• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Nanogold & Quantum Dot as Novel Biosensors
 

Nanogold & Quantum Dot as Novel Biosensors

on

  • 1,718 views

Nanogold & Quantum Dot as Novel Biosensors

Nanogold & Quantum Dot as Novel Biosensors

Statistics

Views

Total Views
1,718
Views on SlideShare
1,718
Embed Views
0

Actions

Likes
0
Downloads
67
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Nanogold & Quantum Dot as Novel Biosensors Nanogold & Quantum Dot as Novel Biosensors Document Transcript

    • Gold Nanoparticle as Biosensor Nanogold &Quantum Dot as Novel Biosensors www.nanopartz.com/Gold_Nanorods.htm Amornpun Sereemaspun, MD. PhD. E-mail : amornpun.s@gmail.com Nanobiomedicine Laboratory • Nano gold (Colloidal Gold) Department of Anatomy – Nanometer-sized particles of gold in a fluid Faculty of Medicine – Size 1-100 nm. Chulalongkorn University – Intense red or yellowish color Why Gold Nanoparticles ? Gold Nanoparticles Synthesis • Easy to synthesis reduction stabilization • Protocol have been approved (J. Turkevich et al. 1951) Au3+ + Au0 Au0 • Stable in room temperature • Red color ;easy to monitor or detect • Biocompatibility • Can conjugate with nucleic acid or protein From; http://www.nature.com/nprot/journal/v3/n2/fig_tab/nprot.2008.1_F2.html Gold Nanoparticles and Optical Properties of Nanogold Biomolecules webexhibits.org www.azonano.com • Nanogold size is similar to many cellular objects • Gold surface can be coated by various biomolecules • The optical properties of gold nanoparticles can be tuned carefully by controlling their size and shape
    • Basic optical properties of Optical Properties of AuNPs nanoparticles 8 NanoGold As Products NanoGold As Products Lateral flow strip test From http://microgravity.hq.nasa.gov/general_info/homeplanet_lite.html Leptospirosis • A worldwide common zoonosis in mammalian • Spirochete-born disease • Empirical diagnosis-based • Staining – Gram unstainable – Silver stain OK • Culture – special media, Take times
    • CFU Leptospirosis 106 Urine Pregnancy Test 5 ×105 Nanogold Comparision with comercial kit 105 Dot-Blot ELISA 5 ×104 104 AuNP control 10 102 104 105 106 CFU Rojanathanes R. et al. 2008 Taiwan OB-GYN 2008, Fluorescence-based detection of Nanogold and DNA Detection protein kinase Kiley et al.(Nanomedicine. 2008) Mirkin et al. (Science 1997 ) reported DNA sandwich hybridization assay using DNA-nanogold conjugate. Kim, Y.-P., et al., Biosens. Bioelectron. (2007), 16 Lateral Flow Strip Test Microchromatographic-based Conjugate probe test line probe Control line probe http://www.rapid-diagnostics.org/index.htm Control line Control line Test line Test line Sample pad Sample pad Conjugate probe Conjugate probe
    • Lateral flow nucleic acid test strips Lateral flow nucleic acid test strips Xun et al. (Anal. Chem. 2009) Ioannis et al. (Anal. Chem. 2007) applied nucleic acid biosensor reported the first dry-reagent based on the oligonucleotide dipstick assay for SNP functionalized Au-NPs and genotyping by primer extension lateral flow for the detection of human genomic DNA directly with a detection limit of 2.5 µg/mL (1.25 fM) 20 (Zhao et al., PNAS,2004) (Wang et al., Bioconjugate Chem, 2007) What Are Quantum Dots? • Crystalline fluorophores • CdSe semiconductor core/ ZnS Shell • Unique Spectral properties – Broad absorption – Narrow emission – Wavelength depends on size 3 nm (Rosi et al., Science, 2006)
    • QDs vs. Other Fluorescence QDs vs. Other Fluorescence • Photostability (quantum dots do not photobleach) • Broader excitation spectrum and narrower emission spectrum • No spectral overlap between dots of different size Quantum dots conjugate - red Alexa 488 conjugate - green Wu et al. Nature; 2003 Jaiswal & Simon 2004 Conjugating quantum dots to biomolecules Quantum dots Avidin • Avidin or protein-G with positively charged tail conjugated to negatively charged DHLA coat of quantum dots protein G Summary Future Outlook • Gold Nanoparticle are key components of numerous • Development of QD lasers at communication wavelengths • Gain and stimulated emission from QDs in polymers assays for biologically analytes, including proteins, – Polymeric optoelectronic devices? nucleic acids, small molecules and metal ions. • Probe fundamental physics • Colorimetric assays provide a sensitive test • Quantum computing schemes (exciton states as qubits) – Basis for solid-state quantum computing? • Gold nanoparticle improve the performance of • Biological applications many conventional assays. • Material engineering – How to make QDs cheaply and easily with good control? • Let’s not forget the electronic applications too! • Lots to do! C. Seydel. Quantum dots get wet. Science, 300, p. 80-81, Apr 2003.
    • Methylation probe T C MT G UTG Thank you Methylation probe Probe Sequence AuNP-Probe Met 5’-thiol-TTTTTTTTTTACCTTACCCGCTCCATCGCG -3’ Test line (T) Met’ 5’-TCACTAACCGCTCCTCAAACAAATACG-TEG-biotin-3’ Control (C) Met Com 5’-biotin- TTTTTTTTTTCGCGATGGAGCG GGTAAGGT-3’ AuNPs-Probe: Methylation-probe 15 µL Test line(T): 1/10 Streptavidin-Biotin-Probe (Methylation) Control line(C): 1/10 Streptavidin-Biotin-Probe (Control) Hybridization buffer: 6XSSC, 0.5% SDS, 50% Formamide Condition adjustment of new unmethylation biotin-probe Condition adjustment of new methylation biotin-probe 0.1 µM Synthetic target T C 0.1 µM Synthetic target (Met or Unmet) 10 µl MT (Met or Unmet) 10 µl MT T C Hybridization buffer 1 G MTG UTG UTG Add 90 µl Add 90 µl G Hybridization buffer Hybridization MT Hybridization buffer MT UTG buffer 2 G UTG G MTG=methylation target, UTG=unmethylation target MTG=methylation target, UTG=unmethylation target Apply mixture to Apply mixture to sample pad Probe µl MTG=methSequence sample pad Probe µl Sequence AuNP-Probe Unmet 15 ylation 5 -thiol-TT TTT TTT TTC ACA ACT AAC CTT ACC CAC TCC ATC ACA -3 AuNP-Probe Met 15 5 -thiol-TTT TTT TTT TAC CTT ACC CGC TCC ATC GCG -3 Test line (T) 1/10 Unmet 1 5 -CAT CAA ACA TCT CCA ACA ACC ACT CCA C-TEG-biotin-3 Test line (T) 1/10 Met 1 5 -CGT CAA ACA TCT CCG ACG ACC GC-TEG-biotin-3 Control (C) 1/10 Unmet 1 5 -biotin-TTTTTTTTTTTGTGATGGAGTGGGTAAGGTTAGTTGTG-3 Control (C) 1/10 Met 1 5 -biotin- T TTT TTT TTT CGC GAT GGA GCG GG TAA GGT-3 Hybridization buffer 1 6×SSC, 1%BSA, 0.01% SDS, 0.2% Tween-20, Hybridization buffer 2 6XSSC, 1% BSA, 0.01% SDS, 0.2% tween 20, 50% Formamide Hybridization buffer 2 6XSSC, 1% BSA, 0.01% SDS, 0.2% tween 20, 50% Formamide Result: Buffer 2 can reduce non specific hybridization Condition adjustment of strip test with genomic DNA Condition adjustment of SRY strip test DNA 5 µl (treat bisulfite) T C 1 µg DNA(Male) T C B MT Denature G Met Denature ZP3 SRY at 100oC, 5 min N MTUTG at 100oC, 5 min G B MT Chill in ice, 15 min UTG Unmet Chill in ice, 10 min N G Apply DNA to Apply DNA to B=Bisulfite treatment DNA, N=No treatment DNA sample pad sample pad Probe µl Sequence AuNP-Probe SRY 10 5 -thiol-T TTT TTT TTT GAT GAT TAC AGT CCA GCT GTG CAA G-3 Probe µl Sequence 5 -thiol-TTT TTT TTT TAG CCA TCC TGA GAC GTC CGT ACA-3 ZP3 10 AuNP-Probe Unmet 15 5 -thiol-TT TTT TTT TTC ACA ACT AAC CTT ACC CAC TCC ATC ACA -3 Test line (T) SRY 1 5 -GAA TAT TCC CGC TCT CCG GAG AAG TTT TTT TTT T-biotin-3 Apply buffer to Met 15 5 -thiol-TTT TTT TTT TAC CTT ACC CGC TCC ATC GCG -3 Apply buffer to 1/10 ZP3 1 5 -GCC CGT ACT GGT GGA GTG TCA TTT TTT TTT T-biotin-3 Test line (T) Unmet 1 5 -CAT CAA ACA TCT CCA ACA ACC ACT CCA C-TEG-biotin-3 sample pad 1/10 Met 1 5 -CGT CAA ACA TCT CCG ACG ACC GC-TEG-biotin-3 sample pad Control (C) SRY 1 5 -biotin-TT TTT TTT TTC TTG CAC AGC TGG ACT GTA ATC ATC-3 5 -biotin-TTT TTT TTT TTG TAC GGA CGT CTC AGG ATG GCT-3 1/10 ZP3 1 Control (C) Unmet 1 5 -biotin-TTTTTTTTTTTGTGATGGAGTGGGTAAGGTTAGTTGTG-3 5 -biotin- T TTT TTT TTT CGC GAT GGA GCG GG TAA GGT-3 Hybridization 6×SSC, 1%BSA, 0.2% Tween-20, 0.01% SDS 1/10 Met 1 buffer Hybridization 6×SSC, 1%BSA, 0.2% Tween-20, 0.01% SDS buffer Result: SRY test line appear red band