• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Biochip 1
 

Biochip 1

on

  • 4,134 views

 

Statistics

Views

Total Views
4,134
Views on SlideShare
4,134
Embed Views
0

Actions

Likes
2
Downloads
311
Comments
1

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel

11 of 1 previous next

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
  • thanks
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Biochip 1 Biochip 1 Presentation Transcript

    • Biochip Biosensor or bioprocessor that utilizes technologies of modern Biology and Electronics in a micro scale.
    • Types of Biochip DNA chip Protein chip Enzyme chip Lab-on-a-chip Biomolecular machine Biocomputer
    • Physical methods are the keys for many biological problems
      • DNA sequencing
      • Protein structure
      • Spectrophotometry
      • Mass Spect
      • Electron microscope
      • Confocal
    •  
    • Bio-physical methods
      • DNA sequencing
      • Protein structure
      • Spectrophotometry
      • Mass Spect
      • Electron microscope
      • Confocal
    •  
    • Structure Determination
    • An ideal biochip Size-portable Save energy-long term usage Low cost-mass production High sensitivity-integration Low sample requirement Microarray-high thru put Decreased invasiveness
    • ASI Atomic Scale Integration LSI Large Scale Integration GSI Giga Scale Integration MSI Medium Scale Integration Time evolution in computer technology from zero to atomic scale integration (Ciabrera et al., 1991; Nicolini, 1993). ULSI Ultra Large Scale Integration SSI Small Scale Integration VLSI Very Large Scale Integration ZSI Zero Scale Integration
    •  
    • Features and factors of size reduction in microchip-based analysis TIBTECH DECEMBER 1999 (VOL 17)
    • The size matter
    •  
    • Biomolecular Machine
      • Microtubules and Their Motors
      • Skeletal Muscle Myosin and muscle contraction
      • A Proton Gradient Drives the rotation of Bacterial Flagella
    •  
    •  
    • DNA as Molecular Machine Construction and operation of the molecular tweezers. A DNA-fuelled molecular machinemade of DNA Bernard Yurk e *, Andrew J. Turber®el d* ², Allen P. Mills J r *, Friedrich C. Simme l* & Jennifer L. Neuman n* NATURE | VOL 406 | 10 AUGUST 2000 Name Sequence Domain 1 Domain 2 A 5’ TGCCTTGTAAGAGCGACCAT CAACCTGGAATGCTTCGGAT 3’ B 5’ GGTCGCTCTTACAAGGCA CTGGTAACAATCACGGTCTATGCG 3’ C 5’ GGAGTCCTACTGTCTGAACTAACG ATCCGAAGCATTCCAGGT 3’ F 5’ CGCATAGACCGTGATTGTTACCAG CGTTAGTTCAGACAGTAGGACTCC TGCTACGA 3’  5’ GGTCGCTCTTACAAGGCA CAGCTAGTTTCACAGTGGCAAGTC 3’  5’ GCAGGCTTCTACATATCTGACGAG ATCCGAAGCATTCCAGGT 3’ F  5’ CGCATAGACCGTGATTGTTACCAG CTCGTCAGATATGTAGAAGCCTGC ACGTCGAT 3’ F  5’ GACTTGCCACTGTGAAACTAGCTG CGTTAGTTCAGACAGTAGGACTCC TGTCCAGA 3’
    •  
    • Biocomputer
      • Memory -The design of a biochip: a self-assembling molecular-scale memory, Protein Engineering, 1, 295 (1987)
      • Switching devise -Biochemical switching devise: biomimetic approach and application to neural network study, J. of Biotech, 109, 109 (1992)
      • Logic gate -A biochemical logic gate using an enzyme and its inhibitor, Biotech Progress (1999)
      • Wire -Femtosecond direct observation of charge transfer between bases in DNA. Proc Natl Acad Sci USA, 19, 14052 (2000)
    • Applications of DNA chip and microarray technology Pharmacogenomics (2000) 1(3):289-307
    • Companies involved in developing microarray DNA-chip technology for pharmacogenomics (from A to V) Pharmacogenomics (2000) 1(3):289-307
    • Components of a DNA microchip . Pharmacogenomics (2000) 1(3):289-307
    • Types of transducer
      • Electrical-current/voltage (FET, MOS ),
      • charge, dielectricity
      • Optical-absorption, emission, phase change, polarisation/absorption ( SPR ), opto-ethermal
      • Thermal
      • Magnetic-NMR, mass spect
      • Mechanical, frequency-surface acoustic wave, quartz balance
    • Electrochemical Sensors
      • Principle:
      • Anode: semi-oxidation reaction
      • Cathode: semi-reduction reaction
      • Example: Biofuel cell
    • Biofuel Cell (J.A.C.S. 2001, 123, 8630)
    • Electronic Nose (Biosen. & Bioele. 14, 1999 9-18)
    • Surface Plasma Resonance (SPR)
    •  
    • Nanowire FET (Sience 293, 17, August, 2001)
    • Semiconductor Devices as Sensors of Biological Reactions Mass Electron Heat Charge Light Modified Electrode Thermometer EnzymeFET Photodiodes SAW Enzymatic Reaction