100617_statistics1

904 views
819 views

Published on

Published in: Education, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
904
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
0
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

100617_statistics1

  1. 1. 2010/06/17   kaneko.satoko(at)ocha.ac.jp   
  2. 2.   R /R   R Bioconductor(GeneR)  
  3. 3. ( )          
  4. 4.  – ‐             ( )   ( ) ( )    
  5. 5.  – ‐   (A:61%, G:32%, C: 7%)   5 (A:80%, G:20%) 10 (A:60%, G:40%)         5     01 A 10 ( ) 02 A 03 A 01 A A G A G G 02 A G A A 04 G A A A G 05 A 03 A G A A C G 04 G C A A A: 80%, G: 20% A A A A 05 A A G A G 06 G 07 A 08 G 09 A 10 G A: 60%, G: 40%
  6. 6.  – ‐   1 n x = ∑ xi n i=1         ( )   €    ( ‐1) ( )            
  7. 7.  – ‐     5   5,  0.5 5,  1.0 5,  2.0
  8. 8. R  R R ( )  Bioconductor(GeneR)    
  9. 9. R R     (2010 6 14 R 2 11.1) R‐2.11.1.dmg      
  10. 10. R   – ‐  R   q()    Save workspace image? [y/n/c]:  y   n
  11. 11. R   –R ‐ R dock  
  12. 12. R   – ‐
  13. 13. R   – ‐  > 1+2    #   [1] 3  + >3‐1     #   ‐ [1] 2  * >10*2    #   / [1] 20  ^ >7/2      #   sqrt() [1] 3.5  > 2^2    #   [1] 4  > sqrt(4)    #   [1] 2 
  14. 14. R   – ‐ R     c    > x  <‐  c(1,2,5,6)    # c() () x   > x  [1] 1 2 5 6  > x + 10        #x (1,2,5,6) 10   [1] 11 12 15 16  > x * 10        #x 10   [1] 10 20 50 60  > x <‐ c(“France”, “123”, “abc”)    # “”   > x  [1] "France" "123"    "abc" 
  15. 15. R   – ‐ > number<‐ c(1,2,3,4,5,6,7,8,9,10)  > number   [1]  1  2  3  4  5  6  7  8  9 10  > length (number)    #length   [1] 10  > sum (number)  #   [1] 55  > max (number)  #   [1] 10  >min (number)  #   [1] 1  > mean(number)   #   [1] 5.5 
  16. 16. R   – 1‐ [41,55,51,61,45,38,60,48,43,46,63,51,55,55,53]                         > x<‐ c(41,55,51,61,45,38,60,48,43,46,63,51,55,55,53)  > length(x)  [1] 15  > sum(x)  #   [1] 765  #   > 765/15    > mean(x)    [1] 51 
  17. 17. R   – 2‐ [41,55,51,61,45,38,60,48,43,46,63,51,55,55,53]                         > sub <‐ x‐51  > sub   [1] ‐10   4   0  10  ‐6 ‐13   9  ‐3  ‐8  ‐5  12   0   4   4   2  > sub^2   [1] 100  16   0 100  36 169  81   9  64  25 144   0  16  16   4  > sum(sub^2)  [1] 780  > 780/15  [1] 52  >sqrt(52)    #   [1] 7.211103
  18. 18. Bioconductor         h`p://www.bioconductor.org/packages/release/Soaware.html 
  19. 19. Bioconductor/GeneR  GeneR   > source("h`p://www.bioconductor.org/biocLite.R")   > biocLite("GeneR")  > library(GeneR)  > ls(“package:GeneR”)     #GeneR  
  20. 20. Bioconductor/GeneR  1  > s<‐"gtcatgcatgctaggtgacag`aaaatgcgtctaggtgacagtctaacaa"  > placeString(s)    #GeneR placeString()   [1] 0  > translate()  # 1   [1] "VMHAR*QLKCV*VTV*Q"  > translate (from=c(1,2,3),to=c(0,0,0))    #3   [1] "VMHAR*QLKCV*VTV*Q" "SCMLGDS*NASR*QSN"  "HAC*VTVKMRLGDSLT"   > strCompoSeq(s, wsize=1)    # (% )  T C A G X [1,] 0.2549020 0.1764706 0.3137255 0.2549020 0 > strCompoSeq(s, wsize=2)     # 2   TT TC TA TG TX CT CC CA CG CX AT AC AA AG AX GT GC [1,] 0 0 0.04 0.08 0 0.12 0 0.2 0 0 0.04 0 0.08 0.08 0 0.24 0.04 GA GG GX XT XC XA XG XX [1,] 0.08 0 0 0 0 0 0 0
  21. 21. ‐Rhodopsin ‐  Rhodopsin (RHO)  5 exons,   CDS 1047bp (348a.a.)  human, chimpanzee, macaque Rhodopsin   transioon, transversion   1) REST   2)  CDS R CDS   3) ClustalW mulople alignment   4)  transioon transversion  
  22. 22. Clustalw     Clustalw mulople alignment   alignment output format   Clustalw Clustalx GUI   available for download here    
  23. 23. Clustalw   Clustalw‐2.0.12 (2010 6 )   ‐2.0.12‐     ‐2.0.12‐   Users/tg03/bin   ap.ebi.ac.uk   clustalw‐2.0.12macosx    
  24. 24. (nucleoode) A,T,G,C 4   A,G purine T,C pyrimidine A T G C   purine pyrimidine transioon  purine pyrimidine transversion   C α T β β β β A T α A G :transioon α :transversion β G C purine pyrimidine Figure 4‐4  Molecular Biology of the Cell (© Garland Science 2008) 
  25. 25. transioon/transversion   Rhodopsin CDS(coding sequence) 1047bp   transioon: A        G, C       T  transversion: A,G        C,T  NCBI ID   human(NM_000539) chimpanzee(XM_516740)  macaque(XM_001094250)   human – chimpanzee, human – macaque   transioon transversion   p distace   p distance =  /   transioon transversion p distance human‐ chimpanzee human‐  macaque 
  26. 26. Bioconductor/GeneR 1  R Users/tg03/bin   > library(GeneR)  # GeneR R   1) REST NCBI Rhodopsin   x R   > x <‐ "         "  > s <‐placeString(x)  2)  CDS R CDS   # rhodopsin.txt fasta   > writeFasta(file="rhodopsin.txt",from =96, to=1142, comment="human")  [1] 1   # 1: , ‐1:                        
  27. 27. Bioconductor/GeneR 2  1’) REST NCBI chimpanzee Rhodopsin   > x <‐ "         "  > s <‐placeString(x)  2’)  CDS R CDS   > writeFasta(file=“rhodopsin.txt”, from =    , to= , comment= "chimpanzee", append=T)    #append=T   1’’) REST NCBI macaque Rhodopsion   > x <‐ "         "  > s <‐placeString(x)  2’’)  CDS R CDS   > writeFasta(file=“rhodopsin.txt”, from =    , to= , comment= "macaque", append=T)    Users/tg03/bin rhodopsin.txt   Seq_R_96_1142    
  28. 28. Clustalw 3)  ClustalW mulople alignment   $ export PATH=/Users/tg03/bin/clustalw‐2.0.12‐macosx  $ cd /Users/tg03/bin/clustalw‐2.0.12‐macosx  $mv ~/bin/rhodopsin.txt ~/bin/clustalw‐2.0.12‐macosx  $ clustalw2 ‐INFILE=rhodopsin.txt ‐OUTFILE=rho.aln rho.aln     CotEditor / Courier Courier New   4)  transioon transversion  
  29. 29.   Rhodopsin CDS(coding sequence) 1047bp   transioon: A        G, C       T  transversion: A,G        C,T  human – chimpanzee, human – macaque   (NM_000539)‐(XM_516740) (NM_000539)‐(XM_001094250)  transioon transversion   transioon transversion p distance human‐ 5 1 6/1047 = 0.006 chimpanzee human‐   32 8 40/1047 = 0.038 macaque 600   3000    
  30. 30.   2 2     1 2 TCTGAGACCT TCTGTGACCT 5th A T  6th G C 3th T A  6th G C 6th G C 3th T A  9th C G  9th C G  5th A T  6th C G TCAGTGACCT  TCTGTCACGT  TCAGTGACCT  TCTGTCACGT 
  31. 31.     1) p distance:  :  , :  2) Jukes and Cantor model (1969):  A T C G     A ‐ α α α ( ) [ ( )] d = − 3 4 ln 1− 4 3 p T α ‐ α α G α α ‐ α 3) Kimura’s two parameter model (1980):    C α α α ‐     transioon   €   transvesion   A T C G ( )( P = 1 4 1− 2e−4 (α + β ) t + e−8 βt ) A ‐ β β α T β ‐ α Q= 1( 2)(1− e )−8 βt G β α ‐ β d ≡ 2rt = 2αt + 4 βt € C α β β ‐ € ( ) ( ) = − 1 2 ln(1− 2P − Q) − 1 4 ln(1− 2Q)
  32. 32. 1 ( a) a’,a”   t t+1   a’ t t+1        T    a’          T    a’          T    a’   (1‐r) (1‐r)2 a A G C        T     a a’’ 1‐2r (1‐r)        T   a”        T   a”        T   a” r 10‐8,10‐9  A G C   r =3α r2     ( t          T    a’          T    a’   (1‐r) ) a” :r         C   a”        T   a” r/3 2r(1‐r)/3 1‐r    t          A    a’          T    a’   r/3 2r/3 a’ :1/3        T   a”        T   a” (1‐r)
  33. 33. 2 Jukes and Cantor model (1969): t t+1   qt qt+1     qt t qt+1‐qt dq/dt                   (d)   2rt d   qt   ( ) [ ( )] d = − 3 4 ln 1− 4 3 p pt=(1‐qt):   p:               (p distance) €
  34. 34. human, chimanzee, macaque Rhodopsin   Jukes and Cantor model   transioon transversion p distance JC distance human‐ 5 1 6/1047 = 0.006  chimpanzee human‐   32 8 40/1047 = 0.038 macaque ( ) [ ( )] d = − 3 4 ln 1− 4 3 p 4   € > ‐(3/4)*log(1‐(4/3)*0.006) 
  35. 35.  R       (transioon/transversion )    

×