non  quan)fiable   1   LLOD   Indétectable Indétectable   (ARN<LLOD) 0   0   Temps   RVS   Harrington et al., Hepatology 2011, sous-presse.
  • Stratégie diagnostique & suivi virologiquePCR en Temps Réel en Pratique•  En  pra)que  clinique,  la  quan)fica)on  de  l’ARN  du   VHC  doit  être  réalisée  à  l’aide  d’une  technique  de  PCR   en  temps  réel   –  Expression  des  résultats  en  UI/mL   –  LOD=LLOQ  de  l’ordre  de  10  à  15  UI/mL  •  La  quan)fica)on  de  l’ARN  du  VHC  doit  être  réalisée   avant  le  début  du  traitement  et  aux  semaines  4,  (8),   12,  24,  en  fin  de  traitement  et  24  semaines  après   l’arrêt  du  traitement    •  Pour  un  pa)ent  donné,  le  monitorage  de  la  charge   virale  doit  être  réalisé  avec  la  même  technique  de   PCR  en  temps  réel  
  • Stratégie diagnostique & suivi virologiqueGénotypes du VHCSimmonds  et  al.  Hepatology  2005.    
  • Stratégie diagnostique & suivi virologiqueRépartition des Génotypes 1a,Adapted  from  Fang  J.,  et  al.  J.  Clin  Liver  Dis.,  1997.    
  • Stratégie diagnostique & suivi virologiqueDétermination du Génotype •  Méthodes  moléculaires  (genotyping)   –  Analyse  de  la  séquence  après  séquençage  direct   –  HybridaTon  inverse  des  produits  d’amplificaTon  sur  des   supports  solides  comportant  des  sondes  génotype   spécifique  :  Line  Probe  Assay  (INNO-­‐LiPA  HCV,   InnogeneTcs)   –  PCR  en  temps  réel  à  l’aide  d’amorces  et  de  sondes   génotype  spécifique   •  Méthodes  sérologiques  (“serotyping”)   –  ELISA  compéTTf    Arens et al., J Clin Virol, 2001; 22:11-29; Davidson et al., J Gen Virol 1995; 76: 1197-204; Lareu et al., 1997; Le Pogam et al., 1998; J ClinMicrobiol; 36: 1461-3; Ilina et al., J Clin Miocrobiol, 2005; 43(6): 2810-15.
  • Stratégie diagnostique & suivi virologiqueDétermination du Génotype •  Méthodes  moléculaires  (genotyping)   –  Analyse  de  la  séquence  après  séquençage  direct   –  HybridaTon  inverse  des  produits  d’amplificaTon  sur  des   supports  solides  comportant  des  sondes  génotype   spécifique  :  Line  Probe  Assay  (INNO-­‐LiPA  HCV,   InnogeneTcs)   –  PCR  en  temps  réel  à  l’aide  d’amorces  et  de  sondes   génotype  spécifique   •  Méthodes  sérologiques  (“serotyping”)   –  ELISA  compéTTf    Arens  et  al.,  J  Clin  Virol,  2001;  22:11-­‐29;  Davidson  et  al.,  J  Gen  Virol  1995;  76:  1197-­‐204;  Lareu  et  al.,  1997;  Le  Pogam  et  al.,  1998;  J  Clin  Microbiol;  36:  1461-­‐3;  Ilina  et  al.,  J  Clin  Miocrobiol,  2005;  43(6):  2810-­‐15.  
  • Stratégie diagnostique & suivi virologiqueAnalyse Phylogénique après Séquençage 1mGUI24  Direct 1mGUI11   1mGUI17   1dBA107   1dHC1N16   1dFR17   99   Pa)ent  26   2   Pa)ent  5 59   Pa)ent  60   98   Pa)ent  48   Génotype  1,  sous-­‐type  i   96   1iQC181   1iQC77   1iFR16   Pa)ent  40   1bHCP01   34   100   1bHCVBK   Génotype  1,  sous-­‐type  b   1bHCJ4   Région  NS5B  (286  nt)   Pa)ent  7   Pa)ent  8   CLUSTALX   Pa)ent  17   Pa)ent  18   DNADist  (PHYLIP  3.5)   Pa)ent  36   Matrice  de  distance:  Kimura  2-­‐ 100   Pa)ent  16   Pa)ent  64   Génotype  1,  sous-­‐type  ?   parameter  (Ts/Tv=2)   Pa)ent  28   Neighbor-­‐Joining   Pa)ent  2   Pa)ent  54   Bootstraping  :  1000  replicates   72   Pa)ent  46   NJPlot   Pa)ent  59   1fFR2   1l98CM1457   43   1l98CM1427   1lM5186N   1gEG024   1g2152   1g1382   1eQC172   1eCAM1078   1eM4541N   Génotype  1   1kQC82   1kQC68   1jQC89   1jQC2   1aHCJ1   1aHCVH   1aHCV1   1cKhaja1   1cSR031   1cHCG9   1h98CM1521   1h98CM1357   Génotype  4   1hFrSSD98   4aED43   Génotype  3   100   Pa)ent  62   0.05   Génotype  6   3aNLZ1   Génotype  3,  sous-­‐type  a   6aEUHK2   Génotype  5   Génotype  2   2aHCJ6   Pa)ent  49   Génotype  2   5aSA13  
  • Stratégie diagnostique & suivi virologiqueVersant® HCV Genotype 2.0 Assay(INNO-LiPA)
  • Stratégie diagnostique & suivi virologiqueIntérêt de la Détermination du Sous-Type(1a vs 1b) ?-  Modeste  différence  d’efficacité  de  la   trithérapie    -  Profils  de  résistance  différents  en  cas  d’échec   de  la  trithérapie  -  Pas  d’influence  sur  la  décision  thérapeu)que  
  • Stratégie diagnostique & suivi virologiqueIntérêt du Sous-Type dans la Résistanceau Telaprevir Subtype  1b   Subtype  1a   Subs)tu)ons  in  pa)ents  who  failed  to  achieve  an  SVR  
  • Stratégie diagnostique & suivi virologiqueImpact du Sous-Type sur la BarrièreGénétique à la RésistanceHCV-­‐1a  prototype   ...PAGHAVGIFFRAAVCTRGVAKAVDFIP...  HCV-­‐1b  prototype   ... S -­‐ -­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐-­‐ -­‐ V ...  HCV-­‐1a   AGAèAAA  (R155K)   AGAèACA  (R155T)  HCV-­‐1b   CGAèAAA  (R155K)   CGAèACA  (R155T)  
  • Stratégie diagnostique & suivi virologiqueIntérêt de la Détermination du Sous-Type(1a vs 1b) ?-  Modeste  différence  d’efficacité  de  la   trithérapie    -  Profils  de  résistance  différents  en  cas  d’échec   de  la  trithérapie  -  Pas  d’influence  sur  la  décision  thérapeu)que  
  • Stratégie diagnostique & suivi virologiqueIntérêt de la Détermination du Sous-Type(1a vs 1b) ?-  OUI   .  Dans  les  essais  cliniques  afin  de  correctement   straTfier  l’efficacité  des  DAAs  et  d’interpréter  les   profils  de  résistance    -  NON   .  En  praTque  clinique  car  le  sous-­‐type  n’a  pas   d’influence  sur  la  décision  thérapeuTque  
  • Stratégie diagnostique & suivi virologiqueRésumé•  Détermina)on  du  génotype  (sous-­‐type)   VHC   –  La  déterminaTon  du  génotype  sur  la  seule   région  5’NC  doit  être  proscrite   –  La  2nde  généraTon  de  Line  Probe  Assay  qui   uTlise  des  sondes  dirigées  contre  la  région  core   en  plus  de  la  région  5’NC  est  la  meilleure   méthode  perme{ant  de  disTnguer  les  sous-­‐ types  1a  et  1b  EASL CPG., J Hepatol. 2011 Aug;55(2):245-64.
  • Stratégie diagnostique & suivi virologiqueIL28B “Single NucleotidePolymorphism” (SNP) En amont du géne de l’IL28B, codant l’IFN-λ3 rs12979860 Ge  et  al.,  Nature  2009;  461:  399-­‐401.    
  • Stratégie diagnostique & suivi virologiqueBithérapie Standard : RVS en Fonction duGénotype IL28B Réponse virologique soutenue (%) Caucasians African-Americans Hispanics Combined (n=1171) (n=300) (n=116) (n=1587) TT CC TT CC 12 CC TT 14 37% 37% 22% 29% 51% 49% 48% CT CT CT Thompson  et  al.,  Gastroenterology  2010;  139(1):  120-­‐129.    
  • Stratégie diagnostique & suivi virologiqueRésumé-  En pratique clinique, SNPs en amont du gène de l’IL28B (rs12979860 et rs8099917) sont les facteurs prédictifs les plus robustes de la RVS à la bithérapie-  Cependant, leur valeur prédictive à l’échelon individuel n’est pas suffisante pour la prise en compte dans les décisions thérapeutiques-  La détermination du génotype IL28B en association à d’autre paramètres, comme la réponse virologique à S4, pourrait être utile pour adapter le traitement, éventuellement des patients sous triple combinaison Ge  et  al.,  Nature  2009;  461:  399-­‐401;  Tanaka  et  al.,  Nat  Genet  2009;  41(10):  1105-­‐9;  Afdhal  et  al,  Hepatology  in  press.    
  • Stratégie diagnostique & suivi virologiqueIntérêts des Tests Virologiques enThérapeutique •  Décision  de  traiter   •  Op)misa)on  du  schéma  thérapeu)que   •  Etude  de  la  réponse  virologique  au   traitement  Consensus  conference:  treatment  of  hepaTTs  C;  2002,  Gastroenterol  Clin  Biol,  26(2):  B303-­‐20  
  • Stratégie diagnostique & suivi virologiqueLe Génotype du VHC Détermine l’Approchedu Traitement VHC•  Génotypes  2/3,  4,  (5/6)   –  MainTen  de  la  bithérapie  pégylée  (pegIFN/RBV)  •  Génotype  1   –  OpTon  thérapeuTque  possible  :  inhibiteur  de  protéase  en   associaTon  à  l’interféron  pégylé  et  la  ribavirine   –  Boceprevir  (Victrelis®)  et  Telaprevir  (Incivo®)  approuvés   depuis  mai  2011  par  la  FDA  et  respecTvement  en  juillet  et   septembre  2011  par  l’EMA  
  • Stratégie diagnostique & suivi virologique Réponses au Traitement en Fonction des Cinétiques Virales SOC   +1   0  HCV  RNA  reduc)on  from   baseline  (Log10  IU/mL)   -­‐1   -­‐2   Diminu)on  ≥  2  Log   -­‐3   -­‐4   Slow  VR   -­‐5   RVR   EVR   Detec)on  cut-­‐off   -­‐6   (10-­‐15  IU/mL)   0   2   4   8   12   Weeks  
  • Stratégie diagnostique & suivi virologique Definitions of Virological ResponsesResponse   Defini/on  SVR   HCV  RNA  undetectable  24  weeks  a‚er  the  end  of  treatment  RVR   HCV  RNA  undetectable  at  week  4  EVR   HCV  RNA  undetectable  at  week  12  DVR   >2  Log10  IU/mL  drop  but  detectable  HCV  RNA  at  week  12  Null  response   Less  than  2  Log10  IU/mL  in  HCV  RNA  from  baseline  at  week  12  ParTal  response   >2  Log10  IU/mL  decrease  in  HCV  RNA  from  baseline  at  week  12  but  sTll   detectable  at  weeks  12  and  24  Viral  breakthrough   HCV  RNA  detectable  at  any  Tme  during  treatment  a‚er  virological   response  Relapse   HCV  RNA  detectable  a‚er  withdrawal  treatment  in  paTent  who  was   undetectable  at  the  end  of  treatment  New  response  categories  with  protease  inhibitor-­‐based  therapy  eRVR  with  BOC   HCV  RNA  undetectable  at  weeks  8  and  24  eRVR  with  TVR   HCV  RNA  undetectable  at  weeks  4  and  12  
  • Stratégie diagnostique & suivi virologiqueMonitoring of Treatment Responses BOC/PR   TVR/PR   PR   S4   S8   S12   S24   S36   S48   S72  
  • Stratégie diagnostique & suivi virologique RVR in Patients Receiving PegIFN plus Ribavirin •  Undetectable  HCV  RNA  at  Wk  4  of  therapy   •  Achieving  RVR  is  highly  predic)ve  of  SVR     –  Independent  of  genotype  and  treatment  regimen   –  RVR  achieved  by  15%  to  20%  of  paTents  with  genotype   1;  66%  with  genotypes  2/3   •  Pa)ents  who  achieve  RVR  may  be  able  to   shorten  therapy  Ferenci P, et al. J Hepatol. 2005;43:425-433; Shiffman ML, et al. N Engl J Med. 2007;357:124-134; Jensen DM, et al. Hepatology. 2006;43:954-960.Ghany MG, et al. Hepatology. 2009;49:1335-1374; Moreno et al., J Hepatol 2010; 52: 25-31.
  • Stratégie diagnostique & suivi virologiqueHigher Rates of SVR in Genotype 2/3 PatientsWho Achieved an RVR with 24 vs 16 Weeks p<0.001   p<0.001   p=0.13   16  weeks   SVR  (%)   24  weeks   375/458   368/405   197/243   115/212   181/215   174/193  Diago et al., Hepatology 2010 Jun;51(6):1897-903.
  • Stratégie diagnostique & suivi virologiqueHigher Rates of SVR in Genotype 2/3 PatientsWho Achieved an RVR with 24 vs 16 Weeks p=0.20   16  weeks   SVR  (%)   24  weeks   111/122   95/100   *HCV  RNA  level  <400,000  IU/mL  Diago et al., Hepatology 2010 Jun;51(6):1897-903.
  • HCV-­‐2/3   RNA  quan)fica)on   SOC   Response-­‐Guided  Therapy   Ribavirin  (1000-­‐1400  mg.d-­‐1)   RNA  quan)fica)on  at  W4   HCV  RNA   HCV  RNA   undetectable   detectable   Consider   24  weeks  of   12-­‐16  weeks   therapy   RNA  quan)fica)on  at  W12   of  therapy1   Decrease  <  2  Log   Decrease  ≥  2  Log     Decrease  ≥  2  Log     HCV  RNA  detectable   HCV  RNA  undetectable   Stop  an)viral   Con)nue  Rx  un)l  W48   treatment  1In  paTents  with  a  low  viral  load  at  baseline  (<400,000  IU/mL);  Marginally  less  effecTve  due  to  higher  rates  of  relapse  in  genotype  3  with  high  HCV  RNA  leval   EASL CPG., J Hepatol. 2011 Aug;55(2):245-64.
  • Stratégie diagnostique & suivi virologiqueBenefits of Response-GuidedTherapy •  Reduce  unnecessary  exposure  to  drugs   –  By  shortening  therapy  in  paTents  likely  to   achieve  SVR  without  requiring  the  full  duraTon   –  By  terminaTng  therapy  early  in  paTents   unlikely  to  achieve  SVR     •  May  iden)fy  pa)ents  who  do  not  need  a   protease  inhibitor   –  Due  to  high  likelihood  of  SVR  with  pegIFN  plus   ribavirin  alone  
  • Peginterferon  and  ribavirin  (SOC)  
  • Stratégie diagnostique & suivi virologique Shorter SOC Treatment Duration in Genotype 1 Patients with RVR Pa/ents  with  RVR   Pa/ents  without  RVR  Propor)ons  of  pa)ents  (%)   24  weeks   48  weeks   Jensen DM, et al. Hepatology. 2006;43:954-960.
  • Stratégie diagnostique & suivi virologiqueShorter Treatment Duration inGenotype 1 Patients with RVR •  A  recent  meta-­‐analysis  suggested  that   –  In  paTents  infected  with  HCV  genotype  1  with   an  RVR,  24  weeks  of  therapy  with  SOC  should   be  considered  only  in  subjects  with  low   baseline  viral  loads   –  The  opTmal  cut-­‐off  defining  low  baseline  HCV   RNA  level  (400,000-­‐800,000  IU/mL)  is  not   clearly  defined  Moreno et al., J Hepatol 2010; 52: 25-31.
  • HCV-­‐1   RNA  quan)fica)on   SOC   Response-­‐Guided  Therapy   Ribavirin  (1000-­‐1400  mg.d-­‐1)   RNA  quan)fica)on  at  W4   HCV  RNA   HCV  RNA   undetectable   detectable   Consider  24   weeks  of   RNA  quan)fica)on  at  W12   therapy1   Decrease  <  2  Log   Decrease  ≥  2  Log     Decrease  ≥  2  Log     HCV  RNA  detectable   HCV  RNA  undetectable   Con)nue  Rx  un)l  W24   If  HCV  RNA   Stop  an)viral   undetetectable   Con)nue  Rx  un)l  W48   treatment   Con)nue  Rx  Un)l  W72  1In  paTents  with  a  low  viral  load  at  baseline  (<400,000  IU/mL);  2In  paTents  with  a  low  viral  load  at  baseline  (400,000-­‐600,000  IU/mL)   EASL CPG., J Hepatol. 2011 Aug;55(2):245-64.
  • Triple  combina/on  of  Peginterferon,  ribavirin   and  a  protease  inhibitor  (BOC  or  TVR)   Pa/ents  Naïfs  
  • Stratégie diagnostique & suivi virologique Higher SVR Rates in Patients Achieving an RVR ADVANCE   SPRINT-­‐2  SVR  (%)   Jacobson et al., N Engl J Med. 2011, 364:2405-2416; Poordad et al., N Engl J Med. 2011, 364:1195-1206. .
  • Stratégie diagnostique & suivi virologiqueRVR : An Early Guide to Success •  Pa)ents  who  achieve  an  RVR  have  a  very  high   chance  of  achieving  an  SVR   •  This  applies  to  pegIFN  and  ribavirin  with  or   without  a  protease  inhibitor   But   •  With  a  protease  inhibitor,  many  more  pa)ents   achieve  an  RVR   –  Defined  as  Wk  4  of  triple  therapy  (i.e,  Wk  8  of  the   treatment  course  in  paTents  receiving  BOC)  
  • Stratégie diagnostique & suivi virologique Boceprevir Regimens W0   W4   W8   W12   W24   W28   W36   W48   HCV RNA undetectable at W8 BOC  +  PR   Treatment-­‐naïve   pa)ents  without   PR     cirrhosis   HCV RNA detectable at W8 Boceprevir BOC  +  PR   PR   Cirrho)c  pa)ents,   W0   W4   W12   W24   W48   poor-­‐IFN  responders  (<1  Log   at  W4)  and  null   responders   PR   BOC  +  PR   Boceprevir  Boceprevir. European Medicines Agency.
  • Stratégie diagnostique & suivi virologiqueFutility Rules •  Different  for  BOC  and  TVR   –  If  HCV  RNA  is  ≥  100  IU/mL  at  Wk  12,  all  3   medicaTons  should  be  disconTnued   –  If  HCV  RNA  is  confirmed  detectable  at  Wk  24,   all  3  medicaTons  should  be  disconTnued  
  • Stratégie diagnostique & suivi virologique Telaprevir Regimens HCV  RNA  undetectable  at  W4-­‐12     Treatment-­‐ Follow-­‐up   naïve  pa)ents   without   TVR  +  PR   PR   cirrhosis   PR   Follow-­‐up   HCV  RNA  detectable  at  W12  and/or  W24  but  ≤1000  IU/mL       cirrho)c  treatment-­‐naïve   TVR  +  PR   PR   Follow-­‐up   pa)ents   W4   W12   W24   W36   W48   W72  Telaprevir. European Medicines Agency.
  • Stratégie diagnostique & suivi virologiqueFutility Rules •  Different  for  TVR  and  BOC   –  If  HCV  RNA  is  >  1000  IU/mL  at  Wk  4  or  12,  all  3   medicaTons  should  be  disconTnued   –  If  HCV  RNA  is  confirmed  detectable  at  Wk  24,   pegIFN/RBV  should  be  disconTnued    
  • Triple  combina/on  of  Peginterferon,  ribavirin   and  a  protease  inhibitor  (BOC  or  TVR)   Pa/ents  en  Echec  d’un  Traitement  Antérieur   par  Bithérapie  Pégylée  
  • Stratégie diagnostique & suivi virologiqueHigher SVR Rates in Patients Achieving anRVR (i.e, At Week 8) SVR  (%)  
  • Stratégie diagnostique & suivi virologiqueHigher SVR Rates in Relapsers Achievingan RVR (i.e, at Week 4) Relapsers   Par/al  responders  SVR  (%)  
  • Stratégie diagnostique & suivi virologique Boceprevir Regimens W0   W4   W8   W12   W24   W28   W36   W48   HCV RNA undetectable at W8 BOC  +  PR   Treatment-­‐naïve   pa)ents  without   PR     cirrhosis   HCV RNA detectable at W8 Boceprevir BOC  +  PR   PR   Treatment-­‐ W0   W4   W12   W24   W36   W48   experienced   pa)ents  without   cirrhosis,  except   null  responders*   PR   BOC  +  PR   PR   Boceprevir   Cirrho)c  pa)ents,   W0   W4   W12   W24   W48   poor-­‐IFN  responders  (<1  Log   at  W4)  and  null   responders   PR   BOC  +  PR   Boceprevir  Boceprevir. European Medicines Agency. *FDA  recommends  RGT  in  relapsers  and  parTal  responders  
  • Stratégie diagnostique & suivi virologiqueFutility Rules •  Differ  for  BOC  and  TVR   –  If  HCV  RNA  is  ≥  100  IU/mL  at  Wk  12,  all  3   medicaTons  should  be  disconTnued   –  If  HCV  RNA  is  confirmed  detectable  at  Wk  24,   all  3  medicaTons  should  be  disconTnued  
  • Stratégie diagnostique & suivi virologique Telaprevir Regimens HCV  RNA  undetectable  at  W4-­‐12     Treatment-­‐ Follow-­‐up   naïve  pa)ents   without   TVR  +  PR   PR   cirrhosis  and   PR   Follow-­‐up   relapsers   HCV  RNA  detectable  at  W12  and/or  W24  but  ≤1000  IU/mL     Par)al  and  null  responders  and   cirrho)c  treatment-­‐naïve   TVR  +  PR   PR   Follow-­‐up   pa)ents   W4   W12   W24   W36   W48   W72  Telaprevir. European Medicines Agency.
  • Stratégie diagnostique & suivi virologiqueFutility Rules •  Differ  for  TVR  and  BOC   –  If  HCV  RNA  is  >  1000  IU/mL  at  Wk  4  or  12,  all  3   medicaTons  should  be  disconTnued   –  If  HCV  RNA  is  confirmed  detectable  at  Wk  24,   pegIFN/RBV  should  be  disconTnued    
  • Stratégie diagnostique & suivi virologique Response-Guided Therapy•   Boceprevir   –   RGT  recommended  for  non-­‐cirrhoTc  treatment-­‐naive  paTents     –   Different  recommendaTons  from  FDA  vs  EMA  for  previous  relapsers  or  non   responders   –   For  previous  null  responders  treated  with  BOC,  fixed  duraTon  48-­‐week   course  of  therapy  recommended   –   For  treatment-­‐naive  paTents  with  <  1  Log  reducTon  in  HCV  RNA  a‚er  the   lead-­‐in  phase,  consideraTon  should  be  given  to  4-­‐plus-­‐44  wks  regimen  rather   than  RGT   –   CirrhoTc  paTents  should  receive  a  fixed  duraTon  48-­‐week  course  of  therapy  •   Telaprevir   –   RGT  recommended  for  treatment-­‐naive  paTents  and  previous  relapsers   –   All  previous  parTal  or  null  responders  and  cirrhoTc  paTents  should  receive   a  fixed-­‐duraTon  48-­‐week  course  of  therapy