Euphytica Identificación de genes de resistentes al virus mosaico de la soya con ayuda de marcadores                      ...
EuphyticaIntroducción:Virus del mosaico de la soja pertenece a la   Un mutante designado SMV-G3A inducefamilia de los poty...
Euphyticaplantas que llevan RSV1 (Chen et al.1991).En contraste, el gen Rsv3 confiereresistencia a las cepas G5 a G7 de SM...
EuphyticaEstamos interesados en establecer un             Para comprender las relaciones alélicassistema de cría en los qu...
EuphyticaEn los otros casos, incluyendo líneas          Bloomington, IN). Los cebadores para elparentales, F2: 3, y RILs, ...
EuphyticaResultados                                     de G7. La línea de soja V94-5152, que lleva                       ...
Euphytica                                              Sinpaldalkong. Además, no se identificaron                         ...
EuphyticaLa identificación de genes de resistencia a        Cuando la población RIL de un cruce entreSMV por marcadores mo...
EuphyticaInoculación G4 o G7H de la RIL resultó en    proporciones de segregación genotípica deuna proporción de segregaci...
Euphyticaproporciones de segregación genotípica deSat_424    y     M3Satt,      que   estánestrechamente vinculados a esta...
EuphyticaEn el caso de Jinpumkong 2, nuestros        cuidadoso de los dos datos deestudios de herencia sugirieron que     ...
EuphyticaSin embargo, nuestros resultados sugieren      Educación,    Ciencia   y   Tecnología,laque el síntoma de necrosi...
Upcoming SlideShare
Loading in...5
×

Identificación de genes de resistentes al virus mosaico de la soya con ayuda de marcadores en líneas de soja (1)

169

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
169
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
1
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Identificación de genes de resistentes al virus mosaico de la soya con ayuda de marcadores en líneas de soja (1)

  1. 1. Euphytica Identificación de genes de resistentes al virus mosaico de la soya con ayuda de marcadores en líneas de soja.Jung-Kyung Moon - Soon-ChunJeong -Kyujung Van - M. A. SaghaiMaroof - Suk-Ha LeeRecibido: 3 de febrero de 2009 / Aceptado: 25 Mayo 2009©SpringerScience + Business Media B.V. 2009Resumen: Los estudios de herencia sugirieron que Sinpaldalkong albergaba el gen RSV1, queLas plantas de soya reaccionan de fue confirmado luego por mapeo dediferente manera a las cepas del virus marcador molecular. Los estudios demosaico de lasoja (SMV) debido a las herencia también sugirieron queinteracciones entre los diferentes genes de Jinpumkong 2, que es la más resistente a laresistencia en el genoma de la soja. Han infección del SMV entre los cuatrosido identificados tres genes cultivares, contenía los genes RSV1 y Rsv3,independientes resistentes al SMV por lo que fue confirmado por mapeo deestudios de herencia y análisis de marcador molecular. Nuestro enfoque, queligamiento. Para desarrollar cultivos de soja combina estudios de herencia y análisisduraderos resistentes a los SMV, es moleculares de ligamiento, permite lanecesario determinar qué genes de soja identificación eficiente de gen deresistentes al SMV pueden ser transferidos resistencia en cuatro cultivares de sojafácilmente desde los cultivares susceptibles coreanas.en un sistema de reproducción.Acontinuación, se presenta el tipo y númerode genes resistentes en cuatro cultivaresde soja de elite coreanos usando una Palabras clave: análisis de asociación,combinación de síntomas de reacción análisis de ligamiento, soja, virus mosaicoenfermedades, estudios de herencia y de la soja.asignaciones de marcadoresmoleculares.Las reacciones de laenfermedad en variedades de sojaSowonkong y Keunolkong en respuesta a lainfección con cepas deSMV sugirió queambas cultivares más probable puerto delgen RSV1 similar a la de York. Estudiosposteriores confirmaron que la herenciaSowonkong tiene el gen RSV1.ᴎVillalobos
  2. 2. EuphyticaIntroducción:Virus del mosaico de la soja pertenece a la Un mutante designado SMV-G3A inducefamilia de los potyvirus y causa una de las síntomas de mosaico en Marshall, Ogden, yEnfermedades virales más prevalentes de Jangbaekkong. G5H causa síntomas desoja en el mundo ([Glycinemax (L.) necrosis en Suwon 97 (llamadoMerr.Sinclair 1982; Thottapilly y Rossel Hwangkeumkong) y mosaico en1987). En 1988 la enfermedad de SMV fue Jangbeakkong, que son inmunes a la cepael principal factor responsable de las G5 de SMV. Posteriormente, los nuevepérdidas de producción de semillas entre alelos RSV1-T, RSV1-Y, RSV1-m, RSV1-K,los principales productores de soja de RSV1-R, RSV1-H,-s, RSV1 RSV1-n, y RSV1 d-países como China, Indonesia (Wrather et han sido identificados en Ogden, York,al. 2001a), y en algunas regiones de los Marshall , Kwanggyo, Raiden, Suwon 97Estados Unidos (Wrather et al. 2001b). Los (Hwangkeumkong), PI 486355, PI 507389 ysíntomas inducidos por el SMV de mosaico FT-10, respectivamente (Chen et al 1991,creanrango leve de necrosis letal (Cho y 1994, 2001, 2002;.Ma et al 1995, 2003,..Goodman 1979). De vainas, el número de Silva et al 2004) Todos los alelos RSV1semillas por vaina, tamaño de la semilla, y excepto RSV1-h, que confieren resistenciapeso de la semilla se reducen y cubierta de al SMV de cepas de G1 a G7, hacer sojala semilla moteada aumenta después de necrótico o susceptible a siete grupos dedesarrollo de SMV en plantas de soja en deformación SMV. Estudios de herenciauna etapa temprana de crecimiento (Hill et con otras variedades de soja inmunes a laal. 1987). mayoría de cepas SMV identificaron dos genes de resistencia más independiente,SMV, una enfermedad viral transmitida por Rsv3 y RSV4. Se informó que diversossemilla, también es transmitida por áfidos. Germoplasmas de soja tienen la resistenciaSin embargo, la soja es la única de las 33 en el locus Rsv3 derivados de Harosoyespecies de plantas hospederas que se (Buzzel y Tu 1989). Además, seissabe que lleva SMV durante el invierno en variedades, incluyendo OX686, L29,la naturaleza (Edwardson 1974). Noventa y Columbia, Tousan 140, Hourei y Zao 18,ocho SMV aislados a partir de semillas en fueron empleados para estudiar lalas colecciones de germoplasma de soja en herencia y de los alelismo en genes RSV1 ylos EE.UU. se clasificaron en grupos de Rsv3(Buzzell y Tu, 1989; Gunduz et aldeformación, G1 a G7 designada, en base a 2002;.Liao et al . 2002; Ma et al 2002). Loslos síntomas (mosaico, necrosis, o estudios de herencia fueron posiblesresistente) inducidas en una variedad de debido a los síntomas de la enfermedadcultivos de soja incluyendo Essex, Davis, causada por la infección diferenciales SMVYork, Kwanggyo, Marshall, Ogden, y PI de la soja que llevan el gen o RSV1 Rsv3. El96983 (Cho y Goodman 1979, 1982). gen RSV1 generalmente confiereAdemás de la agrupación inicial de SMV, resistencia a números más bajos grupos devarias ruptura aisladas a la resistencia se deformación entre los siete grupos cepahan identificado en las últimas dos SMV (G1 a G7) previamente clasificadosdécadas, tanto en Corea y Brasil. G3A y por Cho y Goodman (1979), mientras queG5H fueron reportados inicialmente por con números más altos los grupos de cepaCho et al. (1983) como mutantes derivados produjo síntomas necróticos o mosaico ende las cepas G3 y G5, respectivamente. ᴎVillalobos
  3. 3. Euphyticaplantas que llevan RSV1 (Chen et al.1991).En contraste, el gen Rsv3 confiereresistencia a las cepas G5 a G7 de SMV,mientras que la necrosis mosaico o tallo depunta se observa después de la inoculaciónde las plantas con cepas con menornúmero de SMV. El gen RSV4 se informóinicialmente como dos genes de resistenciaindependientes en PI 486355 (Ma et al1995.); Este cultivar de soja se muestramás adelante para que contenga losgenes RSV1 y RSV4 (Buss et al 1997; Hayeset al 2000). Resistencia condicionada porlos genes en el locus RSV4 ha sidoreportado en PI 486355, Pekín, y PI 88788(Ma et al 1995;.. Gunduz et al 2004). Lapresencia del gen RSV4 da lugar a laresistencia completamente dominante asiete cepas al SMV, el enmascaramiento dela expresión de la necrosis sistémica queresulta de la expresión del alelo RSV1 (Maet al. 1995). La disponibilidad de una únicaresistencia que contiene el gen de línea apartir de los estudios de herencia hallevado a la cartografía molecular de RSV1,Rsv3, y RSV4 en cromosomas (Chr) 13(grupos de vinculación (LGS) F), 14 (B2 LG),y 2 (LG D1b), respectivamente (Yu et al1994;. Hayes et al 2000, 2004;.Jeong et al2002.). Los estudios de herencia descritosanteriormente han demostrado ser crucialen la identificación de tres genes deresistencia independiente de SMV en lasoja. Aunque estos enfoques podríanfacilitar el descubrimiento de nuevos genesde resistencia SMV _ en los cultivos de sojacon un amplio espectro de resistencia, lacombinación de estudios de herencia yanálisis de marcadores moleculares puedepermitir una determinación más rápida yeficiente del tipo y número de genes deresistencia en las variedades de soja.ᴎVillalobos
  4. 4. EuphyticaEstamos interesados en establecer un Para comprender las relaciones alélicassistema de cría en los que los genes de soja entre los genes de resistencia en cultivaresresistentes a SMV puede ser fácilmente de soja en el RSV1, Rsv3 y loci RSV4, setransferidos a los cultivares susceptibles. realizaron cruces de Jinpumkong 2 oPara lograr esto, primero tenemos que Sowonkong con PI 96983 (RSV1), L29determinar cuántos genes y qué tipo de (Rsv3) y V94-5152 (RSV4) Una poblacióngenes son albergados por varias obtiene de una cruz de Sinpaldalkong conimportantes líneas de soja coreana de cría. PI 96983 también se utilizó.A continuación, se presenta el tipo y elnúmero de genes de resistencia en los Cepas de SMVcultivares de soja de Corea, Jinpumkong 2, Once cepas SMV, a saber, G1, G2, G3, G4,Sinpaldalkong, Keunolkong y Sowonkong. G5, G6, G7, G7a, G5H, G6H y G7H seNuestros resultados sugieren que el uso utilizaron para este estudio. SMV G1-VAtanto de la herencia y métodos asistidos (PV-571), G2 (PV-615), G3 (PV-616), G4-VApor marcadores podría facilitar (PV-572), G6 (PV-612), G7 (PV-613), y G7aenormemente la identificación de genes de (PV-614) se obtuvieron de la Americanresistencia en soja. Type Culture Collection (Rockville, MD,Materiales y métodos. EE.UU.) y G5H (SB15), G6H (SB32), y G7H (SB26) fueron proporcionadosMateriales vegetales para poblaciones de generosamente por el Dr. Yul-Ho Kim en elmapeo y parental de soja cruces utilizados Instituto Nacional de CropScience (Suwon,para identificar el tipo y el número de Corea). Los síntomas causados por cadagenes de resistencia SMV en Jinpumkong 2, cepa fueron verificadas por la inoculaciónSinpaldalkong, Keunolkong, y cultivares de cultivos de soja diferenciales.Sowonkong se enumeran en la Tabla 1.Para mapear los genes de resistencia en SMV screening en los padres y laJinpumkong 2 utilizando marcadores cartografía de la poblaciónmoleculares, una línea consanguínea Inoculaciones de invernadero se realizaronrecombinante (RIL) de la población de un esencialmente como se describe por Chencruce entre Pureunkong Jinpumkong2 (en et al. (1991). Los inóculos se hicieron alo sucesivo, la población PJ) se utilizó. Esta partir SMV infectados por hojas de cultivarpoblación RIL se desarrolló a través de un de soja Lee 68. Las hojas semétodo simple semilla descenso de las homogeneizaron en 5 ml de tampóngeneraciones F3 a la F9. Pureunkong se fosfato 0,01 M (pH 7,0) por gramo depresume que contiene RSV1 sobre la base tejido fresco. Líneas diferenciales de sojade sus granjas de selección (Kim et al. que se utilizaron para confirmar la1996). Utilizando el método de descenso identidad de las cepas fueron Lee SMV 68semilla individual de la F3 a las (RSV), York (RSV1-y), Kwanggyo (RSV1-k),generaciones F9, otra población RIL de un Marshall (RSV1-m), Ogden (RSV1-t), PIcruce entre Keunolkong y Sinpaldalkong 96983 (RSV1), y Hwangkeumkong (RSV1-h).(en lo sucesivo, la población KS) fue En el caso de las poblaciones F2, solaestablecido para localizar los genes de planta se cultivó en cada maceta para laresistencia en Keunolkong y Sinpaldalkong. inoculación SMV. ᴎVillalobos
  5. 5. EuphyticaEn los otros casos, incluyendo líneas Bloomington, IN). Los cebadores para elparentales, F2: 3, y RILs, alrededor de 10- marcador de polimorfismo de secuencia15 plantas se cultivaron en cada olla de sencilla longitud OPN11-Sec se diseñó adiámetro de 15-cm de plástico para partir de secuencias N11PF (Jeong yinoculación de SMV.Se inocularon hojas SaghaiMaroof 2004); hacia adelante,primarias completamente expandidas por AAGAAACTTTAAAACTGGGT e inversa,el roce de inóculo-torundas de algodón TCTTCAACAGGTCAATAGTC. Cincuentaempapadas en hojas de carborundum- nanogramos de ADN se utilizó como moldeespolvoreados, a continuación, las hojas en una reacción de 10 ll que conteníainoculadas se enjuaga inmediatamente. tampón 19reaction (10 mM Tris-HCl, 50Once cepas de SMV se inocularon en los mMKCl, pH 8,3), 2,5 mM de MgCl2, 2 lM depadres de mapeo para seleccionar cepas de cada cebador, dNTPs 50 lm, y 1,0 unidad depara el mapeo molecular de genes de Taq polimerasa. Treinta y cinco ciclosresistencia en cada población. Sobre la estándar de PCR se realizó como sigue:base de la reacción de los padres de mapeo desnaturalización a 94 º C durante 30 s,a SMV, cepas de SMV para el marcador de hibridación del cebador a 47 º C durante 30la enfermedad de los individuos o líneas en s, y extensión del cebador a 72 º C durantelas poblaciones se determinaron. Las 30 s. Los productos de PCR se resolvieronplantas fueron calificadas por reacción en un gel de poliacrilamida al 4,0% y seenfermedad en cada semana durante un visualizaron usando un kit de tinción deperíodo de 4 semanas después de la plata de acuerdo con las instrucciones delinoculación. Las reacciones se registraron fabricante (Bioneer, Daejon, Corea) ocomo resistentes (sin síntomas), necrosis mediante electroforesis en 1,5% (w / v)(necrosis tanto local como sistémica) o horizontales geles de agarosa con bromurosusceptible (mosaico). de etidio en Tris-borato-EDTA (TBE).Análisis de marcadores Análisis de los datosLas muestras de hojas para la extracción de Las proporciones de segregación paraADN se obtuvieron de cada planta de los reacciones de enfermedades causadas porpadres y las líneas o los individuos de las el SMV y datos de marcadores molecularespoblaciones de mapeo. El ADN fue aislado en cada población se evaluaron mediantede acuerdo con el método descrito por pruebas de Chi cuadrado. Usando 3.0bKeim et al. (1988). Después de 17 y 9 Mapmaker (Lander et al. 1987), las órdenesmarcadores moleculares fueron utilizados de marcadores y rasgos en el mapa separa estudio parental polimórficos en las determinaron por análisis de de dos o trespoblaciones PJ y KS, respectivamente puntos en una probabilidad logarítmica de(Tabla 1), un total de trece marcadores 3,0 con una distancia máxima de 50 cmpolimórficos se emplearon para la según la función de Kosambi. Mapas deconstrucción de mapas genéticos en los soja conexiones que indique las posicionesRSV1 y Rsv3 regiones cromosómicas. Las de los marcadores fueron producidos porsecuencias de los cebadores de MapChart, versión 2,2 (Voorrips 2002).microsatélites se obtuvieron a partir deSong et al. (2004), con la excepción de64A8C que fue proporcionada por el Dr.Roger Innes (Indiana University,ᴎVillalobos
  6. 6. EuphyticaResultados de G7. La línea de soja V94-5152, que lleva RSV4 como su único gen de resistenciaPara determinar qué cepas de SMV se debe SMV (Buss et al. 1997), fue resistente aemplear para la fenotipificación de las todas las cepas SMV (Tabla 2)enfermedades y los análisis de mapeo, lasreacciones de los cultivares coreanas a un El cultivar de soja Pureunkong se deriva detotal de 11 cepas de SMV fueron un cruce entre cheongseaknamulkong, unaencuestadas (Tabla 2). Reacciones de raza criolla coreano, y 379-L78, que es unaEnfermedades de las variedades línea isogénica de retrocruzamientodiferenciales de soja al SMV G1, G2, G3, derivado de Williams que lleva el gen deG5, G6, G7 y las cepas fueron consistentes resistencia a RSV1 de PI 96983con estudios anteriores (Cho y Goodman (http://soybase.org). Por lo tanto,1979;.Ma et al 2003). Sin embargo,cepa G4 Pureunkong, como padre materna en ladel SMV (G4-VA) obtenido de la American población PJ, contiene el alelo RSV1Type Culture Collection provocó reacciones derivado de PI 96983. Como era dediferentes en los cultivares de soja esperar, Pureunkong mostró la mismaMarshall, Ogden, y PI 96983 en reacción a la infección de SMV como PIcomparación con las reacciones notificadas 96983. Jinpumkong 2 mostraronpor Cho y Goodman (1979). Estos tres reacciones necróticas tras la infección concultivares presentaron síntomas necróticos la cepa G7H y era resistente a todas lasen lugar de permanecer asintomáticos. otras cepas. Keunolkong y SowonkongEntre las cepas coreanas de SMV, la cepa mostró reacción a enfermedades muyG5H indujo la reacción misma enfermedad similares a los de York. Otros estudios deque el G5 en todos los cultivares herencia de los genes de resistencia endiferenciales excepto Hwangkeumkong. Sowonkong se llevaron a cabo pero,Marshall tenía síntomas necróticos Keunolkong y Sowonkong se encontró quedespués de la infección con la cepa G6, sólo llevan el gen RSV1. Sinpaldalkong,mientras que los síntomas de mosaico como padre de la población KS, mostró lafueron inducidos por la cepa G6H. Después misma reacción a la infección de SMVde la infección de PI 96983 con síntomas como PI 96983, excepto que SinpaldalkongG7, necróticas apareció, pero este genotipo también mostró síntomas de necrosisde soja, que sólo caries RSV1, era después de la infección con la cepa G3. deasintomáticas después de la infección con SMV cepas a las que un cultivar padre erala cepa G7H. Aunque Hwangkeumkong resistente y susceptible del cultivar otro(Suwon 97) muestran la inmunidad a la G1 padre. Sin embargo, en el caso de laa G7 cepas de SMV, el G5H, G6H, y las población PJ, ya que las reacciones detensiones inducidas G7H síntomas enfermedades a G7a no siguió la esperadanecróticos en este cultivar. La línea L29 de de 1:1 como se describe a continuación, sesoja, que lleva Rsv3 como su único gen de utilizó G4, G7, y G7H porque estas cepasresistencia SMV (Buss et al 1999;.. Jeong et virales indujo una reacción necrótica enal 2002), mostraron síntomas de mosaico uno de los padres, pero una resistenciaen reacción a la infección con el G1, G2, reacción en el otro padre.G3, G4, G7H, y cepas de G7A, y eraresistente a la G5, G5H, G6, G6H, y cepas ᴎVillalobos
  7. 7. Euphytica Sinpaldalkong. Además, no se identificaron individuos susceptibles en la población F2La identificación de genes de resistencia a de un cruce entre Jinpumkong 2 (R) y PISMV por estudios de herencia. 96983 (R, RSV1) cuando la cepa G1 seNo se identificaron individuos susceptibles inocularon (Tabla 3). La ausencia deen la población F2 de un cruce entre individuos susceptibles indicaron queSowonkong (R) y PI 96983 (R, RSV1) en G1 Jinpumkong 2 puertos un alelo RSV1.cepa de inoculación (Tabla 3). La ausencia Cuando la cepa se inoculó SMV G6, unde individuos susceptibles indicó que individuo necrótico y un individuo mosaicoSowonkong alberga un alelo RSV1. La fueron observadas entre las 114 plantas enpoblación F2 de un cruce entre Sowonkong la población F2 de un cruce entre(S) y L29 (R, Rsv3) mostraron un buen Jinpumkong 2 (R) y L29 (R, Rsv3) (Tabla 3).ajuste a un monogénica 3 (R N?): 1 (S) Estas dos personas pueden ser falsosSowonkong relación porque no tiene el gen positivos. Aunque la relación esperada paraRsv3 (Tabla 3). En la población F2 de un la segregación equipado a la segregacióncruce entre Sowonkong (S) y V94 5152-(R, trigenic, el tamaño de la población F2RSV4), algunos individuos fueron podría no ser suficiente para la prueba deidentificados como susceptibles a la cepa segregación trigenic. Sin embargo,de SMV G7H. Esto sugiere que el gen RSV4 nuestros resultados indicaron queno está presente en Sowonkong. Jinpumkong 2 tiene Rsv3. En el locus RSV4,Sowonkong mostraron las reacciones las poblaciones F2 de un cruce entremisma enfermedad York pero, nuestros Jinpumkong 2 (R) y 5152 V94-(R, RSV4)datos indican que Sowonkong más seguido de un patrón de segregaciónprobable es que contenga un único gen digenic con respecto a la infección por ladominante RSV1. No se identificaron cepa SMV G7, lo que sugiere queindividuos susceptibles en la población F2 Jinpumkong 2 puertos y el RSV1 Rsv3 genesde un cruce entre Sinpaldalkong (R) y PI más que el gen RSV4.96983 (R, RSV1) (Tabla 3), apoyando lapresencia de un alelo RSV1 enᴎVillalobos
  8. 8. EuphyticaLa identificación de genes de resistencia a Cuando la población RIL de un cruce entreSMV por marcadores moleculares. KeunolkongSinpaldalkong y se inocularon con G5 o G6, la segregación fenotípicaPara evaluar si los estudios de herencia proporcionado un buen ajuste a un 1Rfueron apoyados por análisis de monogénica: relación 1S, lo que indica lamarcadores moleculares, se construyeron segregación de un gen en la cruz (Tabla 4).mapas de ligamiento con las reacciones de Los síntomas provocados por la infecciónla enfermedad y los datos de marcadores con el G5 o G6 cepas SMV en estamoleculares cerca de la región genómica población fueron asignadas entre loscon un énfasis específico en los informes 64A8C y Sct_033 marcadores (Fig. 1). Esteanteriores independientes loci dominantes locus para el gen RSV1 es coherente conresistencia SMV. Dado que los programas los informes anteriores (Gore et alactuales de cría acuerdo con variedades de 2002;.Jeong y SaghaiMaroof 2004). La cepasoya que llevan más de un gen de G7a, que es la única cepa SMV que induceresistencia a SMV, hemos construido una reacción de mosaico en Pureunkong ymapas de ligamiento moleculares tanto una reacción resistente en Jinpumkong 2,para el KS y poblaciones PJ obtenido a se inoculó en la población RIL formada porpartir de cruces entre líneas de soja un cruce entre la Pureunkong yparental, ambos de los cuales llevan gen de Jinpumkong 2. La segregación fenotípica noresistencia (s) (Fig. 1 ). Un total de 17 y 9 se se ajustaba a la 1R monogénica: relaciónemplearon marcadores polimórficos para 1S, lo que indica que más de un gen sela encuesta de los padres en las segregantes (Tabla 4). Los resultadospoblaciones del PJ y KS, respectivamente inesperados se podría explicar por la(Tabla 1). En población PJ, 12 marcadores cartografía de marcadores molecularesfueron capaces de posicionarse en estrechamente ligados a los genes RSV1 ydiferentes cromosomas 2, pero la Rsv3, como se describe a continuación.población KS tenía solamente 4 Hemos sido capaces de identificar losmarcadores polimórficos localizados en Chr genes SMV resistencia en respuesta a la13 (LG F) (Fig. 1). inoculación con G4, G7, o G7H, que ya sea inducida reacciones necróticas o resistencia en una de las líneas de soja parental. ᴎVillalobos
  9. 9. EuphyticaInoculación G4 o G7H de la RIL resultó en proporciones de segregación genotípica deuna proporción de segregación fenotípica OPN11-Sec (v2 value = 5,76) y Satt510 (v2significativamente diferente de la teórica value = 4,96), que estaban estrechamenterelación 1:1 (Tabla 4). No obstante, los vinculados a esta región, también difiriódatos sobre la enfermedad se han asignado significativamente de la teórica relación 1:1a una región entre los Satt114 y OPN11 con valores similares a los de x2 G4 o G7H.Sec-marcadores (Fig. 1) que se había Esto sugiere que una distorsión de lainformado anteriormente a ser el locus segregación región que abarca más de 10RSV1 (Gore et al 2002;.Jeong y cM (Yang et al. 2008) está presente en estaSaghaiMaroof 2004). Curiosamente, las a ser el locus Rsv3 (Jeong et al. 2002). LasᴎVillalobos
  10. 10. Euphyticaproporciones de segregación genotípica deSat_424 y M3Satt, que estánestrechamente vinculados a esta región,también caben la teórica 1:1.La inoculación de G7a montado un 3R: 1S Discusión(valor v2 = 1,52) en lugar de la relaciónteórica proporción de 1:1 (valor v2 = Hemos identificado el gen de resistencia a13,14). Sin embargo, esta observación SMV (s) en cuatro cultivares de sojapuede ser explicada por la hipótesis de que importantes de Corea. A diferencia detanto los RSV1 y Rsv3 genes en Jinpumkong estudios anteriores, nuestro enfoque2 confieren resistencia a G7a, que está utilizado tanto en estudios de herencia ysoportado por la combinación de los análisis moleculares de ligamiento parasíntomas de reacción a la enfermedad y los identificar genes independientesdatos de genotipado de marcadores. Sobre dominante (s) en variedades de soya sinla base de datos de marcadores cruzarse con variedades susceptibles, comomoleculares genotipo (Tabla 5), podemos Essex y Lee68 (por ejemplo, Ma et al 1995,predecir que los 27 RILs que mostraron una 2002;.Shi et al. 2008). Las reacciones dereacción mosaico G7a para albergar un gen enfermedades de los variedades de soya adominante RSV1 de Pureunkong cepas SMV sugirió que Sowonkong y(denominado en lo sucesivo Rsv1pu), pero Keunolkong más probable contener unno protege a un dominante RSV1 (en lo único dominante RSV1 de tipo gen desucesivo Rsv1ji ) o un gen dominante Rsv3 resistencia similar a la de York.(Rsv3ji en lo sucesivo). Los 13 RILs que eran Sinpaldalkong puede contener un únicoresistentes a G7a se prevé que el puerto dominante RSV1 gen de tipo similar a la deRsv1ji pero no Rsv3ji. Los 18 RILs que eran PI 96983 y dos genes de resistenciaresistentes a G7a podría contener Rsv3ji en dominantes podrían estar presentes enlugar de Rsv1ji, mientras que los 19 RILs jinpumkong 2. Nuestros estudios(resistentes a G7a) podría tener tanto confirman que la herencia SowonkongRsv1ji y Rsv3ji. Por lo tanto, los genotipos tiene un solo gen dominante RSV1.de los 11 RILs que mostraban resistencia a Nuestros resultados de la vinculación deG7a podría ser rsv1jiRsv3ji o Rsv1jiRsv3ji. marcadores confirmar que SinpaldalkongLa relación de segregación entre contiene una dominante RSV1 gen quersv1jirsv3ji, Rsv1jirsv3ji, rsv1jiRsv3ji y confiere resistencia a SMV-G5 y G6-.equipado Rsv1jiRsv3ji la teórica relación1:1:1:1 (valor v2 = 1,52, P 0,05), aunque elvalor v2 no pudo ser estimado conprecisión de acuerdo con la suposición deque los 11 RILs eran rsv1jiRsv3ji orsv1jiRsv3ji. ᴎVillalobos
  11. 11. EuphyticaEn el caso de Jinpumkong 2, nuestros cuidadoso de los dos datos deestudios de herencia sugirieron que enfermedades de reacción y los datos deinpumkong 2 en su mayoría marcadores moleculares sugieren queprobablemente contiene los tanto los RSV1 y Rsv3 genes en Jinpumkonggenesdominantes RSV1 y Rsv3. Sin 2 confiere resistencia a G7a. Curiosamente,embargo, los estudios de herencia con nuestros intentos para el mapeo de losJinpumkong 2 no fueron concluyentes genes de resistencia SMV en Jinpumkong 2debido a error de tipo 1. Jinpumkong 2 mediante el uso de G7 G4, y G7H quepuede contener un gen no identificado en mostró ya sea necrosis o una reacción deun lugar separado de los genes de resistencia a caºda una de las líneasresistencia conocidos SMV, RSV1, Rsv3 y parentales de soja tuvieron éxito. AmbosRSV4. Sin embargo, la reacción de la síntomas de necrosis y / o resistencia seenfermedad en respuesta a la infección cree que ser conferida por genesSMV no se podría utilizar para mapa Rsv3 resistentes, por lo que los segregantes conen Jinpumkong 2 sobre la base de estudios síntoma de necrosis tendía a serde herencia con inoculación G7a en la combinado con la clase de resistencia parapoblación RIL de un cruce entre las pruebas de herencia y el mapeo (porPureunkong y Jinpumkong 2. Un examen ejemplo Zheng et al 2006;.. Shi et al 2008).ᴎVillalobos
  12. 12. EuphyticaSin embargo, nuestros resultados sugieren Educación, Ciencia y Tecnología,laque el síntoma de necrosis podría ser República de Corea.usado independientemente para generardatos de genotipado para propósitos demapeo. La resistencia al SMV, nuevasfuentes de resistencia debe ser identificadoo piramidal de genes que se sabe debellevarse a cabo, frecuentemente requierenque consumen mucho tiempo y alelismopruebas adicionales de los estudiosgenéticos (Zheng et al 2005).. Entre loscultivares estudiados aquí, el másresistente a la SMV cultivar fueJinpumkong 2, que contiene dos genes deresistencia, y RSV1 Rsv3. Los resultados soncoherentes con los informes anteriores quemuchos SMV cultivares resistentescontienen dos o más genes de resistenciaSMV (s) (Ma et al 1995, 2002;.Chen et al2001;.. Zheng et al 2006). Por lo tanto,nuestros resultados sugieren que losfuturos esfuerzos de mejoramiento SMVdebe orientarse hacia la pirámide SMVgenes de resistencia en las líneas de sojade elite, como se demostró en un recienteinforme de SaghaiMaroof et al. (2008).Nuestro análisis, realizado mediante lacombinación de estudios de herencia y elanálisis de marcador molecular,determinado el tipo y el número de genesde resistencia SMV en varias variedades desoya. Este conocimiento debe servir debase para futuras gene SMV piramidal, loque permite a los criadores de elegir eldonante de genes más adecuadoslospadres para sus cruces.Agradecimientos: Este trabajo fue apoyadopor una subvención del 21 BioGreenProject (nada de código. 20080401034011)Administración para el Desarrollo Rural, laRepública de Corea. Dr. K. Van es elbeneficiario de una beca del programaBK21 otorgada por el Ministerio de ᴎVillalobos

×