Replicación, transcripción y traducción del adn
Upcoming SlideShare
Loading in...5
×

Like this? Share it with your network

Share
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
  • tiene errores garrafales aunque sea bonito. No todo lo lindo es exacto, esta presentación cría burros
    Are you sure you want to
    Your message goes here
  • @camilla65
    Are you sure you want to
    Your message goes here
  • q' buena la presentación
    Are you sure you want to
    Your message goes here
No Downloads

Views

Total Views
64,928
On Slideshare
64,906
From Embeds
22
Number of Embeds
4

Actions

Shares
Downloads
880
Comments
3
Likes
11

Embeds 22

http://isfd129.bue.infd.edu.ar 17
http://www.slideshare.net 3
http://itesm.blackboard.com 1
http://www.edmodo.com 1

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Replicación, Transcripción y traducción del ADN
  • 2. El ADN… ¿ácido desoxiqué?
    Para comenzar, el ADN es un polímero conformado por monómeros llamados nucleótidos, y éstos a su vez están conformados por:
    Un grupo fosfato (H3PO4-2)
    Un azúcar (desoxirribosa C5H10O4)
    Y una base nitrogenada: Adenina (A), Guanina (G), Timina (T) o Citosina (C).
    Respecto a éstas últimas, la A y la G son de tipo purinas, y la G y la T son de tipo pirimidina. Entre nucleótidos se forman enlaces entre:
    Las bases nitrogenadas, A-T (doble) y C-G (triple) por puentes de H.
    Grupos fosfatos y azúcares (enlaces glucosídicos).
    También, cabe destacar que posee dos hebras antiparalelas, es de tipo helicoidal, y dextrógira (enrollada hacia la derecha).
  • 3.
  • 4. Código genético
    El código genético es la secuencia de nucleótidos que determina a un gen, y éste a una síntesis de aminoácidos (mín 10) para formar una proteína funcional (transporte, estructural, hormonal, catalítica, etc).
    ArchibaldGarrod y William Bateson: En base a una investigación acerca de la alcaptonuria, concluyen que «la alteración de un gen heredable provoca la alteración de una ruta metabólica».
    Marshall W. Nirenberg y J. Heinrich Matthael: Experimentan para saber la secuencia que codifica para cada uno de los 20 aminoácidos existentes. Intentaron de a 2 (ej: AA, AT, AC…) pero solo
    codificarían para 16 aá, asique probaron ahora con 3 o tripletes, les daban 64 combinaciones. Se
    construyó un ADNmsólo con G, en un
    sistema de síntesis proteica in vitro, y
    obtuvieron solo polipéptidos con el
    aminoácido glicina en su estructura, y
    con este tipo de experimento descifraron
    los códigos para «fabricar» proteínas.
    Secuencias no codificantes: Intrones
    secuencias codificantes: Exones (2%)
  • 5. Organizado en tripletes o codones: 3 nucleótidos codifican para un aminoácido.
    Es degenerado: hay mas codones que aminoácidos, de igual manera varios codones codifican para un mismo aminoácido.
    No es solapado: U nucleótido solo pertenece a un codón, no a dos.
    Lectura sin «comas»: La lectura de los codones es continuo y sin espacios en blanco.
    Universal: para todas* las especies los codones codifican para los mismo aminoácidos.
    *excepto el ADN mitocondrial
    Características del código genético
  • 6. A diferencia de los procariontes que en ellos:
    -sólo existe un tipo de ARN polimerasa,
    -la transcripción se realiza en el citoplasma y su lugar de acción también es en éste,
    -su cadenano posee una caperuza que señale el inicio
    -sin una cola poli A polimerasa que señale el final.
    -Tampoco posee intrones en la cadena de ADN, (no posee una etapa de maduración)
  • 7. INICIACIÓN
    • La ARN polimerasa II localiza el sitio promotor (TTCAGA o TATA)
    • 8. Marca el inicio uniéndose al ADN Complejo cerrado
    • 9. Al cambiar de forma, abre la doble hélice Complejo abierto
    • 10. Se forma la burbuja de transcripción de 18 nucleótidos.
    • 11. Se sintetiza a partir del número 10
    MADURACIÓN
    • Se eliminan los intrones, por las RNPpn(ribonucleoproteínas)
    • 12. Las RNPpn y las ARN ligasas ensamblan los exones (splicing)
    TERMINACIÓN
    ELONGACIÓN
    • La ARN po II llega la secuencia de terminación (UAG)
    • 13. Se le añade al extremo 3’ una cola poli A polimerasa
    • 14. El ARN po II se mueve hacia el extremo 5’, donde se le añade una caperuza.
    • 15. Se sintetiza una cadena de ARNm en dirección 5’-3’
  • 16.
  • 17. TRADUCCIÓN
    INICIACIÓN
    • Subunidad liviana se une al ARNm
    • 18. 1º ARNtcon metionina se acopla
    • 19. La subunidad pesada se ubica en su lugar
    • 20. El ARNt metionina se ubica en el sitio P (sitio A vacante)
    • 21. ELONGACIÓN
    • 22. Entrada de un 2º ARNt con un aá
    • 23. se coloca en el sitio aminoacídico (A)
    • 24. su anticodón se acopla con el codón del ARNm
    • 25. Enlace peptídico entre aminoácidos
    • 26. Se rompe el enlace entre el 1º ARNtcon su aá
    • 27. El ribosoma se mueve a lo largo de la cadena de ARNm
    • 28. El 2º ARNtse coloca en el sitio P
    • 29. Se repiten los pasos
    • 30. TERMINACIÓN
    • 31. El ribosoma encuentra el codón de terminación
    • 32. El polipéptido se desprende del último ARNt.
    • 33. El ARNt se desprende del sitio P
    • 34. Finalmente, el sitio A lo ocupa un factor de liberación que separa a las subunidades
  • 35.
  • 36. REPLICACION
  • 37.
  • 38. Preguntas~~
    1.- ¿Qué proteína es la encargada de romper los puentes de hidrógeno que unen las dos hebras del ADN?
    Topoisomerasa
    Primasa
    ADN polimerasa
    ARN polimerasa
    Helicasa
  • 39. 2.- La replicación del ADN se define como semiconservativa, lo que significa que:
    Cuando se duplica el ADN, las hebras contienen sólo ADN nuevo
    Cuando el ADN se replica, el resultado es una mezcla desigual de ADN nuevo y original
    Luego de la replicación, cada cadena de ADN contiene la mitad del ADN nuevo y la otra mitad original.
    Cada cadena de ADN conserva completamente la información de la cadena original
    Cada cadena resultante sufre una dispersión con respecto a la cadena original
  • 40. 3.- ¿cuál/es de éstas opciones es/son propia/s de las hebras?
    Tienen una disposición antipararela
    Se unen por puentes de hidrógeno entre las bases nitrogenadas
    Se unen en forma exacta y complementaria
    Sólo I
    Sólo II
    Sólo III
    Sólo I y II
    I, II y III
  • 41. 4.- ¿qué condiciones se deben cumplir para que ocurra replicación de ADN?
    Nucleótidos libres
    Cebadores sobre los moldes de ADN
    Presencia de horquilla de replicación
    Sólo I
    Sólo II
    Sólo I y II
    Sólo I y III
    I, II y III
  • 42. 5.- ¿En cuál de las siguientes situaciones se debe aplicar una mayor cantidad de energía para separar las hebras del ADN?
    75% pares de bases AT y 25% pares de bases GC
    50% pares de bases AT y 50% pares de bases GC
    25% pares de bases AT y 75% pares de bases GC
    80% pares de bases AT y 20% pares de bases GC
    60% pares de bases AT y 40% pares de bases GC
  • 43. 6.- ¿qué pareja/s de conceptos está/n incorrectamente combinada/s?
    pares de bases complementarias = Adenina y Citosina
    Bases = Adenina, Timina, Citosina y Guanina
    Cromosoma eucariótico = ADN y proteínas
    Sólo I
    Sólo II
    Sólo III
    Sólo I y II
    Sólo II y III
  • 44. 7.- los tripletes presentes en el código genético son equivalentes a:
    ARNm
    Codones
    Antidocones
    Sólo I
    Sólo II
    Sólo III
    Sólo I y II
    Sólo I y III
  • 45. 8.- El proceso de replicación semiconservativa se refiere a que:
    Cada nueva molécula de ADN contiene dos nuevas cadenas individuales de ADN
    Las enzimas encargadas de la síntesis de ADN utilizan nucleótidos libres para realizarla
    Algunas bases nitrogenadas se aparean con bases nitrogenadas específicas
    cada una de las hebras de la cadena de ADN sirve de molde para formar una cadena nueva
    Se producen errores durante la replicación de ADN
  • 46. 9.- se logro determinar el gen que codifica para una hormona hipotalámica, tal como se muestra a continuación:GEN : ATTCGGGGACCCCACCTCCAAACACGGCAA
    Al respecto, es correcto afirmar:
    La hormona está conformada por 10 aminoácidos
    El ARNm está formado por lo menos por 10 codones
    El ARNm tiene la misma secuencia, pero reemplazando T por U
    Sólo I
    Sólo II
    Sólo III
    Sólo I y II
    I, II y III