0
Biochip Biosensor or bioprocessor that utilizes  technologies of modern Biology and  Electronics in a micro scale.
Types of Biochip DNA chip Protein chip Enzyme chip Lab-on-a-chip Biomolecular machine Biocomputer
Physical methods are the keys for many biological problems <ul><li>DNA sequencing </li></ul><ul><li>Protein structure </li...
 
Bio-physical methods <ul><li>DNA sequencing </li></ul><ul><li>Protein structure </li></ul><ul><li>Spectrophotometry </li><...
 
Structure Determination
An ideal biochip Size-portable Save energy-long term usage Low cost-mass production High sensitivity-integration Low sampl...
ASI Atomic Scale Integration LSI Large Scale Integration GSI Giga Scale Integration MSI Medium Scale Integration Time evol...
 
Features and factors of size reduction in microchip-based analysis  TIBTECH  DECEMBER 1999 (VOL 17)
The size matter
 
Biomolecular Machine <ul><li>Microtubules and Their Motors </li></ul><ul><li>Skeletal Muscle Myosin and muscle contraction...
 
 
DNA as Molecular Machine   Construction and operation of the molecular tweezers. A DNA-fuelled molecular machinemade of DN...
 
Biocomputer <ul><li>Memory -The design of a biochip: a self-assembling molecular-scale memory,  Protein Engineering, 1, 29...
Applications of DNA chip and microarray technology Pharmacogenomics (2000) 1(3):289-307
Companies involved in developing microarray DNA-chip technology for pharmacogenomics (from A to V)  Pharmacogenomics (2000...
Components of a DNA microchip . Pharmacogenomics (2000) 1(3):289-307
Types of transducer <ul><li>Electrical-current/voltage  (FET, MOS ), </li></ul><ul><li>charge, dielectricity </li></ul><ul...
Electrochemical Sensors <ul><li>Principle:  </li></ul><ul><li>Anode: semi-oxidation reaction </li></ul><ul><li>Cathode: se...
Biofuel Cell   (J.A.C.S. 2001, 123, 8630)
Electronic Nose (Biosen. & Bioele. 14, 1999 9-18)
Surface Plasma Resonance (SPR)
 
Nanowire FET  (Sience 293, 17, August, 2001)
Semiconductor Devices as Sensors of Biological Reactions Mass Electron Heat Charge Light Modified Electrode Thermometer En...
Upcoming SlideShare
Loading in...5
×

Biochip 1

3,475

Published on

Published in: Technology
1 Comment
2 Likes
Statistics
Notes
No Downloads
Views
Total Views
3,475
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
342
Comments
1
Likes
2
Embeds 0
No embeds

No notes for slide

Transcript of "Biochip 1"

  1. 1. Biochip Biosensor or bioprocessor that utilizes technologies of modern Biology and Electronics in a micro scale.
  2. 2. Types of Biochip DNA chip Protein chip Enzyme chip Lab-on-a-chip Biomolecular machine Biocomputer
  3. 3. Physical methods are the keys for many biological problems <ul><li>DNA sequencing </li></ul><ul><li>Protein structure </li></ul><ul><li>Spectrophotometry </li></ul><ul><li>Mass Spect </li></ul><ul><li>Electron microscope </li></ul><ul><li>Confocal </li></ul>
  4. 5. Bio-physical methods <ul><li>DNA sequencing </li></ul><ul><li>Protein structure </li></ul><ul><li>Spectrophotometry </li></ul><ul><li>Mass Spect </li></ul><ul><li>Electron microscope </li></ul><ul><li>Confocal </li></ul>
  5. 7. Structure Determination
  6. 8. An ideal biochip Size-portable Save energy-long term usage Low cost-mass production High sensitivity-integration Low sample requirement Microarray-high thru put Decreased invasiveness
  7. 9. ASI Atomic Scale Integration LSI Large Scale Integration GSI Giga Scale Integration MSI Medium Scale Integration Time evolution in computer technology from zero to atomic scale integration (Ciabrera et al., 1991; Nicolini, 1993). ULSI Ultra Large Scale Integration SSI Small Scale Integration VLSI Very Large Scale Integration ZSI Zero Scale Integration
  8. 11. Features and factors of size reduction in microchip-based analysis TIBTECH DECEMBER 1999 (VOL 17)
  9. 12. The size matter
  10. 14. Biomolecular Machine <ul><li>Microtubules and Their Motors </li></ul><ul><li>Skeletal Muscle Myosin and muscle contraction </li></ul><ul><li>A Proton Gradient Drives the rotation of Bacterial Flagella </li></ul>
  11. 17. DNA as Molecular Machine Construction and operation of the molecular tweezers. A DNA-fuelled molecular machinemade of DNA Bernard Yurk e *, Andrew J. Turber®el d* ², Allen P. Mills J r *, Friedrich C. Simme l* & Jennifer L. Neuman n* NATURE | VOL 406 | 10 AUGUST 2000 Name Sequence Domain 1 Domain 2 A 5’ TGCCTTGTAAGAGCGACCAT CAACCTGGAATGCTTCGGAT 3’ B 5’ GGTCGCTCTTACAAGGCA CTGGTAACAATCACGGTCTATGCG 3’ C 5’ GGAGTCCTACTGTCTGAACTAACG ATCCGAAGCATTCCAGGT 3’ F 5’ CGCATAGACCGTGATTGTTACCAG CGTTAGTTCAGACAGTAGGACTCC TGCTACGA 3’  5’ GGTCGCTCTTACAAGGCA CAGCTAGTTTCACAGTGGCAAGTC 3’  5’ GCAGGCTTCTACATATCTGACGAG ATCCGAAGCATTCCAGGT 3’ F  5’ CGCATAGACCGTGATTGTTACCAG CTCGTCAGATATGTAGAAGCCTGC ACGTCGAT 3’ F  5’ GACTTGCCACTGTGAAACTAGCTG CGTTAGTTCAGACAGTAGGACTCC TGTCCAGA 3’
  12. 19. Biocomputer <ul><li>Memory -The design of a biochip: a self-assembling molecular-scale memory, Protein Engineering, 1, 295 (1987) </li></ul><ul><li>Switching devise -Biochemical switching devise: biomimetic approach and application to neural network study, J. of Biotech, 109, 109 (1992) </li></ul><ul><li>Logic gate -A biochemical logic gate using an enzyme and its inhibitor, Biotech Progress (1999) </li></ul><ul><li>Wire -Femtosecond direct observation of charge transfer between bases in DNA. Proc Natl Acad Sci USA, 19, 14052 (2000) </li></ul>
  13. 20. Applications of DNA chip and microarray technology Pharmacogenomics (2000) 1(3):289-307
  14. 21. Companies involved in developing microarray DNA-chip technology for pharmacogenomics (from A to V) Pharmacogenomics (2000) 1(3):289-307
  15. 22. Components of a DNA microchip . Pharmacogenomics (2000) 1(3):289-307
  16. 23. Types of transducer <ul><li>Electrical-current/voltage (FET, MOS ), </li></ul><ul><li>charge, dielectricity </li></ul><ul><li>Optical-absorption, emission, phase change, polarisation/absorption ( SPR ), opto-ethermal </li></ul><ul><li>Thermal </li></ul><ul><li>Magnetic-NMR, mass spect </li></ul><ul><li>Mechanical, frequency-surface acoustic wave, quartz balance </li></ul>
  17. 24. Electrochemical Sensors <ul><li>Principle: </li></ul><ul><li>Anode: semi-oxidation reaction </li></ul><ul><li>Cathode: semi-reduction reaction </li></ul><ul><li>Example: Biofuel cell </li></ul>
  18. 25. Biofuel Cell (J.A.C.S. 2001, 123, 8630)
  19. 26. Electronic Nose (Biosen. & Bioele. 14, 1999 9-18)
  20. 27. Surface Plasma Resonance (SPR)
  21. 29. Nanowire FET (Sience 293, 17, August, 2001)
  22. 30. Semiconductor Devices as Sensors of Biological Reactions Mass Electron Heat Charge Light Modified Electrode Thermometer EnzymeFET Photodiodes SAW Enzymatic Reaction
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×