Biol3400 labmanual
Upcoming SlideShare
Loading in...5
×
 

Biol3400 labmanual

on

  • 3,079 views

 

Statistics

Views

Total Views
3,079
Views on SlideShare
3,079
Embed Views
0

Actions

Likes
0
Downloads
3
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Biol3400 labmanual Biol3400 labmanual Document Transcript

  • The University of Lethbridge BIOLOGY 3400Principles of Microbiology LABORATORY MANUAL Spring, 2012 Written by: L. A. Pacarynuk and H.C. Danyk Revised: December, 2011
  • TABLE  OF  CONTENTS    Exercise:                     Page    Biology  3400  Laboratory  Schedule.............................................................................................................2  Grade  Distribution.....................................................................................................................................3  Occupational  Health  and  Safety  Guidelines...............................................................................................5  Guidelines  for  Safety  Procedures...............................................................................................................6  Exercise  1  –  Introduction  to  Microscopy....................................................................................................9  Exercise  2  –  General  Laboratory  Principles  and  Biosafety.......................................................................13  Exercise  3  –  Free-­‐Living  Nitrogen  Fixation...............................................................................................14  Exercise  4  –  Winogradsky  Column  ..........................................................................................................21  Exercise  5  -­‐  Bacterial  and  Yeast  Morphology...........................................................................................23  Exercise  6  –  Bacterial  Reproduction.........................................................................................................28  Exercise  7  –  Ames  Test.............................................................................................................................31  Exercise  8  –  Biochemical  Tests.................................................................................................................34  Exercise  9  –  Yeast  Fermentation..............................................................................................................39  Exercise  10  -­‐  Virology...............................................................................................................................43  Appendix  1  –  The  Compound  Light  Microscope......................................................................................49  Appendix  2  –  Preparation  of  Scientific  Drawings.....................................................................................52  Appendix  3  –  Aseptic  Technique..............................................................................................................54  Appendix  4  –  The  Cultivation  of  Bacteria.................................................................................................59  Appendix  5  –  Bacterial  Observation.........................................................................................................64  Appendix  6  –  Laboratory  Reports...........................................................................................................  65  Appendix  7  –  Use  of  the  Spectrophotometer..........................................................................................67  Appendix  8  –  Media,  Reagents,  pH  Indicators.........................................................................................69  Appendix  9  –  Care  and  Feeding  of  the  Microscopes................................................................................76     1  
  • BIOLOGY  3400  LAB  SCHEDULE   SPRING,  2012  Jan.  10     No  lab  Jan.  12     No  lab    Jan.  17     Introduction,  Microscopy  Jan.  19       General  Lab  Procedures,  Biosafety    Jan.  24     General  Lab  Procedures,  Biosafety  –  Complete;  N-­‐Fixation    Jan.  26     Winogradsky  Column      Jan.  31     Bacterial  Morphology;  N-­‐fixation  Feb.  2   Bacterial  Morphology    Feb.  7   Bacterial  Morphology;  N-­‐fixation      Feb.  9     Bacterial  Morphology      Feb.  14   Bacterial  Growth    Feb.  16     Bacterial  Morphology  –  Complete;  N-­‐fixation:  Polymerase  Chain  Reaction    Feb.  21   Reading  Week    Feb.  23     Reading  Week    Feb.  28     Ames  Test  Mar.  1   Ames  Test  –  Complete;  N-­‐fixation:  Agarose  Gel  Electrophoresis    Mar.  6     Biochemical  Tests  -­‐  Selective  and  Differential  Media,  IMViC  Tests  Mar.  8     Selective  and  Differential  Media,  IMViC  tests  –  Complete    Mar.  13     Yeast  Fermentation  Mar.  15     Winogradsky  Column      Mar.  20   Virology  (phage  isolation)    Mar.  22     Virology  (phage  elution)    Mar.  27     Virology  (amplification)  Mar.  29   Virology  (titre/host  range)    Apr.  3     Virology  -­‐  Complete  Apr.  5     no  lab    Apr.  10     Lab  report  due     2  
  • Laboratory  Grade  Distribution:  The  laboratory  component  of  Biology  3400  is  worth  50%  of  your  course  mark.    It  is  distributed  as  follows:    • Skills  Tests             10%  • Assignments             20%  • Lab  Books             10%  (to  be  handed  in  three  times)    • Lab  Report             10%   th                On  Yeast  Fermentation;  due  Tuesday  April  10  at  the  beginning  of  lab  Performance:      Up  to  10%  of  laboratory  grade  (5  marks  out  of  50)  will  be  subtracted  for  poor  laboratory  performance.    This  includes  (but  is  not  limited  to)  failure  to  be  prepared  for  the  laboratory,  missing  lab  notebook  or  lab  manual,  poor  time  management  skills,  improper  handling  and  care  of  equipment  such  as  microscopes  and  micropipettors,  and  unsafe  practices  such  as  not  tying  hair  back,  chewing  gum,  applying  lipstick,  eating,  drinking,  or  chewing  on  pencils,  and  sloppy  technique  leading  to  poor  results.    As  we  are  working  with  potential  pathogens,  students  displaying  improper  or  careless  techniques  will  be  asked  to  leave  the  lab  and  will  have  at  least  5%  of  their  laboratory  grade  deducted  immediately.    Missing  a  lab  for  which  there  is  a  skills  test  or  assignment  requires  documentation.    Upon  presentation  of  this  documentation,  you  will  either  have  to  complete  the  assignment  or  skills  test  as  soon  as  possible  or,  if  this  is  not  possible,  your  lab  grade  will  be  recalculated.        The  lab  books  will  be  collected  and  graded  three  times  during  the  semester.    Although  most  exercises  are  completed  as  groups,  the  lab  books  are  to  be  completed  individually,  and  must  represent  individual  effort.      The  following  page  provides  you  with  tips  on  how  to  construct  your  books.    Unannounced  skills  tests  will  be  given  during  the  semester.    Students  are  expected  to  work  independently  on  some  technical  aspect  of  microbiology  and  will  be  graded  based  on  their  techniques  and  their  results.    As  proficiency  in  microbiological  techniques  is  considered  an  essential  component  of  the  course,  students  are  only  permitted  three  lab  period  absences  (you  do  not  require  any  documentation).      Missing  more  than  three  labs  will  result  in  a  grade  of  0  being  assigned  for  the  lab  (at  this  point,  it  is  recommended  that  students  consult  with  Arts  and  Science  Advising  for  the  option  of  completing  the  laboratory  the  following  year).    Students  are  still  responsible  for  the  material  missed  (and  their  assignments,  lab  reports  etc.  will  be  graded  as  such).    There  are  no  make-­‐up  laboratories.      Late  Assignments  will  be  penalized  as  follows:    For  Assignments  and  the  Lab  Report:    after  the  start  of  lab,  but  by  4:30  pm  on  the  due  date  –25%;  by  9:00  am  the  next  morning  -­‐50%,  and  after  9:00  am  the  following  day,  no  marks  will  be  given.        Extensions  for  the  lab  report  and  Assignments  will  only  be  granted  for  situations  involving  prolonged  illness  (documentation  is  required).         3  
  • Preparation  of  a  Lab  Book:  Your  lab  book  provides  you  with  a  detailed  record  of  your  experiments  performed.    This  record  proves  invaluable  when  preparing  manuscripts  for  publication,  or,  more  immediately,  when  preparing  lab  reports.    This  lab  book,  as  with  all  of  the  reports  and  assignments  is  an  individual  effort.    Choice  of  Lab  Book  Standard  black  lab  books  can  be  purchased  from  the  book  store  but  these  are  not  required  for  this  course.  The  only  required  features  are:   • Pages  are  non-­‐removable  (no  spiral  bindings)   • All  pages  must  be  numbered  in  the  top  outer  corner   • page  numbers  may  be  hand-­‐written  on  EVERY  page  in  INK  In  General   • all  entries  must  be  made  in  blue  or  black  ink  (except  drawings)   • date  EVERY  entry   • never  remove  a  page  or  use  white-­‐out   • if  an  entry  needs  to  be  deleted,  strike  out  the  entry  with  a  single  straight  line  (the   deleted  entry  must  be  readable)   • keep  up  to  date,  a  lab  book  is  meant  to  be  filled  out  as  the  experiments  are  carried  out  and  NOT   after  the  fact   • record  anything  that  may  be  useful  to  you  when  preparing  your  lab  reports   • leave  plenty  of  space  throughout  the  lab  book  to  add  comments  after  the  fact  Table  of  Contents  Designate  the  first  2  pages  as  the  Table  of  Contents   • record  information  and  pages  numbers  as  you  go  Lab  Entries  For  each  lab  be  sure  to  include  the  following;   1. Objective   2. Method  Summary   • do  not  rewrite  the  protocol  from  the  lab  manual   • highlight  any  specific  changes  to  the  lab  protocol   • include  times  and  dates  for  when  work  was  performed   • record  product  names  and  manufacturers  used       -­‐  enzymes,  chemicals,  equipment  (micropipettors,  baths)   • include  incubation  conditions  for  cultures  and  reaction   3. Observations  &  Results   • record  any  &  all  observations,  this  goes  beyond  number  results   • include  diagrams  and  any  other  form  of  raw  data   • include  calculations  as  appropriate   4. Conclusions   • did  you  achieve  your  objective?  Why  or  why  not?   • use  your  results  to  support  your  conclusions   5. Answer  the  thought  questions  at  the  end  of  the  lab  (as  applicable)   • use  reference  citations  as  needed   • these  may  be  graded   4  
  •   THE  UNIVERSITY  OF  LETHBRIDGE   Policies  and  Procedures   Occupational  Health  and  Safety  Manual      SUBJECT:   CHEMICAL  SPILLS  PROCEDURE    Precaution  should  be  taken  when  approaching  any  chemical  spill.     1. UNKNOWN  SPILL   a. Clear  the  area   b. Call  Security  at  329-­‐2345   c. Secure  the  area  and  do  not  let  anyone  enter   d. Call  Utilities  at  329-­‐2600  and  request  air  be  turned  on  at  the  spill  site   e. Security  will  respond  and  determine  the  severity  of  the  spill   f. Security  will  immediately  notify  the  spill  team  as  follows:   • Chemical  Release  Officer:  331-­‐5201     • Risk   and   Safety   Services   (OHS   Officers):   329-­‐2350/329-­‐2190   (office)   or   394-­‐ 8716/330-­‐4495  (cellular)   • Risk  and  Safety  Services  (Manager):  382-­‐7176  (office)   • DBS  Environmental  only  if  above  not  available  328-­‐4483  (24  hrs)       2. KNOWN  SPILL   a. Clear  the  area   b. Call  Security  at  329-­‐2345   c. Secure  the  area   d. Call  Utilities  at  329-­‐2600  and  request  air  be  turned  on  at  the  spill  site   e. Security  will  respond  and  determine  the  severity  of  the  spill   f. Security  will  immediately  notify  the  spill  team  as  follows:   • Chemical  Release  Officer:  331-­‐5201     • Risk   and   Safety   Services   (OHS   Officers):   329-­‐2350/329-­‐2190   (office)   or   332-­‐ 2350/394-­‐8716  (cellular)   • Risk  and  Safety  Services  (Manager):  382-­‐7176  (office)   • DBS  Environmental  only  if  above  not  available  328-­‐4483  (24  hrs)       3. NOTIFICATION   a. Risk  and  Safety  Services  will  notify  the  appropriate  departments,  including  notification   of  appropriate  government  agency.   5  
  • GUIDELINES  FOR  SAFETY  PROCEDURES  Students  enrolled  in  laboratories  in  the  Biological  Sciences  should  be  aware  that  there  are  risks  of  personal  injury  through  accidents  (fire,  explosion,  exposure  to  biohazardous  materials,  corrosive  chemicals,  fumes,  cuts,  etc).    The  guidelines  outlined  below  are  designed  to:       a)  minimize  the  risk  of  injury  by  emphasizing  safety  precautions  and             b)  clarify  emergency  procedures  should  an    accident  occur.  EMERGENCY  NUMBERS:  City  Emergency       911  Campus  Emergency     2345  Campus  Security       2603  Student  Health  Centre     2484  (Emergency  -­‐  2483)     THE  LABORATORY  INSTRUCTOR  MUST  BE  NOTIFIED  AS  SOON  AS   POSSIBLE  AFTER  THE  INCIDENT  OCCURS.      EMERGENCY  EQUIPMENT:  Your  lab  instructor  will  indicate  the  location  of  the  following  items  to  you  at  the  beginning  of  the  first  lab  period.     • Closest  emergency  exit   • Closest  emergency  telephone  and  emergency  phone  numbers   • Closest  fire  alarm   • Fire  extinguisher  and  explanation  of  use   • Safety  showers  and  explanation  of  operation   • Eyewash  facilities  and  explanation  of  operation   • First  aid  kit  GENERAL  SAFETY  REGULATIONS:   • Eating  and  drinking  is  prohibited  in  the  laboratory.    Keep  pencils,  fingers  and  other  objects   away  from  your  mouth.    These  measures  are  to  ensure  your  safety  and  prevent  accidental   ingestion  of  chemicals  or  microorganisms.   • Personal  protective  wear  is  mandatory.    Lab  coats,  safety  glasses  and  closed-­‐toed  shoes  must   be  worn  at  all  times  during  lab  exercises  which  involve  potential  for  chemical  or  biological   spills.         • Coats,  knapsacks,  briefcases,  etc.  are  to  be  hung  on  the  hooks  provided,  stowed  in  the   cupboards  beneath  the  countertops,  or  placed  along  a  side  designated  by  your  instructor.     Take  only  the  absolute  essentials  needed  to  complete  the  exercise*  with  you  to  your   laboratory  bench.    (*  e.g.  manual,  pen  or  pencil)   • Mouth  pipetting  is  NOT  permitted;  pipet  pumps  are  provided  and  must  be  used.   • Always  wash  your  hands  prior  to  leaving  the  laboratory.   • Students  are  not  allowed  access  to  the  central  Biology  Stores  area  for  any  reason.    Consult  your   instructor  if  you  require  additional  supplies.   • Report  any  equipment  problems  to  instructor  immediately.    Do  NOT  attempt  to  fix  any  of  the   equipment  that  malfunctions  during  the  course  of  the  lab.   • Use  caution  when  handling  chemical  solutions.    Consult  the  lab  instructor  for  instruction   regarding  the  clean-­‐up  of  corrosive  or  toxic  chemicals.   6  
  • • Contain  and  wipe  up  any  spills  immediately  and  notify  your  lab  instructor  (see  SPILLS  below).     Heed  any  special  instructions  outlined  in  the  lab  manual,  those  given  by  the  instructor  or  those   written  on  reagent  bottles.   • Long  hair  must  be  restrained  to  prevent  it  from  being  caught  in  equipment,  Bunsen  burners,   chemicals,  etc.   • Dispose  of  broken  glass,  microscope  slides,  coverslips  and  pipets  in  the  specially  marked  white   and  blue  boxes.    There  will  be  NO  disposal  of  glassware  in  the  wastepaper  baskets.       • You  are  responsible  for  leaving  your  lab  bench  clean  and  tidy.    Glassware  must  be  thoroughly   rinsed  and  placed  on  paper  toweling  to  dry.    SPILLS:   • Spill  of  SOLUTION/CHEMICAL:  While  wearing  gloves,  wipe  up  the  spill  using  paper  towels  and  a   sponge  as  indicated  by  the  lab  instructor.     • Spill  of  ACID/BASE/TOXIN:  Contact  instructor  immediately.    DO  NOT  TOUCH.     • BACTERIA  SPILLS:  If  necessary,  remove  any  contaminated  clothing.    Prevent  anyone  from  going   near  the  spill.    Cover  the  spill  with  10%  bleach  and  leave  for  10  minutes  before  wiping  up.     Discard  paper  towels  in  biohazard  bag.    Discard  contaminated  broken  glass  in  designated   biohazard  sharps  container.  DISPOSAL:   •   Broken  glass,  microscope  slides,  coverslips  and  Pasteur  pipets  are  placed  in  the  upright  white   ‘broken  glass’  cardboard  boxes.    NO  PAPER,  CHEMICAL,  BIOLOGICAL  OR  BACTERIAL  WASTE   MATERIALS  should  be  placed  in  this  container     •   Petri  plates,  microfuge  tubes,  pipet  tips  should  be  placed  in  the  orange  biohazard  bags.    The   material  in  this  bag  will  be  autoclaved  prior  to  disposal.     •   Bacterial  cultures  in  tubes  or  flasks  should  be  placed  in  marked  trays  for  autoclaving.     •   Liquid  chemicals  should  be  disposed  of  as  indicated  by  the  instructor.    DO  NOT  dispose  of   residual  solution  in  the  regent  bottles.    In  case  of  any  uncertainty  in  disposal  please  consult  the   lab  instructor.     •   Slides  of  bacteria  should  be  placed  in  the  trays  filled  with  10%  bleach  that  are  located  at  the  ends   of  the  laboratory  benches.    HEALTH  CONCERNS:  Students  who  have  allergies,  are  pregnant,  or  who  may  have  other  health  concerns  should  inform  their  lab  instructor  so  that  appropriate  precautions  may  be  taken  where  necessary.     7  
  • This  form  must  be  completed,  signed,  and  submitted  to  the  laboratory   instructor  before  any  laboratory  work  is  begun.           *  *  *  *  *  *  *  *        I  have  read  and  I  understand  the  safety  rules  that  appear  in  this  manual.    I  recognize  that  it  is  my  responsibility  to  observe  them,  and  agree  to  abide  by  them  throughout  this  course.          Name  (please  print)                                  Date                    Signature                          Course:   Biology        3400          Semester:   Spring  2012               8  
  • EXERCISE  1   INTRODUCTION  TO  MICROSCOPY      MICROSCOPY  To  view  microscopic  organisms,  their  magnification  is  essential.    The  microscope  is  the  instrument  used  to  magnify  microscopic  images.    Its  function  and  some  aspects  of  design  are  similar  to  those  of  telescopes  although  the  microscope  is  designed  to  visualize  very  small  close  objects  while  telescopes  magnify  distant  objects.  Please  review  Appendices  1  and  9.    Magnification  is  achieved  by  the  refraction  of  light  travelling  though  lenses,  transparent  devices  with  curved  surfaces.    In  general,  the  degree  of  refraction,  and  hence,  magnification,  is  determined  by  the  degree  of  curvature.    However,  rather  than  using  a  single,  severely-­‐curved  biconvex  lens  such  as  that  of  Leeuwenhoeks  simple  microscopes,  Hooke  determined  that  image  clarity  was  improved  through  the  use  of  a  compound  microscope,  involving  two  (or  more)  separate  lenses.  Operation  of  the  Compound  Microscope    Students  should  be  familiar  with  all  names  and  functions  of  the  components  of  their  compound  light  microscopes  as  demonstrated  in  Appendix  1.    Properties  of  the  Objective  Lenses    1.   Magnification    Magnification  is  a  measure  of  how  big  an  object  looks  to  your  eye.    The  number  of  times  that  an  object  is  magnified  by  the  microscope  is  the  product  of  the  magnification  of  both  the  objective  and  ocular  lenses.    The  magnification  of  the  individual  lenses  is  engraved  on  them.    Your  microscope  is  equipped  with  ocular  lenses  that  magnify  the  specimen  ten  times  (10X),  and  four  objectives  which  magnify  the  specimen  4X,  10X,  40X,  and  100X.  Each  lens  system  magnifies  the  object  being  viewed  the  same  number  of  times  in  each  dimension  as  the  number  engraved  on  the  lens.    When  using  a  10X  objective,  for  instance,  the  specimen  is  magnified  ten  times  in  each  dimension  to  give  a  primary  or  "aerial"  image  inside  the  body  tube  of  the  microscope.    This  image  is  then  magnified  an  additional  ten  times  by  the  ocular  to  give  a  virtual  image  that  is  100  times  larger  than  the  object  being  viewed.    2.   Resolution    Resolution  is  a  measure  of  how  clearly  details  can  be  seen  and  is  distinct  from  magnification.    The  resolving  power  of  a  lens  system  is  its  capacity  for  separating  to  the  eye  two  points  that  are  very  close  together.    It  is  dependent  upon  the  quality  of  the  lens  system  and  the  wavelength  of  light  employed  in  illumination.    The  white  light  (a  combination  of  different  wavelengths  of  visible  light)  used  as  the  light  source  in  the  lab  limits  the  resolving  power  of  the  100X  objective  lens  to  about  0.25  µm.    Objects  smaller  than  0.25  µm  cannot  be  resolved  even  if  magnification  is  increased.    Spherical  aberration  (distortion   9  
  • caused  by  differential  bending  of  light  passing  through  different  thicknesses  of  the  lens  center  versus  the  margin)  results  from  the  air  gap  between  the  specimen  and  the  objective  lens.  This  problem  can  be  eliminated  by  filling  the  air  gap  with  immersion  oil,  formulated  to  have  a  refractive  index  similar  to  the  glass  used  for  cover  slips  and  the  microscopes  objective  lens.    Use  of  immersion  oil  with  a  100X  special  oil  immersion  objective  lens  can  increase  resolution  to  about  0.18  µm.    Resolving  power  can  be  increased  further  to  0.17  µm  if  only  the  shorter  (violet)  wavelengths  of  visible  light  are  used  as  the  light  source.    This  is  the  limit  of  resolution  of  the  light  microscope.        The  resolving  power  of  each  objective  lens  is  described  by  a  number  engraved  on  the  objective  called  the  numerical  aperture.    Numerical  aperture  (NA)  is  calculated  from  physical  properties  of  the  lens  and  the  angles  from  which  light  enters  and  leaves.    Examine  the  three  objective  lenses.    The  NA  of  the  10X  objective  lens  is  0.25.    Which  objective  lens  is  capable  of  the  greatest  resolving  power?    3.   Working  Distance    The  working  distance  is  measured  as  the  distance  between  the  lowest  part  of  the  objective  lens  and  the  top  of  the  coverslip  when  the  microscope  is  focused  on  a  thin  preparation.    This  distance  is  related  to  the  individual  properties  of  each  objective.    4.   Parfocal  Objectives    Most  microscope  objectives  when  firmly  screwed  in  place  are  positioned  so  the  microscope  requires  only  fine  adjustments  for  focusing  when  the  magnification  is  changed.    Objectives  installed  in  this  manner  are  said  to  be  parfocal.    5.   Depth  of  Focus    The  vertical  distance  of  a  specimen  being  viewed  that  remains  in  focus  at  any  one  time  is  called  the  depth  of  focus  or  depth  of  field.    It  is  a  different  value  for  each  of  the  objectives.    As  the  microscope  is  focused  up  and  down  on  a  specimen,  only  a  thin  layer  of  the  specimen  is  in  focus  at  one  time.    To  see  details  in  a  specimen  that  is  thicker  than  the  depth  of  focus  of  a  particular  objective  you  must  continuously  focus  up  and  down.    Observing  Bacteria    Three  fundamental  properties  of  bacteria  are  size,  shape  and  association.    Bacteria  generally  occur  in  three  shapes:    coccus  (round),  bacillus  (rod-­‐shaped),  and  spirillum  (spiral-­‐shaped).    Size  of  bacterial  cells  used  in  these  labs  varies  from  0.5  µm  to  1.0  µm  in  width  and  from  1.0  µm  to  5.0  µm  in  length,  although  there  is  a  range  of  sizes  which  bacteria  demonstrate.    Association  refers  to  the  organization  of  the  numerous  bacterial  cells  within  a  culture.    Cells  may  occur  singly  with   10  
  • cells  separating  after  division;  showing  random  association.    Cells  may  remain  together  after  division  for  some  interval  resulting  in  the  presence  of  pairs  of  cells.  When  cells  remain  together  after  more  than  a  single  division,  clusters  result.    Cell  divisions  in  a  single  plane  result  in  chains  of  cells.    If  the  plane  of  cell  division  of  bacilli  is  longitudinal,  a  palisade  results,  resembling  a  picket  fence.    Both  bacterial  cell  shape  and  association  are  usually  constant  for  bacteria  and  hence,  can  be  used  for  taxonomic  identification.    However,  both  properties  may  be  influenced  by  culture  condition  and  age.    Further,  some  bacteria  are  quite  variable  in  shape  and  association  and  this  may  also  be  diagnostic.    Micrometry    When  studying  bacteria  or  other  microorganisms,  it  is  often  essential  to  evaluate  the  size  of  the  organism.  By  tradition,  the  longest  dimension  (length)  is  generally  stressed,  although  width  is  sometimes  useful  for  identification  or  other  study.        Use  of  an  Ocular  Micrometer  (Figure  1)    An  ocular  micrometer  can  be  used  to  measure  the  size  of  objects  within  the  field  of  view.    Unfortunately,  the  distance  between  the  graduations  of  the  ocular  micrometer  is  an  arbitrary  measurement  that  only  has  meaning  if  the  ocular  micrometer  is  calibrated  for  the  objective  being  used.    1) Place  a  micrometer  slide  on  the  stage  and  focus  the  scale  using  the  40x  objective.  2) Turn  the  eyepiece  until  the  graduations  on  the  ocular  scale  are  parallel  with  those  on  the  micrometer   slide  scale  and  superimpose  the  micrometer  scale.  3) Move  the  micrometer  slide  so  that  the  first  graduation  on  each  scale  coincides.  4) Look  for  another  graduation  on  the  ocular  scale  that  exactly  coincides  with  a  graduation  on  the   micrometer  scale.  5) Count  the  number  of  graduations  on  the  ocular  scale  and  the  number  of  graduations  on  the   micrometer  slide  scale  between  and  including  the  graduations  that  coincide.  6) Calibrate  the  ocular  divisions  for  the  40x  and  the  100x  objective  lenses.    Note  that  immersion  oil  is   not  necessary  for  calibration.        Figure  1.    Calibration  of  an  ocular  micrometer  using  a  stage  micrometer.    The  mark  on  the  stage  micrometer  corresponding  to  0.06  mm  (60  µ m)  is  equal  to  5  ocular  divisions  (o.d.)  on  the  ocular  micrometer.    ∴  1  ocular  division  equals  60  µ m/5  ocular  divisions  or  12  µ m.     11  
  • Once  an  ocular  micrometer  has  been  calibrated,  objects  may  be  measured  in  ocular  divisions  and  this  number  converted  to  µm  using  the  conversion  factor  determined.    Bacterial  size  is  generally  a  highly  heritable  trait.  Consequently,  size  is  a  key  factor  used  in  the  identification  of  bacterial  taxa.  However,  for  some  bacteria,  cell  size  can  be  modified  by  nutritional  factors  such  as  culture  media  composition,  environmental  factors  such  as  temperature,  or  other  factors  such  as  age.    METHODS:    For  each  student:  • Compound  light  microscope  • Various  prepared  slides  of  bacteria.  • Stage  micrometer  • Ocular  micrometer  • Immersion  oil    1) Use  the  diagram  in  Figure  1  to  calibrate  the  40x  and  the  100x  objectives  on  your  compound   microscopes.    Record  these  values  in  your  lab  book  as  you  will  then  use  these  values  when   measuring  cells  and  structures  for  the  rest  of  the  lab.        Note:    Do  NOT  use  immersion  oil  when  calibrating  the  100x  objective.    This  is  the  ONLY  time  during  the  term  that  you  will  not  use  immersion  oil  with  this  objective.    2) Use  the  compound  microscope  to  observe  the  prepared  slides  of  bacteria  using  the  10x  and  40x   objective  lenses.    Observe  the  same  slides  under  the  100x  objective  using  immersion  oil.  3) Diagram  two  of  the  organisms  viewed  following  the  instructions  found  in  Appendix  2. 12  
  • EXERCISE  2   GENERAL  LABORATORY  PROCEDURES  AND  BIOSAFETY  A  primary  feature  of  the  microbiology  laboratory  is  that  living  organisms  are  employed  as  part  of  the  experiment.    Most  of  the  microorganisms  are  harmless;  however,  whether  they  are  non-­‐pathogenic  or  pathogenic,  the  microorganisms  are  treated  with  the  same  respect  to  assure  that  personal  safety  in  the  laboratory  is  maintained.    Careful  attention  to  technique  is  essential  at  all  times.    Care  must  always  be  taken  to  prevent  the  contamination  of  the  environment  from  the  cultures  used  in  the  exercises  and  to  prevent  the  possibility  of  the  people  working  in  the  laboratory  from  becoming  contaminated.    Ensure  that  you  have  read  over  the  guidelines  on  Safety,  and  those  on  Aseptic  technique  (Appendix  3).    As  well,  you  should  be  familiar  with  the  contents  of  the  University  of  Lethbridge  Biosafety  web  site:    www.uleth.ca/artsci/biological-­‐sciences/bio-­‐safety    METHODS  Part  1:  General  Laboratory  Procedures  Work  individually  to  prepare  a  streak  plate  and  a  broth  culture  using  the  E.  coli  cultures  provided.    Refer  to  Appendix  3  as  necessary.    Part  2:  Biosafety  You  will  be  provided  with  the  following:  • Sterile  swabs  • Sterile  water  • Potato  Dextrose  Agar  (PDA)  plates  and  Luria  Bertani  (LB)  plates    Work  in  pairs  to  complete  the  following  exercise:  1) Draw  a  line  on  the  back  of  each  plate  to  divide  the  plates  in  half.    Label  one  half  of  the  plate  with  the  name  of   the  surface  to  be  tested.    Label  the  other  half  of  the  plate  as  “after  disinfection”.  2) Moisten  the  swabs  provided  with  a  small  amount  of  sterile  water.    Brush  the  surface  to  be  tested  with  the   swab,  and  then  use  the  swab  to  inoculate  one-­‐half  of  each  of  your  two  plates.  3) Disinfect  the  surface,  moisten  another  swab,  and  repeat  using  the  other  half  of  both  plates.    Wrap  the  plates   with  parafilm.  4) Your  plates  will  be  incubated  for  16-­‐20  hours  at  30oC,  and  then  refrigerated  at  4oC.    During  the  next   laboratory  period,  evaluate  your  plate  results  and  record  the  number  of  colonies  present  on  each  half  of  both   plates.    Make  observations  of  colony  morphology.    Thought  Questions:    (Use  the  Biosafety  Web  Site  as  a  reference)  • Were  differences  in  colony  morphology  and  number  observed  on  the  two  types  of  media?    Why?  • Does  disinfection  of  work  surfaces  completely  eliminate  all  microbial  organisms?    What  evidence  do  you   have?  • What  is  an  MSDS  and  where  can  you  find  one?  • In  Canada,  the  Laboratory  Centre  for  Disease  Control  has  classified  infectious  agents  into  4  Risk  Groups  using   pathogenicity,  virulence  and  mode  of  transmission  (among  others)  as  criteria.    What  do  these  terms  mean?  • What  criteria  would  characterize  an  organism  classified  in  Risk  Group  1,  2  3  or  4?      • There  are  many  “Golden  Rules”  for  Biosafety.    Identify  4  common  sense  practices  that  will  protect  you  in  your   microbiology  labs. 13  
  • EXERCISE  3   FREE-­LIVING  NITROGEN  FIXATION  PART  A:  ISOLATION  OF  FREE-­‐LIVING  NITROGEN  FIXING  MICROORGANISMS    Nitrogen  is  an  important  component  of  amino  acids,  cell  walls  and  other  cofactors  present  in  all  cells.    Nitrogen  gas  comprises  greater  than  75%  of  our  atmosphere,  but  it  is  one  of  the  most  stable  bonds  in  nature,  and  is  unavailable  for  use  in  this  form.    At  one  time  early  in  the  evolutionary  history  of  life  on  earth,  all  cells  may  have  had  the  ability  to  fix  N2  gas  into  a  more  usable  form  (nitrate,  nitrite  or  ammonia).    Today  however,  only  a  few  species  of  bacteria  and  archaea  are  capable  of  converting  N2;  all  other  organisms  rely  on  N2-­‐fixing  prokaryotes  for  their  fixed  nitrogen  requirements.    M.W.  Beijerinck,  a  Dutch  microbiologist,  successfully  isolated  free  living  nitrogen  fixing  bacteria  in  1901.    He  inoculated  soil  samples  into  enrichment  media  containing  glucose  and  mineral  salts,  but  lacking  any  source  of  nitrogen  other  than  atmospheric  nitrogen.    He  observed  cells  that  are  today  identified  as  members  of  the  genus  Azotobacter.    Subsequently,  other  aerobic,  free-­‐living  nitrogen  fixing  genera  of  bacteria  have  been  isolated  and  identified,  including  Azomonas,  Azospirillum  and  Beijerinckia.        Nitrogen  fixation  occurs  only  when  an  enzyme  called  nitrogenase  is  present.    The  enzyme  consists  of  two  distinct  proteins  (i)  dinitrogenase,  which  reacts  with  N2,  and  (ii)  dinitrogenase  reductase,  which  reduces  nitrogen  gas  to  ammonia.    The  dinitrogenase  reductase  component  is  irreversibly  inactivated  by  the  presence  of  oxygen.  Several  strategies  have  evolved  to  enable  free-­‐living,  aerobic  organisms  like  Azotobacter  to  fix  nitrogen.    Azotobacter  has  a  very  high  respiratory  rate,  which  is  thought  to  prevent  any  stray  oxygen  from  coming  into  contact  with  the  nitrogenase  enzyme.    Additionally,  free-­‐living  nitrogen  fixers  often  secrete  copious  amounts  of  slime  which  may  prevent  extra  oxygen  from  entering  the  cells.        There  is  also  evidence  suggesting  that  in  the  presence  of  oxygen  nitrogenase  can  combine  with  a  specific  protein  inside  the  cell  that  shields  the  oxygen  sensitive  site  and  prevents  it  from  interacting  from  oxygen.    When  oxygen  levels  drop,  nitrogenase  can  resume  its  activity.    Over  the  course  of  the  semester  we  will  isolate  free  living  nitrogen  fixing  bacteria  from  prairie  soil,  establish  pure  cultures  and  attempt  to  identify  cultures  using  modern  day  molecular  techniques.    METHODS:    For  each  lab:   • 5,  250  mL  flasks  containing  N-­‐free  medium;  10  plates  N-­‐free  medium   • Balance,  weigh  boats  and  spatula   • N-­‐free  soil  sample    Work  in  groups  of  4  to  inoculate  your  flasks.   • Weigh  out  1  g  of  the  soil  sample  provided,  and  add  it  to  an  Erlenmeyer  flask  containing  100  mL  of  N-­‐ free  medium.   14  
  • • Swirl  gently  to  mix.    Label  the  flask  with  your  lab,  bench  number,  and  date.    Make  sure  that  the  cap  or   foil  is  loosened  sufficiently  to  allow  air  to  enter  the  culture.   • After  7  days,  remove  the  flask  and  look  for  the  presence  of  a  thin  film  of  growth  on  the  surface  of  the   medium.    Use  a  sterile  inoculating  loop  to  remove  some  of  this  film  and  prepare  a  streak  plate.    The  streak   o plate  will  be  incubated  for  a  further  7  days  at  30 C.       • Examine  wet  mounts  from  your  broth  culture  using  the  phase  contrast  microscope.    Prepare  Gram  stains  of   the  film  and  look  for  large  Gram  negative  cells  that  may  be  bacillus  or  coccoid  in  shape.    They  may  occur   singly,  or  in  arrowhead-­‐shaped  pairs.    Record  observations  in  your  lab  book.       • After  the  incubation  period  is  complete,  examine  your  streak  plate.    Look  for  large,  translucent,   mucoid  colonies.    Prepare  a  wet  mount  from  an  isolated  colony  and  view  it  using  a  phase-­‐contrast   microscope.    Prepare  another  streak  plate  using  cells  from  the  same  colony.    This  plate  will  be   incubated  again,  and  observations  will  be  made  later  in  the  term.    Additionally,  this  culture  will  be   used  in  Part  B  of  this  exercise.    Thought  Questions:   • Define  enrichment.    What  aspect(s)  of  the  medium  used  in  this  exercise  made  it  an  enrichment  medium?     Why  did  we  use  the  same  medium  for  plating  after  free-­‐living  nitrogen  fixers  were  isolated?    What  term   would  we  use  to  describe  the  medium  in  this  case?   • Why  did  we  sample  the  film  on  top  of  the  culture,  rather  than  the  sediment  on  the  bottom  of  the  flask?   • When  you  viewed  your  Gram  stains,  you  may  have  observed  cells  on  your  slides  that  didn’t  appear  to  be   Azotobacter.    Why  might  these  other  genera  be  present?      PART  B:  IDENTIFICATION  OF  MICROORGANISMS  USING  PCR  OF  16s  rDNA  The  DNA  from  microbes  can  be  isolated  and  may  be  studied  via  construction  of  BAC  (Bacterial  Artificial  Chromosome)  libraries  (for  an  example,  see  Rondon,  et  al.,  2000).    More  simply,  an  appreciation  of  diversity  may  be  obtained  by  using  universal  primers  for  PCR  amplification  of  rDNA  genes  from  the  Bacterial  domain  on  a  preparation  of  total  DNA  from  an  environmental  sample.    The  resulting  pool  of  nucleotide  fragments  may  then  be  cloned,  unique  clones  sequenced,  and  the  resulting  sequences  analyzed  in  order  to  characterize  and  potentially  identify  the  microbes  present.    In  Part  B  of  this  exercise  you  will  perform  PCR  using  primers  specific  for  prokaryotic  16s  rDNA  to  isolate  ribosomal  DNA  from  putative  Azotobacter  cultures  and  then  visualise  this  DNA  using  Agarose  Gel  Electrophoresis.    In  addition,  DNA  from  successful  PCRs  will  be  sent  for  sequencing  and  you  will  then  be  using  online  tools  to  perform  sequence  analysis  to  confirm  the  identity  of  your  cultures.    PCR  of  Soil  Bacteria  Two  different  primer  sets  will  be  employed.    Each  group  will  only  be  using  one  set  on  their  particular  culture.    Note  that  the  primer  designations  refer  to  location  of  primer  binding  site  on  the  16s  rDNA  molecule.    Given  this  information,  predict  the  sizes  of  your  PCR  products  for  both  primer  sets.         15  
  • For  preparation  of  your  reaction  mixtures:  Benches  1,  3,  and  5:  Working  with  the  people  at  your  bench,  each  group  will  be  setting  up  3x  reactions  as  outlined  below:    Primer   Template  Source  FP1/1492R   Unknown  Culture  FP1/1492R   E.  coli  FP1/1492R   No  template    Benches  2/4:  Working  with  the  people  at  your  bench,  each  group  will  be  setting  up  3x  reactions  as  outlined  below:    Primer  Set   Template  Source  27F/805R   Unknown  Culture  27F/805R   E.  coli  27F/805R   No  template    METHODS:    Reagents:   • Taq  (Invitrogen)   • 10x  PCR  buffer   • 50  mM  MgCl2  Primers  (*Y  =  C  or  T)   • FP1  (AGAGTTYGATYCTGGCT)*1  (10  pmol/µL)   • RP1492  (TACGGYTACCTTGTTACGACT)*1  (10  pmol/µL)   • 27F  (AGAGTTTGATCCTGGCTCAG)2  (10  pmol/µL)   • 805R  (GACTACCAGGGTATCTAATCC)2  (10  pmol/µL)   • dNTP  mix  (8  mM)   • Optima  Water  (Fisher  Scientific)  Cultures:   • Pure  culture  of  organism  isolated  from  soil   • Plate  culture  of  E.  coli    Equipment:     • Thermocyclers  (BioRad)   • Micropipettors  and  sterile  tips     • Parafilm   • Ice  buckets  and  ice   • Sterile  0.5  mL  tubes   • Sterile  0.2  mL  PCR  tubes   • Biohazard  bags   • Permanent  markers  Note:    Use  aseptic  technique  throughout.    Keep  your  tubes  on  ice  at  all  times!   • Obtain  three  0.2  mL  PCR  tubes  from  the  sterile  container  at  the  side  of  the  lab.    Decide  on  appropriate   16  
  • codes  for  labeling  the  tubes  (keeping  in  mind  that  other  groups  are  carrying  out  the  same  reactions).    Label   the  tubes  on  the  tops  and  on  the  sides  using  permanent  marker.    Place  the  tubes  on  ice.   • Obtain  a  0.5  mL  tube  for  your  Master  Mix.    Keep  this  tube  on  ice.    Use  the  information  outlined  in  Table  1   to  set  up  your  Master  Mix.    This  mix  contains  everything  required  in  order  for  DNA  replication  to  occur.     Generally,  Master  Mixes  contain  enough  volume  to  set  up  the  number  of  reactions  +  1.    In  your  case,  you   will  be  preparing  enough  mix  for  4  reactions.    Work  carefully.        Table  1.    Components,  starting  concentrations  and  volumes  for  set-­‐up  of  PCRs.   Component  and  Starting   Final   Amount  to  add   Master  Mix  vol.  (for   Concentration   Concentration     for  ONE  reaction   total  #  Reactions  +   (µL)   1)  (µL)       Optima-­‐Water     32   128   10x  PCR  buffer   1x   5   20   50  mM  MgCl2   1.5  mM   2   8   dNTP  mix  (8  mM  of  all  4)   40  nmoles  (0.8  mM   5   20   of  all  4)   Primer  1   0.4  µ M   2   8   Primer  2   0.4  µ M   2   8   Taq  DNA  polymerase  (5  U/µL)   5  U    (units)   1   4     Template  DNA     1     Leave  Template  out   of  Master  Mix!   Final  Volume   50  µ L   50  µ L      Note:    One  primer  set  per  reaction  mixture!       • While  the  Master  Mix  is  being  set  up,  other  group  members  should  be  setting  up  template  preparations.     Obtain  a  small  square  of  parafilm.    For  each  bacterial  culture  (soil  bacteria  and  E.  coli  –  what  is  the  role  of  E.   coli?),  use  a  micropipettor  with  a  sterile  tip  to  pipette  20  µ L  of  sterile  Optima-­‐water  (Fisher  Scientific)  onto   the  parafilm.       • Take  a  10  –  100  µL  micropipettor  and  put  on  a  sterile  tip.    Touch  the  tip  to  a  single  colony  from  your  soil   bacterial  culture  plate.    Pipette  up  and  down  into  the  Optima  water  on  the  parafilm.    This  mixture  will  be   used  as  your  template  source.   • Mix  E.  coli  in  the  same  fashion  with  your  second  drop  of  Optima  water  on  the  parafilm.    Again,  1  µL  of  this   mixture  will  be  used  as  template  in  your  second  reaction.   • For  your  third  reaction,  you  will  be  leaving  out  template  and  replacing  it  with  an  equal  volume  of  sterile   Optima  water.    What  is  the  purpose  of  this  reaction?     • After  preparation  of  Master  Mix,  add  the  appropriate  volume  of  template  (1  µL)  to  each  tube,  then  check   with  the  Instructor  to  see  where  everyone  else  is  at.    When  all  of  the  groups  are  at  the  same  stage,  add  the   appropriate  volume  of  Master  Mix  (49  µL  )  to  each  tube.    Keep  your  tubes  on  ice  until  in  the  PCR  machine.      GENTLY  tap  tubes  to  mix.    When  everyone  is  ready,  the  instructor  will  then  show  you  how  to  operate  the  thermocycler.          The  parameters  you  are  using  for  the  PCR  are:   17  
  • o 12  minutes  at  95   C  (used  not  only  in  initial  DNA  denaturation,  but  also  to  lyse  the  bacterial  cells)   30  cycles  of:   o • 1  minute  at  94   C   o • 45  seconds  at  55   C   o • 90  seconds  at  72   C   A  final  elongation  of:   o • 20  minutes  at  72   C     oThe  samples  will  be  stored  at  -­‐20   C  upon  completion.    Thought  Questions:    • What  are  the  purposes  of  the  primers  in  PCR?  • What  happens  at  each  temperature?  • How  is  annealing  temperature  determined?  • What  is  meant  by  stringency?    How  can  you  ensure  high  stringency?  • If  you  left  out  the  forward  primer,  would  you  expect  to  see  a  band  resulting  on  the  gel?    If  you  did,  explain  what   this  would  mean.  • Is  it  possible  to  design  PCRs  given  only  an  isolatable  protein?    Why  or  why  not?    What  are  some  of  the  problems   associated  with  such  an  experiment?    How  might  you  adapt  the  reaction  conditions  to  optimise  yield  of  desired   product?    Suggested  Background  Reading:  Amann  et.  al.,  1995.    Phylogenetic  identification  and  in  situ  detection  of  individual  microbial  cells  without  cultivation.  Microbiol.  Rev.  59  (1):  143-­‐169.    Aas,  J.  A.,  Paster,  B.  J.,  Stokes,  L.  N.,  Olsen,  I.,  and  Dewhirst,  F.  E.  2005.  Defining  the  Normal  Bacterial  Flora  of  the  Oral  Cavity.  J.  Clin.  Microbiol.  43:  5721-­‐5732.  Cole,  J.  R.,  Chai,  B.,  Farris,  R.  J.,  Wang,  Q.,  Kulam,  S.  A.,  McGarrell,  D.  M.,  Bandela,  A.  M.,  Cardenas,  E.,  Garrity,  G.  M.,  and  Tiedje,  J.  M.  2007.  The  ribosomal  database  project  (RDPII):  introducing  myRDP  space  and  quality  controlled  public  data.  Nuc.  A.  Res.  35:  D169-­‐D172.  DeLong  and  Pace,  2001.  Environmental  diversity  of  bacteria  and  archaea.  Syst.  Biol.  50(4):  470-­‐478.  Gabor,  E.  M.,  deVries,  E.  J.,  and  Janssen,  D.  B.  2003.    Efficient  recovery  of  environmental  DNA  for  expression  cloning  by  indirect  extraction  methods.    FEMS.    44(2):  153-­‐163.    Kelley,  S.T.,  Theisen  U.,  Angenent,  L.T.,  Amand,  A.S.,  and  Pace,  N.R.    Molecular  Analysis  of  Shower  Curtain  Biofilm  Microbes.    Appl.  Environ.  Microbiol.    70:  4187-­‐4192.  Pace,  1997.  A  molecular  view  of  microbial  diversity  and  the  biosphere.  Science.  276:  734-­‐740.      Whitford,  M.  F.,  Forster,  R.  J.,  Beard,  C.  E.,  Gong,  J.,  and  Teather,  R.  M.  1998.  Phylogenetic  analysis  of  rumen  bacteria  by  comparative  sequence  analysis  of  cloned  16S  rRNA  genes.    Anaerobe.  4:  153-­‐163.   18  
  • Woese,  C.  R.,  Kandler,  O.,  and  Wheelis,  M.  L.,  1990.  Towards  a  natural  system  of  organisms:  Proposal  for  the  domains  Archaea,  Bacteria,  and  Eucarya.  Proc.  Natl.  Acad.  Sci.  USA.  87:  4576-­‐4579.    Agarose  Gel  Electrophoresis    METHODS  Reagents:  • 1x  TBE  buffer  • 0.8%  agarose  gels  (1  per  2  benches)  • 10x  loading  dye  • 2-­‐log  NEB  ladder  premixed  with  loading  dye  • Ethidium  bromide  bath  • PCR  samples  from  last  lab    Equipment  • Power  supplies  (1  per  2  benches)  • Micropipettors  • Sterile  tips  • Parafilm  • Transilluminator/camera  • Biohazard  bags    • Gloves    Note:    Two  groups  will  load  their  samples  (6  tubes  total)  onto  one  gel.        We  will  be  using  0.8%  agarose  prepared  in  1x  TBE.     • Obtain  and  completely  thaw  your  PCR  samples.       • Using  a  micropipettor,  dot  out  1  µL  aliquots  of  10x  loading  dye  in  a  line  on  a  thin  strip  of  parafilm.  Remove   a  7.5  µL  aliquot  of  your  first  sample,  mix  gently  with  the  loading  dye  on  the  parafilm,  and  proceed  with   loading.    Aim  for  approximately  1-­‐2x  final  concentration  of  loading  dye  per  sample  loaded  (and  recognise   that  this  is  NOT  exact).     Loading  Dye  –  1)  increases  the  density  of  the  sample  ensuring  that  it  drops  evenly  into  the  well;  2)  adds   colour  to  the  sample  to  simplify  loading;  and  3)  contains  dyes  that  in  an  electric  field  move  toward  the   anode  at  predictable  rates.  In  this  laboratory,  we  are  making  use  of  mixtures  containing  xylene  cyanol  FF.     This  dye  migrates  in  0.5x  TBE    at  approximately  the  same  rate  as  linear  DNA  of  4000  bp  in  size.    Often,   bromophenol  blue  is  used  in  conjunction  with  xylene  cyanol,  or  separately.    Bromophenol  blue  migrates  at   approximately  the  same  rate  as  linear  DNA  of  300  bp  in  size  in  0.5x  TBE  (2.2  fold  faster  than  xylene  cyanol   FF,  independent  of  agarose  concentration).         • Load  the  remainder  of  the  samples  in  the  same  manner,  leaving  at  least  one  well  empty  (to  be  used  for  a   DNA  ladder).    Be  sure  to  RECORD  the  order  in  which  the  samples  were  loaded.       • Load  10  µL  of  the  ladder.     One  type  of  size  standard  is  produced  by  ligating  a  monomer  DNA  fragment  of  known  size  into  a  ladder  of   polymeric  forms.    The  2-­‐log  DNA  ladder  from  New  England  Biolabs  consists  of  a  mixture  of  a  number  of   proprietary  plasmids  digested  to  completion  with  different  restriction  enzymes.    Ladders  tend  to  be   19  
  • purchased  as  commercial  preparations.      For  an  example  please  see:   http://www.neb.com/nebecomm/products/productn3200.asp     • Turn  on  the  power  supply  and  set  the  voltage  to  100  V.    Place  the  lid  on  the  gel  and  start  the  run.    The  gel   will  run  for  30  minutes,  then  shut  off  automatically.     • After  the  run  is  complete,  turn  off  the  power.    Designate  one  group  member  to  put  on  gloves,  scoop  up  the   gel,  and  gently  slide  the  gel  into  the  ethidium  bromide  bath.     Caution:    Ethidium  bromide  is  a  mutagen  and  a  suspected  carcinogen.    At  very  dilute  concentrations  and   with  responsible  handling,  this  risk  is  minimised.     • Stain  the  gel  with  gentle  shaking  for  approximately  10  minutes.    One  group  member  again  should  put  on   gloves,  and  transfer  the  gel  to  the  gel  documentation  system.      View  using  the  UV  transilluminator.     Photographs  will  be  taken.    Please  ensure  that  you  bring  a  USB  memory  stick  so  that  you  can  obtain  the   photograph  of  your  gel  (these  will  NOT  be  emailed  out).     Caution:    Ultraviolet  light  is  damaging  to  naked  eyes  and  exposed  skin.    Always  view  through  filter  or   safety  glasses  that  absorb  harmful  wavelengths.     • Based  on  gel  results  and  quantification  of  your  DNA,  a  selection  of  samples  will  be  sent  off  for  sequencing.     In  order  to  facilitate  this,  use  a  piece  of  tape  to  completely  label  your  PCR  products  ensuring  that  the  label   corresponds  with  that  from  the  gel.        Thought  Questions   • What  factors  influence  DNA  migration  through  agarose?    Explain.   • Why  are  we  using  0.8%  agarose  for  resolution  of  our  PCR  products?   • Evaluate  your  gel  results  with  respect  to:    expected  fragment  sizes  and  reasoning,  and  control  results.    Do   we  have  evidence  to  suggest  that  we  were  successful  in  amplifying  16s  rDNA?    Explain  your  reasoning.     • What  are  some  of  the  advantages  and  disadvantages  of  molecular  techniques  for  identification  of  bacteria?     Compare  and  contrast  with  conventional  culturing  techniques.     20  
  • EXERCISE  4   WINOGRADSKY  COLUMNS  All  life  on  earth  can  be  categorized  based  on  what  carbon  and  energy  sources  they  utilize.    Phototrophs  obtain  energy  from  light  reactions,  while  chemotrophs  obtain  energy  from  chemical  oxidations  of  organic  or  inorganic  substances.    The  carbon  used  for  synthesis  can  be  obtained  directly  from  CO2  (autotrophs),  or  from  previously  existing  organic  compounds  (heterotrophs).      Combinations  of  these  categories  give  rise  to  the  four  basic  strategies  of  life:  photoautotrophs  (plants),  chemoheterotrophs  (animals  and  fungi),  photoheterotrophs  and  chemoautotrophs.    The  prokaryotic  bacteria  and  archaea  are  the  only  forms  of  life  where  all  four  life  strategies  can  be  observed.        Winogradsky  columns,  named  for  the  Russian  microbiologist  Sergei  Winogradsky  (1856-­‐1953)  are  model  ecosystems  that  can  be  used  to  study  the  diversity  of  life  strategies  employed  by  bacteria  and  archaea.    Columns  are  prepared  by  filling  glass  tubes  mostly  full  of  mud  supplemented  with  cellulose  (shredded  newspaper),  calcium  carbonate  and  calcium  sulphate.    Initially  there  are  low  numbers  of  organisms  present  in  the  column,  but  after  two  to  three  months  of  incubation,  many  different  types  of  organisms  proliferate  and  occupy  distinct  zones  within  the  column  where  environmental  conditions  favour  their  growth.      After  the  column  is  constructed,  it  is  sealed  and  left  in  the  dark  for  several  days  to  promote  the  growth  of  aerobic  heterotrophs,  which  will  utilize  the  cellulose  in  the  column  and  deplete  the  oxygen.    This  is  the  first  of  a  succession  of  organisms  that  will  inhabit  the  column.    The  column  is  then  placed  in  indirect  light.    Cyanobacteria  and  algae  may  appear  in  the  water  at  the  top  of  the  column,  providing  aerobic  conditions  resulting  from  the  production  of  oxygen  from  photosynthesis.    Large  populations  of  chemoautotrophic  bacteria  may  also  appear  in  this  region  (Thiobacillus,  Beggiatoa).    These  organisms  fix  carbon  dioxide  and  obtain  energy  by  oxidizing  H2S.    Conversely,  if  the  water  at  the  top  of  the  column  contains  only  small  amounts  of  oxygen,  it  may  appear  to  be  red  due  to  the  presence  of  purple  non-­‐sulphur  bacteria  (Rhodobacter,  Rhodospirillum).        The  anaerobic  mud  at  the  bottom  of  the  column  may  be  home  to  species  like  Cellulomonas,  which  degrades  cellulose  to  component  monosaccharides,  and  Clostridium  and  other  species  which  degrade  the  monosaccharides  to  organic  acids  such  as  lactacte  and  acetate.    Lactate,  along  with  the  sulphate  in  the  column,  is  utilized  by  sulphate-­‐reducing  bacteria  (Desulfovibrio),  producing  H2S.    The  H2S  may  react  with  metals  in  the  mud  to  produce  a  black  precipitate.    H2S  also  diffuses  up  through  the  column,  and  may  be  used  by  other  bacterial  populations,  including  the  phototrophic  purple  sulphur  bacteria  (Chromatium)  and  green  sulphur  bacteria  (Chlorobium).        METHODS:  For  each  lab:  • 100  mL  graduated  cylinders  • Mud  samples  • Source  of  cellulose  • CaCO3,  CaSO4,  K2HPO4  • Balance,  weigh  boats  and  spatulas  • Stirring  rods• Aluminium  foil• 250  mL  beakers 21  
  •  Work  in  groups  of  four  to  set  up  your  Winogradsky  columns.     • Prepare  a  thick  slurry  in  the  beaker  using  your  source  of  cellulose.    If  using  cellulose  powder,  weigh   out  1-­‐2  g  of  powder  and  add  to  a  small  amount  of  water.    Add  more  water  as  necessary  to  make  a   thick  slurry  (still  needs  to  be  runny;  a  slurry  is  not  a  paste).    If  using  newspaper,  tear  it  in  small  pieces,   and  macerate  it  in  a  small  volume  of  water.   • Fill  the  graduated  cylinder  to  about  the  30  mL  mark  with  your  cellulose  slurry.   • Add  1.64  g  CaSO4  and  1.3  g  each  of  CaCO3  and  K2HPO4  to  200  g  of  mud  sample.     • Add  some  of  the  water  collected  with  your  mud  (“self”  water)  to  your  mud-­‐chemical  mixture,  and  mix   well.       • Slowly  pour  some  mud  into  the  column,  mixing  it  with  the  cellulose  slurry.    Your  column  will  begin  to   pack.    As  you  pack  the  column,  you  may  need  to  add  more  “self”  water  to  the  mixture.    The  slurry-­‐ mud-­‐water  mixture  should  occupy  about  2/3  of  the  graduated  cylinder  when  you  are  finished.       • Top  off  the  column  with  more  “self”  water  until  it  is  about  90%  full.    Note  the  appearance  of  the   column  in  your  lab  books.    Cover  the  top  with  aluminium  foil,  and  label  with  your  source  of  mud,   group  and  lab  number.    Wrap  the  sides  of  the  column  with  aluminium  foil,  and  apply  another  label  to   the  outside.   • Columns  will  be  incubated  at  room  temperature  for  2  weeks.    Remove  the  aluminium  foil  from  the   sides  of  the  column  and  make  observations  in  your  lab  books.    Place  your  column  near  the  window,   and  continue  to  make  observations  at  regular  intervals  during  the  remainder  of  the  semester.    Look   for  development  of  red,  brown,  purple,  black  or  green  regions  in  the  mud  or  water.   • We  will  occasionally  sample  regions  of  the  Winogradsky  column  and  examine  them  by  phase  contrast   microscopy  to  observe  microorganisms  that  are  proliferating.    Thought  Questions:   • What  is  the  function  of  each  chemical  (including  the  cellulose)  added  to  the  Winogradsky  column?   • What  may  have  happened  if  the  column  was  not  wrapped  in  aluminium  foil  for  the  first  two  weeks?   • Prepare  a  composite  sketch  of  your  column,  and  name  the  groups  of  bacteria  appearing  in  each   region.    Provide  an  explanation  as  to  why  each  group  appears  where  it  does  in  the  column.   • Describe  how  Winogradsky  columns  may  be  used  to  enrich  various  prokaryotes.   • How  is  a  Winogradsky  column  similar  to  a  real  ecosystem?    How  does  it  differ?     22  
  • EXERCISE  5   BACTERIAL  and  YEAST  MORPHOLOGY  Bacteria  cells  are  very  difficult  to  observe  using  compound  light  microscopes  because  the  cells  appear  transparent  in  the  aqueous  medium  in  which  they  are  suspended.        Staining  the  cells  prior  to  observation  increases  the  contrast  between  the  cell  and  the  medium,  which  allows  for  the  visualization  of  cell  structures.    However,  the  application  of  stains  usually  leads  to  cell  death.    Phase  contrast  microscopes  enhance  the  contrast  between  cells  and  their  environment  without  the  use  of  stains,  meaning  that  living  cells  and  their  activities  can  be  observed.    We  will  use  both  approaches  to  study  the  morphology  of  microorganisms  in  this  exercise.        Staining    In  general,  prior  to  any  staining  procedure,  fixation  occurs.    Fixation  performs  two  functions:  (i)  immobilizes  (kills)  the  bacteria;  and  (ii)  affixes  them  to  the  slide.        Any  procedure  that  results  in  the  staining  of  whole  cells  or  cell  parts  is  referred  to  as  positive  staining.    Most  positive  stains  used  involve  basic  dyes  where  basic  means  that  they  owe  their  coloured  properties  to  a  cation  (positively  charged  molecule).    When  all  that  is  required  is  a  general  bacterial  stain  to  show  morphology,  basic  stains  such  as  methylene  blue  or  carbol  fuchsin  result  in  the  staining  of  the  entire  bacterial  cell.    Differential  stains  are  used  to  distinguish  bacteria  based  on  certain  properties  such  as  cell  wall  structure.    Differential  stains  are  useful  for  bacterial  identification,  contributing  to  information  based  on  bacterial  size,  shape,  and  association.    Differential  staining  relies  on  biochemical  or  structural  differences  between  the  groups  that  result  in  different  affinities  by  various  chromophores.    Gram  staining  behaviour  relies  on  differences  in  cell  wall  structure  and  biochemical  composition.    Some  bacteria  when  treated  with  para-­‐rosaniline  dyes  and  iodine  retain  the  stain  when  subsequently  treated  with  a  decolourising  agent  such  as  alcohol  or  acetone.    Other  bacteria  lose  the  stain.    Based  on  this  property,  a  contemporary  of  Pasteur,  Hans  Christian  Gram,  developed  a  rapid  and  extremely  useful  differential  stain,  which  subsequently  bears  his  name  -­‐  the  Gram  stain  used  to  distinguish  two  types  of  bacteria,  Gram  positive  and  Gram  negative.    Gram  negative  forms,  which  are  those  that  lose  the  stain  on  decolourization,  can  be  made  visible  by  using  a  suitable  counterstain.    The  strength  of  the  Gram  stain  rests  on  its  relatively  unambiguous  separation  of  bacterial  types  into  two  groups.    However,  variables  such  as  culture  condition,  age  or  environmental  condition,  can  influence  Gram  staining  of  some  bacteria.    The  bacterial  cell  wall  is  very  important  for  many  aspects  of  bacterial  function  and  hence,  the  Gram  stain  also  provides  valuable  information  about  the  physiological,  medicinal  and  even  ecological  aspects  of  the  bacteria.    Negative  staining  is  used  to  characterize  external  structures,  like  capsules,  that  are  associated  with  living  bacterial  cells.    Negative  stains  make  use  of  acidic  dyes  where  acidic  means  that  they  owe  their  coloured  properties  to  an  anion  (negatively  charged  molecule),  so  they  are  repelled  by  the  negatively  charged  cell  wall.    Hence,  the  cell  is  transparent  and  its  surroundings  are  coloured.      Negative  staining  is  useful  for  determining  cell  dimensions  and  visualizing  capsules,  as  heat  fixation  shrinks  both  cells  and  capsules.     23  
  • Poly-­‐β-­‐hydroxybutyric  Acid  (PHB)  Staining    PHB  granules  are  common  inclusion  bodies  in  bacteria.    Monomers  of  β-­‐hydroxybutyric  acid  are  connected  by  ester  linkages  forming  long  polymers  which  aggregate  into  granules.    As  these  granules  have  an  affinity  for  fat-­‐soluble  dyes  such  as  Sudan  black,  they  can  be  stained  and  then  identified  with  the  light  microscope.    These  granules  are  storage  depots  for  carbon  and  energy.    Endospore  Staining    Certain  bacteria  may  produce  endospores  under  unfavourable  environmental  conditions.    Endospores  are  mainly  found  in  Gram-­‐positive  organisms,  including  the  Gram-­‐positive  Clostridium  and  Bacillus,  in  the  Gram-­‐positive  cocci  Sporosarcina,  and  in  some  of  the  filamentous  Gram-­‐positive  Monosporaceae  family.    It  has  also  been  discovered  that  Coxiella  burnetii,  a  small  rod  found  in  raw  milk  that  has  a  variable  Gram  stain  reaction,  but  a  typical  Gram-­‐negative  cell  wall  has  a  sporogenic  cycle.    When  conditions  become  more  favourable,  the  endospores  will  germinate  and  the  bacteria  will  return  to  the  actively  growing  and  dividing  form.    Endospores  are  highly  resistant  to  heat,  chemical  disinfectants  and  to  desiccation  and  therefore  allow  the  bacterial  endospore  to  survive  much  more  rigorous  conditions  than  the  vegetative  cells.    Endospore  resistance  is  due  to  several  factors,  including:  • A  decrease  in  the  amount  of  water  compared  to  vegetative  cells  • An  increase  in  the  amount  of  dipicolinic  acid  and  calcium  ions  • Enzymes  which  are  more  resistant  to  heat  • A  spore  coat  which  is  impermeable  to  many  substances    Endospores  may  be  formed  in  a  central,  terminal,  or  sub-­‐terminal  position  in  the  cell  and  their  shape  varies  from  ellipsoidal  to  spherical.    The  location  of  the  endospore  in  the  cell  is  usually  characteristic  of  the  species.    For  example,  the  location  and  shape  of  the  Bacillus  subtilis  endospore  is  different  from  the  location  and  shape  of  the  Clostridium  endospore.    Therefore,  the  presence  or  absence  of  endospores  and  the  description  of  the  endospore  is  useful  to  a  microbiologist  as  an  aid  in  identification.    The  resistant  properties  of  endospores  make  them  difficult  to  stain,  hence  heat  is  used  in  conjunction  with  staining  to  enable  the  stain  to  penetrate  into  the  spore  coat.    Phase  Contrast  Microscopy    The  phase  contrast  microscope  was  developed  by  Frits  Zernike,  a  Dutch  mathematical  physicist,  in  1936.    His  discovery,  for  which  he  was  awarded  a  Nobel  Prize  in  1953,  led  to  the  development  of  other  types  of  microscopes  (confocal  and  fluorescence  microscopy).        Phase  contrast  microscopes  are  based  on  the  principle  that  cells  differ  in  refractive  index  from  their  surroundings,  meaning  that  light  that  passes  through  a  cell  differs  in  phase  (the  light  is  slowed  as  it  passes  through  a  cell)  from  light  passing  through  its  surroundings.    The  difference  in  phase  is  subtle,  but  can  be  enhanced,  or  amplified  by  a  device  called  a  phase  ring.    The  result  is  a  dark  image  on  a  light  background.    Phase  contrast  microscopy  is  a  very  powerful  tool  for  observing  living  cells  and  their  activities.       24  
  • METHODS:    For  each  bench:  Stains  • Crystal  violet  • Safranin  • 5%  Malachite  green  • Methylene  blue  • Gram’s  iodine  • Sudan  black    • India  ink  • 95%  ethanol  • Hemo-­‐D  (in  fume  hood)    Equipment  • microbiology  kits  • compound  microscopes  • phase  contrast  microscopes  • slides  • blotting  paper  • corks    Bacteria    Bacillus  thuringiensis  Escherichia  coli  Kucuria  rhizophilia  Anabaena  Aquaspirillum  Other  bacteria  may  also  be  available  which  have  unusual  morphological  properties    Saccharomyces  bayanus  Rhizopus  nigricans    Follow  the  guidelines  for  each  stain  as  described  below.    Work  individually.    Prepare  scientific  diagrams  (Appendix  2)  showing  results  from  each  stain.    For  each  set  of  results,  students  should  plan  on  looking  up  the  correct  reactions  and/or  morphological  features  using  the  resources  available  (ie  your  textbook,  Dr.  Selinger’s  web  page)  and  using  this  information  to  evaluate  their  techniques.    Preparation  of  Films  for  Staining  –  Procedure   • Obtain  a  clean  slide  and  draw  a  circle  on  it  approximately  1.5  cm  in  diameter.   • Turn  the  slide  over.   • Flick  the  tube  of  culture  to  mix  up  the  cells,  and  use  a  loop  to  obtain  aseptically  a  drop  of  culture.     Place  this  loopful  of  culture  within  the  circle.    Alternatively,  if  using  a  plate  culture,  first  use  your  loop   25  
  • to  add  a  drop  of  water  to  the  circle  on  the  slide.    Remove  a  small  quantity  of  culture  and  mix  with  the   water  to  make  a  smooth  suspension.   • Allow  the  suspension  to  air  dry.    When  dry,  the  film  should  be  only  faintly  visible;  a  thick  opaque  film  is   useless.   • The  only  fixation  required  is  to  pass  the  slide  several  times  (maximum  10)  through  the  bunsen  burner   flame  until  the  slide  is  warm  but  not  too  hot.    If  the  slide  is  fixed  until  too  hot  to  the  touch,  the   bacteria  will  be  misshapen  when  observed  under  the  microscope.      Gram  Staining  –  Procedure  Perform  on  B.  thuringiensis,  Aquaspirillum  and  E.  coli   • Prepare  smear,  dry  and  heat  fix.    Flood  the  smear  with  crystal  violet  solution  for  1  min.    Gently  wash  with   tap  water  for  2-­‐3  seconds  and  remove  the  water  by  tapping  the  slide  gently  on  paper  towel.   • Add  Gram’s  iodine  solution  to  the  slide  for  1  min.    Wash  gently  with  tap  water  and  remove  as  above.   • Decolourise  with  95%  ethanol  by  dripping  ethanol  on  surface  of  slide  until  no  more  colour  is  removed.     Rinse  gently  with  water.    If  too  much  alcohol  is  added,  the  Gram-­‐positive  organisms  may  become  Gram-­‐ negative.    Remove  the  water  after  the  last  wash.   • Counterstain  the  slide  with  safranin  for  30  seconds  -­‐  1  minute.   • Wash  the  slides  with  tap  water,  air  dry  on  paper  towels,  and  examine  under  oil  immersion.    Gram  positive  organisms  stain  purple;  Gram  negative  organisms,  red  (pink).    Negative  Staining  –  Procedure  Perform  on  Bacillus  thuringiensis.   • Add  a  small  drop  of  India  ink  to  a  wet  mount  of  bacterial  cells  on  a  microscope  slide.    Mix  with  a  toothpick.   • Add  a  coverslip,  place  the  slide  between  two  sheets  of  blotting  paper,  and  apply  pressure  with  a  cork  until   most  of  the  India  ink  is  removed  (slide  should  appear  a  light  gray  in  colour)   • Observe  using  phase  contrast  microscopy.    PHB  Staining  -­‐  Procedure  Perform  on  Bacillus  thuringiensis.   • Prepare  smears  of  the  organism,  air  dry  and  heat  fix.    Flood  entire  slide  with  Sudan  Black  B  and  add  more   stain  as  the  dye  solvent  evaporates.    Stain  for  at  least  10  minutes.   • Pour  off  excess  stain  (do  not  wash)  and  air  dry.   • Clear  slide  by  dipping  in  a  jar  of  solvent  in  the  fume  hood  for  5  sec.    Air  dry  in  the  fume  hood.   • Counterstain  for  1  min.  with  safranin.       • Wash  with  water,  drain,  blot  and  air  dry.    Examine  with  oil  immersion  objective.    Cell  is  pink,  lipids  are  dark   grey  or  black.    Endospore  Staining  -­‐  Procedure  Perform  on  Bacillus  thuringiensis.   • Prepare  smear  and  heat  fix.    Cover  the  dried  fixed  film  with  a  small  piece  of  paper  towel.    Saturate  this  with   5%  malachite  green.   • Place  the  slide  on  a  rack  over  a  boiling  water  bath.    Steam  slide  for  5-­‐10  minutes  in  this  manner.    Add   additional  stain  as  needed  -­‐  do  not  allow  the  slide  to  dry  out  during  this  procedure.   26  
  •   o Caution:  the  water  bath  is  at  100 C  –  the  steam  will  burn  your  skin.    Take  appropriate  precautions.     • Allow  the  slide  to  cool,  then  rinse  with  water.    Tap  over  a  paper  towel  to  remove  excess  water   • Counterstain  with  safranin  for  30  seconds.   • Rinse  slide  with  water.   • Allow  to  air  dry,  and  view.    Endospores  will  stain  green  and  the  rest  of  the  cell  pink.      Anabaena     • Prepare  a  wet  mount  and  observe  using  the  phase  contrast  microscope.    Look  for  the  presence  of   heterocysts  at  regular  intervals  in  the  filament.        Saccharomyces  bayanus  Staining  –  Procedure   • Prepare  a  wet  mount  of  the  cells  using  a  drop  of  Methylene  Blue.   • Carefully  place  a  cover  slip  on  the  cell/stain  mixture.   • View  the  cells  noting  size  and  shape.    If  you  look  carefully,  you  should  be  able  to  see  budding  cells.        Rhizopus     • Prepare  a  wet  mount  of  the  hyphae  and  view  using  the  compound  light  microscope.    You  may  be  able   to  see  zygosporangia,  the  reproductive  structures  produced  by  these  organisms.    Thought  Questions:  • Why  do  we  stain  microorganisms  before  viewing  them  with  a  microscope?  • What  is  a  differential  stain?    Give  two  examples  of  differential  stains  used  in  Biology  3200  labs.  • Why  is  immersion  oil  used  to  view  microscopic  organisms?  • Gram  stains  separate  microorganisms  into  two  major  groups:  Gram  negative  bacteria  and  Gram  positive   bacteria.    Describe  the  differences  in  the  structure  of  the  cell  wall  of  each  type  of  bacteria  that  results  in   the  differential  stain  result.  • What  are  endospores?    How  do  they  form?    Which  organisms  can  produce  endospores?  • What  are  heterocysts?    Which  organisms  can  produce  them?    Relate  their  structure  to  their  function.    References:  Atlas,  R.  M.  1997.  Principles  of  Microbiology.  Wm.  C.  Brown  Publishers,  Toronto.    Madigan,  M.  T.,  and  Martinko,  2006.    Brock  Biology  of  Microorganisms  Eleventh  Edition.  Prentice-­‐Hall  of   Canada,  Inc.,  Toronto.    Ross,  H.  1992-­‐1993.  Microbiology  241  Laboratory  Manual.    The  University  of  Calgary  Press,  Calgary.         27  
  • EXERCISE  6   BACTERIAL  REPRODUCTIONMost  bacteria  reproduce  by  an  asexual  process  called  binary  fission.    In  this  process  a  single  mother  cell  produces  two  identical  daughter  cells.    Cell  growth  is  often  equated  with  increase  in  cell  number  due  to  the  difficulty  in  measuring  changes  in  cell  size.    Under  ideal  conditions  populations  of  bacterial  cells  grow  exponentially  as  cell  number  doubles  at  a  regular  interval  or  generation  time  (td).      In  the  laboratory,  pure  cultures  are  routinely  grown  as  batch  cultures  in  test  tubes  and  Erlenmeyer  flasks.    A  batch  culture  is  prepared  by  inoculating  a  fixed  amount  of  liquid  medium  with  the  bacteria.    The  resulting  culture  is  then  incubated  for  an  appropriate  period  of  time  with  no  further  addition  of  microorganisms  or  growth  substrates.        Cell  growth  in  batch  cultures  can  be  divided  into  four  phases.    Initially  the  culture  is  in  a  lag  phase  where  cells  are  preparing  to  reproduce.    During  this  time  cells  are  adjusting  their  metabolism  to  prepare  for  a  new  cycle  of  growth.    There  is  an  increase  in  cell  size  without  increasing  numbers.    As  cells  begin  to  divide  and  their  growth  approaches  the  maximal  rate  for  the  particular  set  of  incubation  conditions  established,  the  culture  enters  the  exponential  growth  phase  (log  phase).    One  cell  gives  rise  to  two,  two  cells  give  rise  to  four,  and  so  on.      In  this  phase,  cells  are  growing  and  dividing  at  the  maximum  growth  rate  possible  for  the  medium  and  incubation  conditions.    Growth  rate  is  determined  by  a  number  of  factors,  including  available  nutrients,  temperature,  pH,  oxygen  and  other  physical  parameters  as  well  as  genetic  determinants.    As  nutrients  become  limiting  or  waste  products  accumulate,  the  growth  rate  once  again  slows  and  the  culture  enters  the  stationary  phase.    During  this  phase,  there  is  no  further  net  increase  in  cell  number,  as  growth  rate  equals  the  rate  of  cell  death.    The  final  phase  of  a  batch  culture  is  the  death  phase.    During  this  phase,  there  is  an  exponential  decline  in  viable  cell  numbers.    This  decline  may  be  reversed  if  environmental  parameters  are  modified  by  the  addition  of  nutrients,  for  example.    The  rate  of  growth  of  bacterial  cells  is  usually  monitored  by  measuring  the  increase  in  cell  number.    Bacterial  cell  numbers  may  be  enumerated  by  a  number  of  methods.    Direct  count  methods  enumerate  all  cells  whether  they  are  viable  or  not.    The  most  common  direct  count  method  uses  a  microscope  and  a  specialized  counting  chamber  (e.g.,  Petroff-­‐Hauser  chamber)  to  count  the  number  of  cells  in  a  known  volume  of  culture.    Automated  systems  such  as  Coulter  counters  may  also  be  used  to  determine  cell  number.        In  contrast,  indirect  count  methods  require  the  growth  of  cells  in  culture  in  order  to  enumerate  cell  numbers.    The  most  common  method  for  enumerating  living  cells  is  the  viable  plate  count.    Serial  dilutions  of  a  cell  suspension  are  prepared  and  spread  on  to  the  surface  of  a  solid  agar  medium  (spread  plate)  or  incorporated  into  molten  agar  that  is  then  poured  into  sterile  petri  dishes  (pour  plate).    Following  a  suitable  incubation  time,  the  number  of  colonies  growing  on  and  in  the  inoculated  agar  are  counted  and  used  to  determine  the  number  of  viable  cells  in  the  original  suspension.    This  method  makes  the  assumption  that  each  colony  arose  from  a  single  viable  cell  or  colony  forming  unit  (CFU).    Turbidimetric  methods  can  be  used  to  rapidly  assess  biomass  (e.g.,  cell  numbers).    The  amount  of  light  passing  through  a  cell  suspension  can  be  determined  with  a  spectrophotometer.    The  optical  density  (OD)  is  a  measure  of  the  amount  of  light  passing  through  the  suspension.    A  calibration  curve  can  be  generated  using  suspensions  of  known  numbers  of  bacteria.     28  
  • Prelab  preparation:    Turn  on  the  spectrophotometer  and  set  to  600  nm  at  least  15  minutes  prior  to  taking  readings.    METHODS  • Ethanol/dettol  in  bottles  • Test  tube  racks  • Spectrophotometer  blank  containing  LB  broth  • Spectrophotometer  • Overnight  culture  of  E.  coli  K12  strain  • Overnight  culture  of  E.  coli  DH5a  strain  • 6  Culture  flasks  of  LB  (100  mL  volume);  pre-­‐warmed  • 2  Culture  flasks  of  LB  with  2%  NaCl;  pre-­‐warmed  • 2  Culture  flasks  of  LB  at  pH  5;  pre-­‐warmed    Please  work  in  pairs.  At  20  minute  intervals,  monitor  the  growth  of  your  E.  coli  culture  by  optical  density  following  the  procedures  outlined  below.    A.    Culture  inoculation:    1)    Each  group  of  two  will  be  assigned  one  culture  flask  and  one  treatment  (see  Table  below).    Please  mark  the  flask   with  your  treatment,  bench  number  and  lab  number.      Groups  in  laboratory  section  3  will  continue  to  sample   from  the  flask  corresponding  to  your  bench.    Data  from  all  three  lab  sections  will  be  pooled  and  posted  on  the   Biology  3400  web  site.     Table  1:  Growth  parameters  for  bacterial  reproduction  exercise.     E.  coli  strain   Medium   Growth  Temperature   K12   LB   37oC   K12   LB   30oC   DH5a   LB   37oC   K12   LB  with  2%  NaCl   37oC   K12   LB  at  pH  5   37oC    2)       Aseptically  remove  1  mL  of  culture  from  the  overnight  E.  coli  culture  you  were  assigned,  and  add  it  to  your   culture  flask.    Swirl  to  mix,  and  record  an  initial  optical  density  value  as  described  in  Part  B  below.    B.    Culture  sampling:    1) Everyone  in  the  laboratory  will  be  sampling  at  the  same  time.    Samples  will  be  collected  four  times  during  your   regularly  scheduled  lab  period  at  20  minute  intervals.    For  labs  1  and  2,  these  correspond  to:  9:35  am  (“time   zero”),  9:55am,  10:15  am,  10:35  am,  and  for  labs  3  and  4:    11:00  am,  11:20  am,  11:40  am,  and  12:00  pm.    Your   laboratory  instructor  will  set  a  timer  so  that  everyone  is  coordinated.    Just  prior  to  your  readings,  zero  the   spectrophotometer  as  outlined  in  Appendix  7.    2) At  the  times  indicated,  carefully  remove  your  flask  from  the  shaking  incubator,  remove  5  mL  of  your  culture,   and  place  it  into  a  spectrophotometer  tube.    Replace  your  culture  flask  back  into  the  incubator,  and  then  read   29  
  • the  absorbance  of  the  sample  you  collected.    Record  the  optical  density  (Absorbance)  reading  in  your  lab  book   and  in  the  table  on  the  board.      3) Your  lab  instructors  will  collect  and  distribute  class  data.    Prepare  graphs  for  each  of  the  parameters  tested,  and   use  them  to  address  the  thought  questions  below.    Thought  Questions:  • Use  your  graphs  to  calculate  generation  time  of  E.  coli  in  each  of  the  cultures.  • What  impact  does  increasing  the  concentration  of  NaCl  have  on  growth  of  E.  coli?  • Do  changes  in  the  pH  or  temperature  cause  a  change  in  the  rate  of  growth  of  E.  coli?    Provide  reasons  for  any   changes  observed.  • Are  there  differences  in  the  rate  of  growth  of  the  two  strains  of  E.  coli  examined?    Why  might  this  be?  • Compare  your  values  to  that  from  the  literature.    Do  the  values  differ?    Why  might  this  be?             30  
  • EXERCISE  7   THE  AMES  TEST  -­  MUTATION  AND  RECOMBINATION    You  have  learned  about  some  of  the  advantages  of  using  a  model  system  in  your  study  of  the  effect  of  UV  light  on  DNA  in  Biology  2000  (Introduction  to  Genetics).    The  Ames  test  also  makes  use  of  a  model  system  in  order  to  measure  the  mutagenic  potential  of  compounds.    This  test  is  a  reversion  mutagenesis  assay  and  uses  strains  of   -­‐the  bacterium  Salmonella  that  have  point  mutations  in  various  genes  in  the  histidine  operon.    These  His  mutants  are  unable  to  synthesise  histidine  and  therefore  unable  to  grow  on  minimal  media  lacking  histidine.     -­‐When  the  His  tester  cells  are  cultured  on  a  minimal  agar  medium  containing  trace  amounts  of  histidine,  a  small   +and  relatively  constant  number  of  cells  per  plate  spontaneously  revert  to  His  and  subsequently  reproduce  and  form  colonies.    Incorporation  of  a  mutagen  into  the  agar  increases  the  number  of  revertant  colonies  per  plate,  usually  in  a  dose  dependent  manner.    METHODS:    For  each  lab:  • 1  mg/mL  Sodium  Azide  (CAUTION:    MUTAGEN!)  • Hair  Dye  (Miss  Clairol)  • Cigarette  extract  • Ethidium  bromide  • Citrisolv  • Micro  Kits  • Gloves  • Sterile  water  • 5x  Liquid  cultures  of  Salmonella  strains  1535  and  1538  in  NB  supplemented  with  NaCl  • Top  agar  overlay  in  50oC  water  bath  (2  mL  per  tube)  • Test  tube  with  2  mL  mark  indicated  (at  pouring  station)  • Minimal  salts  plates  (15  per  lab)  • Vortex  mixer  (at  pouring  station)  • Bunsen  burner  (at  pouring  station)  • Test  tube  racks  • Sterile  filter  paper  disks    • Forceps  • 3x  micropipettors  (10  –  100  µL)  • Sterile  tips  • 5x  beakers  with  biohazard  bags  • Small  vials  containing  95%  ethanol  for  flaming      Set  up  your  experiment  as  follows  in  the  Table:               31  
  • Bench  #   Compound  to  be  Tested   Water     Ethidium   Cigarette   Citrisolv   Sodium   Hair  Dye   Bromide   Extract   Azide  1   +  1535     +1535             +  1538          2   +  1538     +1535             +1538        3         +1535             +1538      4           +1535             +1538    5             +1535             +1538    • For  each  plate,  you  will  be  creating  an  overlay  using  a  single  strain  mixed  with  the  top  agar.    The  top  agar  has   had  a  trace  amount  of  histidine  and  biotin  added.    Using  the  Table  as  a  guide,  obtain  and  label  the  appropriate   number  of  minimal  salts  plates.     Why  is  it  necessary  to  add  a  trace  amount  of  histidine  to  the  top  agar?    • Have  your  plates  labelled,  and  take  to  the  station  set  up  at  the  back  bench.    Set  a  micropipettor  to  50  µL.     Remove  one  tube  of  agar  overlay  from  the  waterbath,  and  aseptically  add  50  µL  of  liquid  culture  to  the  tube.     Vortex  to  mix  and  pour  over  the  surface  of  your  agar  plate.    Clean  up  your  work  surface  prior  to  going  back  to   your  bench.     Note:    you  must  work  very  quickly  in  order  to  avoid  the  top  agar  solidifying.      • Allow  your  agar  to  solidify  for  10  minutes.         Wear  gloves  for  any  handling  of  the  potential  mutagens!        • Flame  forceps  to  sterilise.    Note  that  this  does  not  mean  holding  forceps  in  the  flame  of  your  Bunsen  burner   until  red  hot!    Rather,  dip  the  forceps  in  ethanol,  and  wave  through  the  flame.    Allow  the  ethanol  to  burn  off.     Pick  up  a  sterile  filter  paper  disk  and  place  it  on  the  centre  of  your  inoculated  plate.    • Add  10  mL  of  the  appropriate  compound  (see  Table  above)  to  the  disk.  • Incubate  your  plates  for  48  hours  at  37  oC.    In  the  next  lab,  enumerate  the  number  of  colonies  on  each  plate   and  record  the  results  on  the  board.      Thought  Questions:   • What  specific  mutations  in  the  His  operon  do  each  of  the  Salmonella  strains  used  contain?   • Evaluate  the  compounds  tested  for  mutagenicity.    What  kind  of  mutations  are  being  caused  by  the   compounds  tested?  (use  the  information  from  the  first  Thought  Question  to  answer  this)   • Typically,  mutagens  are  first  mixed  with  liver  extract  prior  to  carrying  out  the  Ames  test.    What  would  be   the  purpose  of  this  step?       32  
  • References:  Ames,  B.N.,  Durston,  W.E.,  Yamasaki,  E.,  and  Lee,  F.E.  1973.  Carcinogens  are  mutagens:  a  simple  test   combining  liver  homogenates  for  activation  and  bacteria  for  detection.  Proc.  Natl.  Acad.  Sci.  U.S.A.   70:2281-­‐2285.    Ames,  B.N.,  Lee,  F.E.,  and  Durston,  W.E.  1973.  An  improved  bacterial  test  system  for  the  detection  and   classification  of  mutagens  and  carcinogens.  Proc.  Natl.  Acad.  Sci.  U.S.A.  70:782-­‐786.    Ames,  B.N.,  McCann,  J.,  and  Yamasaki,  E.  1975.  Methods  for  detecting  carcinogens  and  mutagens  with  the   Salmonella-­‐microsome  mutagenicity  test.  Mutational  Research  31:347-­‐364.    Madigan,  M.  T.,  and  Martinko,  2006.    Brock  Biology  of  Microorganisms  Eleventh  Edition.  Prentice-­‐Hall  of   Canada,  Inc.,  Toronto.     33  
  • EXERCISE  8   BIOCHEMICAL  TESTS  (Selective  and  Differential  Media;  IMViC  Tests)  Normally,  the  coliform  group  of  bacteria  is  used  to  indicate  the  pollution  of  water  with  fecal  wastes  of  humans  and  animals,  and  thus,  the  suitability  of  a  particular  water  supply  for  domestic  use.    The  term  coliform  is  used  to  describe  aerobic  and  facultatively  anaerobic  Gram  negative  rods  that  ferment  lactose  with  gas  formation.    Most,  but  not  all  organisms  within  this  group  are  intestinal  in  origin;  for  instance,  Escherichia  coli.    Consequently,  presence  of  lactose  fermentors  in  a  sample  of  water  provides  circumstantial  evidence  of  pollution  by  fecal  wastes,  and  may  suggest  the  presence  of  pathogenic  bacteria  such  as  members  of  the  genera  Salmonella  and  Shigella.    These  pathogens,  in  addition  to  non-­‐pathogens  such  as  E.  coli  are  members  of  the  Enterobacteriaceae  family.    In  order  to  identify  the  organisms  present  in  the  water,  several  biochemical  tests  that  rely  on  differences  in  the  chemical  composition  of  media  used  may  be  performed  (see  Appendix  4  and  Appendix  8  for  more  details).    SELECTIVE  AND  DIFFERENTIAL  MEDIA:    I.  Media  for  Isolation  of  Enterobacteriaceae    A  strategy  for  bacterial  isolation  involves  the  use  of  selective  media,  media  with  specific  components  that  promote  the  growth  of  some  bacteria  and  inhibit  the  growth  of  others.    Selectivity  may  be  achieved  in  three  ways:   • by  adding  something  to  the  medium  to  discourage  the  growth  of  species  not  required   • by  altering  the  pH  of  the  medium   • by  omission  of  some  ingredient  required  by  most  bacteria,  but  not  by  the  organism  to  be  isolated    Differential  media  contain  specific  biochemical  indicators  that  demonstrate  the  presence  of  certain  substances  characteristic  of  certain  bacteria.    Thus,  differential  media  are  useful  for  bacterial  identification.    Eosin  Methylene  Blue  Agar  (EMB  Agar)  EMB  is  both  a  differential  and  selective  plating  medium  recommended  for  use  in  the  isolation  of  Gram-­‐negative  bacilli  and  the  differentiation  of  lactose  fermentors  from  non-­‐lactose  fermentors.    EMB  agar  contains  the  two  indicators,  eosin  Y  and  methylene  blue  as  well  as  the  carbohydrate  lactose.    Eosin  (an  acidic  dye)  reacts  with  methylene  blue  (a  basic  stain)  to  form  a  compound  of  either  acidic  or  neutral  nature.    The  acid  produced  by  lactose  fermentors  is  sufficient  to  cause  this  dye  compound  to  be  taken  up  by  the  cells.    Non-­‐lactose  fermentors  are  colourless  because  the  eosin  and  methylene  blue  compound  cannot  be  taken  up  by  the  cells.    The  basic  stain  methylene  blue  inhibits  bacterial  growth,  particularly  that  of  Gram  positive  bacteria  (due  to  their  cell  wall  composition).    Eosin  methylene  blue  (EMB)  agar  is  thus  selective  for  Gram  negative  bacteria.    MacConkey  Agar  MacConkey  agar  is  a  differential  and  selective  plating  medium  recommended  for  use  in  the  isolation  of  Gram-­‐negative  bacilli  and  the  differentiation  of  lactose  fermentors  from  non-­‐lactose  fermentors.    The  differential  action  of  the  MacConkey  agar  is  indicated  by  the  colonies  of  coliform  bacteria  becoming  “brick  red”  in  colour.     34  
  • This  occurs  when  the  coliforms  utilise  the  lactose  producing  acids.    The  decrease  in  pH  results  in  the  uptake  of  the  indicator  neutral  red  by  the  cells.    Non-­‐lactose  fermentors  are  colourless  and  transparent.    Production  of  acid  may  also  result  in  a  zone  of  precipitated  bile  surrounding  the  colony.    Bile  salts  and  crystal  violet  present  in  the  medium  inhibit  Gram-­‐positive  bacteria  from  growing.    II.  Acid  Production  From  Carbohydrates    As  demonstrated  with  MacConkey  Agar,  bacteria  vary  in  their  ability  to  ferment  various  sugars.    Products  of  fermentation  are  often  acids  and  hence,  pH  changes  can  demonstrate  successful  fermentation.    In  addition,  gas  (usually  but  not  always  CO2)  is  often  produced  during  fermentation,  offering  another  indicator.    Hugh  and  Leifsons  method  for  demonstrating  the  presence  of  the  products  of  fermentation  consists  of  a  semi-­‐solid  medium  containing  peptone  (short  chains  of  amino  acids),  the  carbohydrate  of  interest  (usually  glucose  or  lactose),  and  a  pH  indicator,  Bromothymol  blue.    Tubes  are  stab-­‐inoculated  all  the  way  to  the  bottom  of  the  tube,  so  as  not  to  introduce  oxygen  into  the  medium.    Several  reactions  may  be  observed.    Facultative  organisms  will  produce  an  acid  reaction  (the  indicator  changes  to  yellow)  throughout  the  entire  tube  of  medium.    The  acid  reaction  produced  by  oxidative  organisms  is  apparent  first  at  the  surface,  extending  gradually  downwards  into  the  medium.    Note  that  organisms  that  oxidize  glucose  are  generally  unable  to  ferment  any  carbohydrate.    Strict  fermentors  will  produce  an  acid  reaction  at  the  bottom  of  the  tube.    Organisms  unable  to  use  the  carbohydrate  may  be  able  to  grow  using  the  peptone.    Production  of  alkaline  products  result  in  the  formation  of  a  blue  colour  at  the  top  of  the  tube  (although  this  does  not  indicate  that  the  organism  is  aerobic).    III.  Motility  Medium    This  medium  contains  triphenyl  tetrazolium  chloride  (TTC)  and  a  small  concentration  of  agar  in  order  to  make  the  medium  semi-­‐solid.    TTC  is  reduced  when  broken  down  by  the  organism,  and  the  TTC  turns  red  where  this  has  occurred.    If  the  organism  is  facultative  and  motile,  it  moves  throughout  the  entire  tube  of  medium  and  the  whole  tube  becomes  red.    If  the  organism  is  aerobic  and  motile,  the  top  of  the  tube  becomes  red.    METHODS    For  each  bench:   • 3  plates  each  of  MacConkey  and  EMB  media     • 5  known  broth  cultures     • 1  unknown  broth  culture   • 6  tubes  of  Hugh  and  Leifsons  (H  &  L)  lactose  medium   • 6  tubes  of  motility  medium    Please  work  in  groups  of  four.   • Divide  your  three  MacConkey  and  three  EMB  plates  in  half  and  streak  inoculate  them  with  the  six   bacterial  species  provided.    After  incubation  at  37°C  for  48  hours,  observe,  and  describe  the  various   35  
  • cultures  on  the  plates.    Generate  a  table  of  results  summarizing  growth  and  properties  of  all  bacteria   on  the  two  media.   • Work  collectively  to  determine  the  lactose  fermentation  ability  of  all  of  the  bacteria  provided.    These   tubes  are  inoculated  using  a  stab  technique.    Use  the  probe  to  remove  aseptically  a  small  amount  of   bacterial  culture,  then  stab  the  probe  to  the  bottom  of  the  tube  of  medium  without  mixing  the   medium  around.    Inoculate  each  tube  with  one  of  the  bacterial  species  and  label  appropriately.    Tubes   will  be  incubated  for  48  h  at  37°C.    After  incubation,  observe  tubes  and  record  the  results.   • Work  collectively  to  inoculate  your  motility  medium  tubes.    Again,  as  this  medium  is  semi-­‐solid,  use  a   probe  and  stab  the  culture  down  to  the  bottom  of  the  tube,  and  remove  the  probe  carefully.    Do  not   mix  the  probe  around  in  the  tube.    Tubes  will  be  incubated  for  48  h  at  37°C.    After  incubation,  observe   tubes  and  record  the  results.    IMViC  TESTS    Only  preliminary  taxonomic  assessment  of  bacteria  can  be  made  on  the  basis  of  microscopic  size,  shape,  association,  and  Gram  staining.    Information  regarding  natural  occurrence  is  also  valuable  since  bacteria  generally  occur  in  specific  habitats.    This  is  particularly  the  case  for  fastidious  bacteria,  those  with  very  specific  nutritional  and  environmental  requirements.  However,  even  when  supplemented  with  habitat  information,  bacterial  identification  based  on  microscopic  assessment  is  generally  incomplete.    Confident  bacterial  identification  can  be  made  based  on  biochemical  tests,  and  for  certain  pathogens,  or  for  examining  microbial  presence  in  specific  environments,  series  of  diagnostic  tests  have  been  developed.    For  example,  the  IMViC  tests  are  used  routinely  to  confirm  the  presence  of  coliform  organisms  in  water.    “IMViC”  is  an  acronym  for  ‘Indole,  Methyl  Red,  Voges-­‐Proskauer,  and  Citrate  utilisation’  tests  (the  “i”  is  inserted  for  ease  of  pronunciation).    I.    Indole  Formation  -­‐  Utilisation  of  Tryptophan    When  cultured  on  peptone  water,  a  liquid  medium  containing  tryptophan,  certain  bacteria  will  produce  indole.    The  presence  of  this  indole  is  readily  revealed  through  addition  of  Kovaks  reagent,  producing  a  pink  colour.    This  reagent  contains  the  organic  solvent  amyl  alcohol  that  extracts  the  coloured  (pink)  substance.    II.  The  Methyl  Red  (MR)  Test  -­‐  Mixed  Acid  Fermentation  Pathway    The  mixed  acid  fermentation  pathway  results  in  the  formation  of  a  number  of  organic  acids  such  as  lactic  and  acetic  acid.    If  this  is  a  primary  fermentation  pathway  of  a  bacterium,  a  noticeable  drop  in  pH  will  occur  with  incubation  on  MRVP  media.    This  decrease  in  pH  can  be  revealed  by  a  methyl  red  solution  which  is  yellow  under  neutral  conditions  and  red  at  a  pH  less  than  5.    III.    The  Voges-­‐Proskauer  (VP)  Test  -­‐  The  Butanediol  Fermentation  Pathway    An  alternate  fermentation  pathway  performed  by  some  other  bacteria  results  in  the  formation  of  a  non-­‐acidic  product,  butanediol  and  hence,  is  named  for  this  product.    The  occurrence  of  the  pathway  may  be  determined   36  
  • by  a  biochemical  test  for  an  intermediate  compound  in  the  pathway,  acetoin  (acetyl  methyl  carbinol),  which  is  detected  by  the  Voges-­‐Proskauer  test.    IV.    Citrate  Utilisation  -­‐  Growth  Using  A  Single  Carbon  Source    The  nutritional  requirements  of  different  bacteria  vary  considerably  and  these  can  provide  useful  information  contributing  to  biochemical  identification.    In  Simmons  citrate  agar,  citrate,  in  the  form  of  sodium  citrate,  is  the  sole  carbon  source.    Organisms  able  to  utilise  the  citrate  grow  on  the  surface  of  the  medium  and  due  to  oxidative  formation  of  sodium  carbonate,  raises  the  pH  of  the  medium  changing  it  from  green  to  blue  (bromothymol  blue  is  the  indicator).      V.    Urea  Hydrolysis    Some  bacteria  can  produce  urease,  an  enzyme  which  hydrolyses  urea  into  ammonium  and  carbon  dioxide.    The  presence  of  this  enzyme  is  detected  by  growing  the  bacteria  in  a  medium  containing  urea    and  a  pH  indicator,  phenol  red.    If  ammonium  is  produced  as  a  result  of  urea  hydrolysis,  the  increase  in  pH  will  turn  the  medium  to  a  violet-­‐red  colour.    METHODS:    For  each  bench:   • 6  broth  cultures,  one  of  which  is  an  ‘Unknown’   • 6  MRVP  broth  tubes     • 6  indole  broth  tubes     • 6  Simmons  citrate  agar  slants   • 6  Urea  broth  tubes    Please  work  in  groups  of  four.    1)   Inoculate  6  Indole  broth  tubes  separately  with  the  6  bacteria.    After  48h  of  incubation  at  37  oC,  add  20   drops  (1  mL)  of  Kovaks  reagent.    Shake  and  look  for  the  formation  of  a  pink  colour  in  the  top  (organic)   phase;  it  may  take  20  minutes  to  develop.    The  pink  colour  is  a  positive  result,  indicating  the  ability  to  use   tryptophan.    Note,  please  place  tubes  containing  amyl  alcohol  in  a  separate  rack  on  the  side  bench  as  this  material  needs  to  be  disposed  of  separately.    2)   A  single  culture  solution  (peptone,  glucose,  potassium  phosphate)  will  be  used  for  both  the  methyl  red  and   Voges-­‐Proskauer  tests.    Inoculate  6  MRVP  tubes  with  the  6  bacteria  provided,  one  culture  into  each  tube.         • After  48h  of  incubation  at  37°C,  remove  2  ml  of  culture  solution  and  add  1  ml  α-­‐napthol  (Barritts   reagent  A  -­‐  1  ml  is  about  20  drops)  and  1  ml  40%  KOH  (Barritt’s  reagent  B;  caution  -­‐  this  is  caustic).   Shake  vigorously  for  30  seconds.     37  
  • • Shake  the  tubes  frequently  and  observe  for  up  to  30  minutes  for  the  formation  of  a  red  colour  that   represents  a  positive  VP  test.  A  yellow  or  brown  colour  is  a  negative  result.   •   • Add  3-­‐5  drops  of  methyl  red  solution  to  the  culture  remaining  in  the  tube.    An  immediate  red  reaction   provides  a  positive  response  to  the  test,  indicating  the  presence  of  mixed  acid  fermentation.    A  yellow   or  orange  colour  represents  a  negative  response.    3)   Inoculate  6  Simmons  citrate  agar  slants  separately  with  the  6  bacteria.  For  these  inoculations,  smear  cells   along  the  surface  of  the  slant.    Incubate  tubes  for  48  h  at  37°C.     • After  incubation,  observe  colours  on  the  surface  and  down  through  the  tubes.  A  dark  blue  colour  is  a   positive  result  while  green  indicates  a  negative  test  for  citrate  utilisation.    4)   Inoculate  6  urea  slants  separately  with  the  6  bacteria.    After  incubation  for  48h  at  37°C,  observe  for  the   development  of  a  violet-­‐red  colour.     After  completing  the  Indole,  MR,  VP,  Citrate  and  Urea  tests,  collaborate  with  the  other  students  at  your   bench  to  generate  in  your  lab  books  tables  of  results  for  all  bacteria  in  all  tests.    Thought  Questions:  • Compare  and  contrast  chemically  defined  and  complex  media.    Provide  two  examples  of  complex  media   used  in  this  exercise  and  explain  why  these  media  are  considered  complex.  • Provide  2  examples  of  compounds  responsible  for  buffering  in  media.  • Is  agar  a  nutritionally  complete  substrate  for  microbes?    Why  or  why  not?  • Design  a  defined  medium  for  an  organism  that  can  grow  aerobically  on  acetate  as  a  carbon  and  energy   source.  • In  this  laboratory,  would  you  classify  the  organisms  used  as  photoautotrophs,  photoheterotrophs,   chemoautotrophs,  or  chemoheterotrophs?    Explain  your  choice(s).  • Identify  your  unknown.  Provide  evidence  to  support  your  choice  of  organisms.     38  
  • EXERCISE  9   YEAST  FERMENTATION  A  number  of  industrial  processes  make  use  of  the  end  products  of  bacterial  and  fungal  fermentations.    For  instance,  in  the  presence  of  acid  producing  bacteria,  and  often  the  enzyme  renninase,  milk  will  form  curds  (solid)  and  whey  (liquid).    Once  the  solids  are  compressed,  salted,  and  aged,  the  resulting  product  is  cheese.    Different  cheeses  are  produced  by  varying  the  bacterial  inoculum,  varying  the  milk  used,  or  even  by  introducing  fungi  such  as  certain  species  of  Penicillium  into  the  curds.    Some  Streptococcus  species  and  some  Lactobacillus  species  produce  only  lactic  acid  as  a  result  of  reduction  of  pyruvic  acid.    These  organisms  are  responsible  for  the  production  of  yogurt.    Yogurt  can  be  made  from  milk  simply  by  inoculating  with  a  starter  culture  of  yogurt  that  contains  live  bacterial  culture.    Conversely,  yeasts  produce  alcohol  and  CO2  rather  than  lactic  acid  as  a  result  of  the  reduction  of  pyruvic  acid.      Alcohol  Production    Prior  to  your  lab  period,  grape  juice,  water  and  yeast  cells  were  added  to  a  sterile  container.    Over  the  next  two  weeks,  you  will  be  responsible  for  sampling  the  fermenting  juice  at  various  time  intervals.    The  primary  fermentor  is  inoculated  with  a  high  cell  density  (~106  yeast  cells/mL).    The  bulk  of  the  must  (grape  juice  medium)  is  rapidly  depleted  of  oxygen  by  the  yeast  and  remains  anaerobic,  despite  the  primary  fermentor  remaining  open  to  the  atmosphere.    Yeast  cells  continue  to  reproduce  by  acquiring  the  needed  energy  and  carbon  through  fermentation.    The  fermentation  is  an  ethanolic  fermentation  because  ethanol  and  CO2  are  the  fermentation  endproducts.        Growth  of  the  yeast  culture  can  be  monitored  by  measuring  optical  density  and  enumerating  CFU/mL  (Recall  Exercise  6  -­‐  Bacterial  Reproduction).    Ethanol  concentration  can  be  estimated  indirectly  by  measuring  the  specific  gravity  of  the  wine  must  with  a  hydrometer.    The  specific  gravity  of  the  must  decreases  as  the  grape  juice  sugars  are  converted  to  ethanol  and  CO2.    A  "specific  gravity  to  percent  ethanol"  conversion  chart  supplied  with  the  hydrometer  is  then  used  to  determine  ethanol  content  of  the  must.        Note:  this  exercise  will  require  some  out  of  lab  participation.    Please  sign  up  for  two  time  slots  when  at  least  half  of  your  group  members  can  attend.    MATERIALS  (in  C741)  • Wine  thief  • Spectrophotometer  (warm  up  15  minutes  prior  to  reading  OD  values)  • Primary  fermentor  • pH  paper  • Micropipettors  and  sterile  tips  • Sterile  microfuge  tubes  • Rack  for  microfuge  tubes  • Filter  sterile  wine  must  for  diluting  samples  • Bunsen  burner   39  
  • • Hydrometer  • Sterilising  solution  • Graduated  cylinder  • Thermometer   o• 30 C  incubator  • YPD  plates  • Spreaders  and  alcohol  • Spreadsheet  for  recording  results    At  each  time  point  the  following  data  must  be  collected  by  each  group:  • Temperature  • OD600    • pH    • Specific  gravity  • Viable  counts    Procedure  • Sterilize  (by  immersion  in  metabisulfite),  the  spoon,  the  wine  thief,  the  sampling  graduated  cylinder,  the   hydrometer  and  the  thermometer,  and  rinse  each  in  water  prior  to  touching  the  wine.    Use  the  sterilized   spoon  to  stir  the  mixture  in  the  primary  fermentor.  • Use  the  sterilized  wine  thief  to  remove  mixture  from  the  primary  fermentor  into  the  plastic  graduated   cylinder.    Add  enough  sample  to  bring  the  level  up  to  the  line  marked.  • Measure  and  record  the  sample  temperature  in  the  cylinder.      • Measure  and  record  specific  gravity.    Use  the  diagram  posted  to  assist  you.  • Aliquot  some  mixture  into  the  125  mL  Erlenmeyer  flask  provided  –  label  with  sampling  time,  and  place  in   the  tray  in  the  deli  cooler.    An  instructor  will  read  and  record  the  pH  for  you.  • Use  a  sterile  5  mL  pipette  to  remove  5  mL  of  sample  from  the  cylinder  and  place  into  a  sterile  spec  tube.  • Remove  the  50  mL  Falcon  tube  of  sterile  wine  must  labeled  with  your  time  point  from  the  deli  fridge,  and   use  it  to  make  appropriate  dilutions.      • Use  the  blank  provided  to  zero  the  machine.    Read  the  optical  density  of  your  sample.    If  the  OD600  exceeds   0.7,  you  will  have  to  dilute  the  sample  with  the  sterile  must  provided  (start  by  creating  a  1:1  dilution).     Read  the  OD600  of  the  diluted  sample,  then  multiply  by  the  dilution  factor  to  obtain  your  corrected  reading.     Record  the  corrected  reading  on  the  sheet  provided.  •  Viable  counts:   • Prepare  in  duplicate.    Refer  to  Table  9.1  to  determine  the  number  of  dilutions  required.   • Prepare  required  dilution  series  –  check  dilution  calculations  with  Helena  or  Quintin  first.   • Label  plates  with  time,  name  and  dilutions.  Spread  plate  (in  duplicate)  100  µL  of  suggested  dilutions  on   YPD  agar.   • Invert  plates  and  incubate  at  30ºC  –  incubator  is  labeled.    Plates  will  be  removed  and  placed  into  the  fridge.    During  lab,  you  will  count  and  record  values  from  plates  having  between  30  and  300  colonies.     40  
  • Tidy  up  work  area!!–  put  spec  tubes  into  labeled  rack,  discard  tips,  pipettes  and  microfuge  tubes  into  Biohazard  bag,  put  everything  back  where  you  found  it.    Pour  out  wine  sample  and  resterilize  cylinder  for  the  next  group.    Thought  Questions  (to  be  answered  in  your  notebooks):  • Numerous  data  relating  to  alcohol  fermentation  were  collected  by  the  class  over  the  sampling  period,   including  measurements  of  pH,  temperature,  specific  gravity,  optical  density,  and  CFU’s/mL  of  culture.     Design  and  construct  a  series  of  figures  to  graphically  represent  the  data  that  were  collected.      • Calculate  the  generation  time  and  the  specific  growth  rate  of  the  yeast  cells  in  the  culture.  • Name  two  factors  that  control  the  final  ethanol  concentration  in  a  culture.  • Although  we  stirred  our  culture  each  time  before  sampling,  winemakers  do  not.    Why  would  winemakers   not  stir  the  culture?  • Why  did  the  pH  of  the  culture  change  as  fermentation  proceeded?  • Why  did  the  specific  gravity  of  the  culture  change  over  time?   41  
  • Table 9.1: Dilutions of yeast mixture to create and to plate out for all time points. Day/Time   Time  point  (hours)   Dilutions  to  Create   Dilutions  to  Plate   Spread  plate  100  mL  of  each  of  the  3  Mar.  22,  10:00  am   2  h   10-­‐3;  10-­‐4;  10-­‐5   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3  Mar.  22,  11:00  am   3  h   10-­‐3;  10-­‐4;  10-­‐5   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3  Mar.  22,  3:00  pm   7  h   10-­‐3;  10-­‐4;  10-­‐5   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3  Mar.  22,  8:00  pm   12  h   10-­‐3;  10-­‐4;  10-­‐5   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3   Mar.  23,  9:00  am   25  h   10-­‐4;  10-­‐5;  10-­‐6   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3  Mar.  23,  12:00  pm   28  h   10-­‐4;  10-­‐5;  10-­‐6   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3  Mar.  23,  4:00  pm   32  h   10-­‐4;  10-­‐5;  10-­‐6   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3  Mar.  24,  10:00  am   50  hr   10-­‐5;  10-­‐6;  10-­‐7   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3  Mar.  24,  4:00  pm   56  h   10-­‐5;  10-­‐6;  10-­‐7   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3   Mar.  25,  9:00  am   73  h   10-­‐5;  10-­‐6;  10-­‐7   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3  Mar.  25,  3:00  pm   79  h   10-­‐5;  10-­‐6;  10-­‐7   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3   Mar.  28,  9:00  am   145  h   10-­‐5;  10-­‐6;  10-­‐7   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3  Mar.  28,  3:00  pm   151  h   10-­‐5;  10-­‐6;  10-­‐7   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3  Mar.  29,  10:00  am   170  h   10-­‐5;  10-­‐6;  10-­‐7   dilutions  in  duplicate  on  YPD   Spread  plate  100  mL  of  each  of  the  3  Mar.  29,  3:00  pm   175  h     10-­‐5;  10-­‐6;  10-­‐7   dilutions  in  duplicate  on  YPD   42  
  • EXERCISE  10   VIROLOGY  The  objectives  of  this  series  of  exercises  are  first  to  isolate  coliphage  from  filtered  raw  and  treated  sewage  obtained  from  the  Lethbridge  Wastewater  Treatment  Plant,  to  examine  the  plaque  morphologies,  and  to  prepare  phage  isolate  from  one  particular  plaque.    Using  this  phage  isolate,  the  phage  titre  will  be  determined,  and  the  host  specificity  of  the  phage  will  be  examined  using  several  enteric  bacterial  strains.    These  exercises  will  demonstrate  standard  techniques  in  phage  isolation  and  manipulation.    (Please  review  the  material  on  sewage  treatment  posted  on  the  Biology  3400  web  page).    Prior  to  the  laboratory,  sewage  samples  were  collected  at  the  areas  indicated  on  the  schematic  posted  on  the   oweb  page.    Both  samples  were  stored  at  4   C  prior  to  filtering,  for  up  to  1  week.    On  the  morning  of  the  lab,  samples  were  filtered  twice  using  0.45  µm  filters.    PART  A  -­‐  ISOLATION    METHODS:    For  each  bench:  • Luria  Methylene  Blue  agar  plates  • Overnight  culture  of  Escherichia  coli  LE  392  • Bottle  of  molten  Luria  agar  overlay  (at  60  oC)  • Sterile  test  tubes  • Test  tube  rack  • Micropipettor  (100  µL  –  1000  µL)  • Sterile  tips  • Microbiology  kits    For  the  lab:  • Vortex  mixer  • Water  bath  set  to  60  oC  • Raw  and  treated  sewage  filtrate  • Test  tube  showing  4  mL  mark    Work  in  groups  of  4.  Note  that  sewage  filtrate  contains  human  pathogens.    Work  very  carefully.    Students  who  are  clearly  unprepared  or  are  sloppy  will  be  asked  to  leave  the  lab.   43  
  • Period  1  -­‐  Procedure    1)    Obtain  a  tube  of  culture  of  E.  coli    LE  392.      2)    Obtain  5  Luria  Methylene  Blue  agar  plates,  and  5  sterile  test  tubes.    Label  your  5  tubes  according  to  Table   7.1.     Table  7.1    Experimental  set-­‐up  for  isolation  of  coliphage  from  sewage.   Tube  #   Contents  (µL)   LE  392   Raw  Sewage   Treated  Sewage   Filtrate   Filtrate   1   500   0   0   2   0   500   0   500   3   0   0     4   500   500   0   5   500   0   500    3)   Pipette  the  appropriate  amount  of  filtrate  and/or  cells  into  each  of  your  labeled  test  tubes.    Leave  the   tubes  at  room  temperature  on  your  bench  to  incubate  for  20  minutes  to  allow  the  phage  to  adsorb  to  the   cells.  4) While  your  cultures  are  incubating,  label  your  Luria  Methylene  Blue  plates  according  to  Table  7.1.    Mark   the  level  of  4  mL  on  each  of  your  tubes  using  the  marked  test  tube  on  the  side  bench  as  a  guide.  5) Starting  with  Tube  1,  aseptically  pour  molten  agar  into  the  tube  up  to  the  level  of  4  mL.    Vortex  to  mix,   then  immediately  pour  the  contents  over  the  surface  of  the  appropriately  labeled  plate.    Swirl  the  plate   gently  to  ensure  that  the  entire  surface  is  covered  with  the  agar.  6) Repeat  step  5  for  the  remaining  tubes  and  plates.      7) After  10  minutes,  the  overlay  should  be  set.    Invert  your  plates  and  place  them  on  a  tray  on  the  side  bench   to  be  incubated.    Plates  will  be  incubated  at  37  °C  for  16  –  20  hours,  then  stored  at  4  °C  until  the  next   laboratory  period.    The  next  laboratory:  Work  in  groups  of  four.    MATERIALS     • Pasteur  pipettes   • Bulbs   • Gloves   • Chloroform  (in  the  fume  hood)   • Vortex  mixer   • Phage  dilution  buffer   • Plates  from  last  lab   44  
  • • 1  dissecting  microscope  per  bench   • Microfuge  tubes  (sterile)   • 1  mL  pipettes  and  propipettors   • Microfuge  racks   • Labeled  microfuge  rack  on  the  side  bench  for  class  tubes    Period  2  -­‐  Procedure  1)   Obtain  your  plates.    Examine  them  carefully.    Record  the  number  of  plaques  present  for  both  raw  and   treated  filtrate.    Is  there  any  difference?  2)   Make  detailed  observations  of  plaque  morphology.    Features  to  look  for  include  size,  shape,  and  turbidity   (clear  vs  cloudy).    Use  the  dissecting  microscopes  for  your  observations.  3)   After  making  observations,  obtain  a  microfuge  tube  and  aseptically  add  1  mL  of  phage  dilution  buffer  to   your  tube.    Label  with  your  group  designation.  4)   Use  a  Pasteur  pipette  (with  a  rubber  bulb  attached)  to  remove  a  plaque  (squeeze  the  bulb,  insert  pipette   into  the  agar  over  a  plaque,  gently  release  bulb  to  remove  a  plug  of  agar  containing  the  plaque).    Release   plaque  into  the  prepared  tube  of  phage  dilution  buffer.  5)   Vortex  vigorously  to  disperse  the  agar.  6)     Move  to  the  fume  hood  and  use  a  Pasteur  pipette  to  add  a  drop  of  chloroform  to  your  tube.    Vortex  the   mixture  once  again.       What  does  the  chloroform  do?  Place  your  tubes  in  the  rack  on  the  side  bench.    The  tubes  will  be  stored  at  4  oC  allowing  the  phage  to  elute  from  the  agar  into  the  buffer.    PART  B  –  AMPLIFICATION  OF  PHAGE  BY  PLATE  LYSIS    METHODS  Cultures/phage:   • Overnight  culture  of  E.  coli  strain  LE  392   • Tube  containing  plaque  isolated  previous  day    Other  supplies:   • Waterbaths  set  at  37  oC,  60  oC   • Test  tube  racks  in  the  37  oC  waterbath   • 15  mL  Falcon  tubes   • Top  agar  (molten  in  50  oC  waterbath)   • Freshly  prepared  methylene  blue  LB  plates  at  room  temperature   • vortex  mixers   • Biohazard  disposal  bags    Period  3  –  Procedure  For  Plating  your  Phage:   1) Obtain  two  freshly  poured  methylene  blue  LB  plates.    Label  appropriately.   2) Obtain  two  test  tubes  per  bench.    One  is  for  phage  plus  cells  while  the  other  is  for  a  control.    Label   appropriately.    Aseptically,  transfer  0.1  mL  of  E.  coli  LE  392  culture  to  one  tube.   45  
  • 3) To  your  cells  in  the  tube,  add  1/10  of  the  volume  of  your  buffer  (0.01  mL)  containing  the  plaque.   4) Set  up  a  negative  control  containing  E.  coli  only  in  the  same  fashion.   o 5) Place  the  tubes  in  the  37   C  waterbath  and  incubate  here  for  20  minutes.     What  is  the  purpose  of  this  incubation  step?     6) Ensure  you  have  all  supplies  for  plating  close  at  hand.    Aseptically,  add  3  mL  of  top  agar  to  each  tube.       7) Working  quickly,  vortex  briefly  to  mix  phage,  cells  and  top  agar,  then  pour  over  the  surface  of  the  labelled   plate  corresponding  to  the  mixture.    Swirl  the  plate  to  evenly  distribute  the  mixture  over  the  entire  surface.     Do  not  swirl  for  more  than  a  few  seconds!   8) Leave  the  plates  face-­‐up  to  dry.   9) Transfer  the  plates  also  face-­‐up  to  the  labelled  tray  on  the  side  bench.    Plates  will  be  incubated  without   o inversion  for  16-­‐24  hours  at  37   C.    For  Harvesting  Phage:    Note:    One  member  of  each  group  will  be  required  to  come  in  make  observations  and  add  buffer  to  plates  tomorrow  (out  of  regular  lab  time)    Additional  Supplies   • Chloroform  (in  the  fume  hood)  -­‐*  Caution:    Chloroform  is  toxic*   • Falcon  tubes  (polypropylene)   • Shaker  at  4  oC   • 5  mL  pipettes  and  propipettors   • Phage  dilution  buffer   • Pasteur  pipettes  and  bulbs   • 100  µL  and  1  mL  micropipettors  and  sterile  tips   • Biohazard  bags   • Centrifuge  at  4  oC   • Vortex  mixer  in  fume  hood   • Balance  and  beaker    The  day  prior  to  lab:   1) View  your  plates  and  record  observations  for  both  the  control  and  phage  treatments.   2) Aseptically  add  5  mL  of  phage  dilution  buffer  to  the  surface  of  each  plate  containing  phage  and  cells.   3) Place  these  plates  on  the  shaker  at  4  oC  to  shake  gently  overnight.      Period  4  -­‐  Procedure   1)   Using  a  Pasteur  pipette,  transfer  as  much  of  the  liquid  as  possible  into  a  sterile  Falcon  tube.   2)   Move  to  the  fume  hood  and  add  0.1  mL  of  chloroform  to  each  tube.       3)   Vortex  briefly,  then  find  another  group  at  the  same  stage  for  balancing  your  tubes.   4) Balance  your  tubes  to  within  0.1  g  as  follows:       • place  1  tube  in  a  beaker  on  the  balance  pan  and  zero  the  balance   • remove  the  first  tube  and  place  the  second  in  the  beaker.    Note  the  mass.   • adjust  the  volume  in  the  tubes  with  sterile  phage  dilution  buffer  such  that  the  balance  reads    the  same   46  
  • for  both  tubes.       Place  your  tubes  into  the  centrifuge  in  a  balanced  configuration;  ie,  the  2  tubes  balanced  against  each  other   should  be  across  from  each  other.   o 5) Centrifuge  at  4000  g  for  10  minutes  at  4   C.    PART  C  –  HOST  RANGE  AND  PHAGE  TITRE    METHODS  Overnight  cultures  of:   • E.  coli  strains  CSH121  and  CSH125  and  LE  392   • Enterobacter    Other  supplies:  • Phage  dilution  buffer  • Micropipettors  and  sterile  tips  • Autoclave  waste  disposal  • Luria  Methylene  Blue  agar  plates  • LB  plates  • Bottle  of  molten  Luria  agar  overlay  (at  60  oC)  • Sterile  test  tubes  • Test  tube  indicating  4  mL  mark  • Test  tube  rack  • Micropipettor  (100  µL  –  1000  µL)  • Sterile  tips  • Microbiology  kits    For  determining  phage  titre:  1)   Prepare  serial  dilutions  of  your  phage  in  dilution  buffer  (10-­‐2,  10-­‐4,  10-­‐6,  10-­‐8)  in  microfuge  tubes.    Vortex   each  tube  as  you  create  each  dilution.    Ensure  that  you  use  fresh  tips  for  each  transfer.  2)   In  separate,  labeled  sterile  test  tubes,  mix  500  µL  of  each  dilution  (10o,  10-­‐2,  10-­‐4,  10-­‐6,  10-­‐8)  with  500  µL  of   host  strain  E.  coli  LE  392.    Sit  for  20  minutes  of  incubation  time  at  room  temperature.    Mark  the  4  mL  mark   on  each  test  tube  while  mixtures  are  incubating.  3)   Plate  your  mixtures  as  per  Part  A  of  this  exercise.  4)   The  next  day,  count  plaques  and  determine  the  titre  of  your  phage.          For  determining  host  range:  1)   Prepare  spread  plates  on  LB  for  each  organism  to  be  tested.  (use  the  instructions  found  in  Appendix  3,   although  this  should  be  a  review  from  previous  courses).    Label  each  plate  clearly.    Use  100  µL  of  liquid   culture  to  create  a  uniform  lawn.  2)   When  lawns  are  dry,  divide  plates  into  four  quadrants.    Spot  20  µL  of  undiluted  phage,  or  20  µL  of  your     47  
  • -­‐2 -­‐4 -­‐6 o10 ,  10  or  10  dilution  in  each  quadrant.    Do  not  invert.    Plates  will  be  incubated  at  37   C  overnight.    Period  5  -­‐  Procedure  1)   The  next  day,  score  as  +  or  –  for  phage  growth  on  each  host.        Thought  Questions:  • Based  on  the  schematic  found  on  Dr.  Brent  Selinger’s  web  site,  what  step(s)  is/are  most  likely  responsible   for  the  difference  in  coliphage  numbers  between  raw  and  treated  sewage?  • Have  you  isolated  more  than  one  type  of  phage?    How  might  you  be  able  to  tell?  • To  what  components  of  the  bacterial  cell  to  phage  typically  adhere?   48  
  • APPENDIX  1   MICROSCOPY  Compound  Light  Microscope    As  you  label  Figure  1,  your  Instructor  will  review  the  use  of  the  compound  light  microscope  with  you.    Locate  the  ocular  lens  (eyepiece);  there  will  be  one  if  the  microscope  is  monocular,  or  two  if  it  is  binocular.    Then  locate  the  objective  lenses,  the  ones  nearest  the  object  to  be  studied.    These  two  lenses  (ocular  and  objective)  are  connected  by  the  body  tube  of  the  microscope.    The  objective  lenses  (there  will  be  two  or  more,  the  smallest  being  that  with  the  least  magnifying  power,  and  the  largest  being  that  with  the  greatest  magnifying  power)  are  mounted  on  a  revolving  nosepiece  above  a  flat  stage  on  which  the  study  specimen  (slide)  is  placed.              Figure  1:    The  Compound  Microscope    Your  microscope  is  equipped  with  a  mechanical  stage.    This  consists  of  a  clip  to  hold  the  slide  in  place  (the  clip  is  spring-­‐loaded;  the  Instructor  will  demonstrate  how  it  works)  and  two  knobs  at  the  side  of  the  microscope  body  to  move  the  slide  side-­‐to-­‐side,  or  forward-­‐to-­‐back.    Note  also  the  two  micrometer  scales  on  the  mechanical  stage,  which  allow  you  to  note  the  coordinates  of  a  particular  object  on  the  slide  you  are  viewing.       49  
  • Place  a  slide  on  the  stage  and  center  it  over  the  hole  in  the  stage.    Adjust  the  distance  between  the  oculars  to  match  your  interpupillary  distance  (distance  between  your  pupils).    Revolve  the  nosepiece  so  that  the  lowest  power  objective  lens  (generally  the  10x  power  lens)  is  in  position.    To  focus  the  microscope,  locate  the  coarse  and  fine  adjustment  knobs  at  the  base  of  the  microscope,  and  use  the  coarse  adjustment  to  move  the  slide  close  to,  but  not  touching,  the  objective  lens.    Look  at  the  stage  from  the  side  as  you  do  this.    On  most  microscopes  this  involves  raising  the  stage,  but  on  some  the  lenses  are  lowered.    Also,  on  most  microscopes  an  automatic  stop  will  prevent  you  from  moving  the  stage  closer  than  about  one  centimeter  from  the  lens.    Now,  look  through  the  ocular  lenses,  and  move  the  slide  away  from  the  objective  lens  until  the  specimen  becomes  clear  (is  in  focus).    Finish  focusing  with  the  fine  adjustment  knob.    Once  you  have  focused  with  the  low  objective  power  lens,  you  may  switch  over  to  the  next  higher  power  lens  with  only  fine  focus  adjustments  (the  microscope  is  said  to  be  parfocal).    As  you  switch  from  one  objective  lens  to  another,  you  will  notice  that  the  working  distance,  the  clearance  between  lens  and  stage,  decreases  with  increasing  lens  power.    This  is  illustrated  in  Figure  2  below.          Figure  2:    The  working  distance  (above)  and  the  field  of  view  (below)  change  with  magnification  of  objective  lens.    It  should  be  obvious  to  you  why,  on  high  power  objective  lenses  (40x  or  100x),  you  must  use  only  the  fine  focus  knob  to  adjust  focus;  otherwise  the  risk  of  (damaging)  contact  between  lens  and  slide  becomes  great.    Also  illustrated  in  Figure  2  is  the  diminishing  field  of  view  as  objective  lens  power  increases;  this  is  due  to  a  smaller  and  smaller  aperture  at  the  bottom  of  the  lens  through  which  light  enters.    This  means  that  [a]  things  are  harder  to  find  on  a  slide  when  you  are  using  high  power  since  only  a  small  fraction  of  the  slide  can  be  seen,  and  [b]  less  light  enters  your  eye  and  everything  in  the  field  appears  darker.    As  a  consequence,  you  will  learn  to  [a]  switch  back  to  a  lower  power  objective  lens  when  you  want  to  "scan"  around  the  slide,  and  [b]  manipulate  the  amount  of  light  coming  into  the  lens  so  that  you  can  see  the  objects  clearly.   50  
  •  The  amount  and  concentration  of  light  coming  through  the  specimen  and  hence  to  your  eye  can  be  adjusted  in  several  ways.    First,  of  course,  is  the  on/off  light  switch,  generally  located  at  the  base  of  the  microscope,  and  often  associated  with  a  rheostat  to  control  light  intensity.    A  condenser  lens  is  mounted  below  the  stage,  and  concentrates  the  light  on  to  the  specimen;  it  generally  needs  no  adjustment  of  position.  An  iris  diaphragm  is  located  below  the  condenser  lens.    Find  the  lever  which  controls  the  diaphragm;  it  can  be  very  useful  in  adjusting  illumination  and  contrast.      Biology  3200  microscopes  are  binocular,  containing  two  eyepieces.    To  correct  for  the  slight  difference  in  the  focus  of  your  two  eyes,  precisely  fine  focus  a  specimen  using  only  your  one  eye  which  is  at  the  non-­‐focusing  ocular  (if  your  microscope  contains  two  focusing  oculars,  either  may  be  used  to  begin).    Next,  open  the  other  eye  and  bring  the  image  into  focus  for  that  eye  using  only  the  ocular  focus.    Since  other  students  use  these  same  microscopes  during  the  semester,  this  exercise  of  binocular  focusing  should  be  performed  at  the  onset  of  each  microscope  session.    Finally,  some  useful  hints  and  cautions:  • Never  drag  the  microscope  across  the  counter-­‐top.    Lift  it  with  both  hands  by  its  arm,  being  careful   not  to  tip  it.  • Use  lens  paper  to  clean  glass  slides  and  lens  surfaces  before  using  your  microscope.  • Water  damages  objective  lenses;  if  water  does  contact  a  lens,  wipe  it  off  immediately.    Also  avoid   getting  water  under  the  slide  as  it  will  stick  to  the  stage.  • If  you  have  used  immersion  oil,  use  lens  paper  dipped  in  60  %  ethanol  to  remove  it  from  the  100x   objective  lens  when  you  are  finished.  • Always  start  the  focusing  procedure  with  low  (10x)  power  lens.  • When  attempting  to  locate  an  object  on  a  slide,  remember  that  the  image  you  see  is  reversed;  that   is,  as  you  move  the  slide  toward  you  on  the  stage,  the  slide  is  apparently  moving  away  from  you  as   you  view  it  through  the  lens.  • Some  ocular  lenses  are  equipped  with  pointers;  they  appear  as  a  dark  black  line  that  will  rotate  if   the  lens  is  rotated  in  its  tube.    Phase  Contrast  Microscope    Tips  for  use:  • Prepare  a  wet  mount  slide,  place  it  on  the  stage,  and  find  and  focus  on  the  cells  using  brightfield   optics  at  a  low-­‐power  magnification.  • Once  the  image  is  in  focus,  move  to  the  next  highest  magnification.    Switch  to  phase  optics  that   match  your  objective  lens  (coding  is  present  on  the  objective  lenses)  by  rotating  the  disc  underneath   the  stage.  • The  use  of  phase  contrast  requires  much  more  illumination  as  much  of  the  light  is  lost  as  it  passes   through  the  phase  ring.    Increase  the  amount  of  light  hitting  the  specimen  once  you  switch  to  phase.  • Switch  to  higher  magnifications  in  the  same  way  that  you  would  for  brightfield  optics,  but  remember   to  rotate  the  annular  stop  corresponding  to  the  objective  lens  into  position  each  time.     51  
  • APPENDIX  2   PREPARATION  OF  SCIENTIFIC  DRAWINGS  • Use  a  sharpened  pencil;  never  ink.    The  lead  should  be  hard.• Place  drawing  to  one  side,  usually  the  left,  leaving  room  for  labels  to  the  right.  • Try  to  draw  with  one  continuous  line  and  do  not  retrace  your  lines.    Do  not  shade.  • Place  label  lines  horizontally  (use  a  ruler),  with  no  crossed  lines.  • Objects  labelled  should  be  singular  unless  label  line  branches  to  multiple  objects.  • Label  only  what  you  see,  not  what  you  think  should  be  seen.  • Below  the  figure  you  should  add:   • The  title  of  the  diagram   • The  magnification  of  the  drawing  (see  below)  • The  magnification  of  the  diagram  gives  you  the  relationship  between  the  size  of  your  diagram  and  the   actual  size  of  the  specimen.    A  diagram  of  a  cell  would  be  much  larger  than  the  actual  cell,  whereas  a   diagram  of  an  elephant  could  be  much  smaller  than  the  actual  elephant.     • Magnification  is  defined  as:   size  of  drawing             actual  size  of  specimen  Where:   • size  of  the  drawing  is  measured  with  a  ruler   • actual  size  of  specimen  is  determined  by  one  of  the  methods  in  Exercise  1.   • the  number  calculated  has  as  many  significant  figures  as  the  accuracy  of  your  measurement   (usually  2,  if  you  measure  in  mm)   52  
  • • Example  of  a  drawing:                                    Figure  1.    A  chain  of  Bacillus  subtilis  cells  stained  with  methylene  blue  (23  000x)     • Notice  that  in  the  figure,  enough  organisms  are  shown  such  that  the  arrangement  can  be  seen.   • Drawing  magnification  is  calculated  based  on  length  or  width,  not  both  of  only  one  of  the   organisms  (not  the  whole  chain).   • Figures  are  given  numbers  -­‐  Figure  1,  Figure  2,  etc.   • As  much  detail  as  possible  is  provided  in  the  title  (eg  Gram  reaction  seen,  type  of  stain  used,  type   of  organism  etc.).   53  
  • APPENDIX  3   ASEPTIC  TECHNIQUE  A.   Aseptic  Technique    Much  microbiological  work,  and  to  some  extent  biochemical  work,  depends  on  the  maintenance  of  pure  cultures  of  microorganisms.    Therefore,  there  are  various  essential  precautions  that  MUST  be  observed  to  exclude  unwanted  organisms.    Accidental  contamination  may  ruin  your  results  completely.    Aseptic  technique  is  largely  a  matter  of  common  sense,  but  it  is  essential  to  realise  that  bacterial  and  fungal  spores  are  present  everywhere,  and  a  high  standard  of  technique  must  be  attained.    Correct  methods  of  handling  cultures  and  apparatus  will  be  demonstrated.    These  methods  must  be  followed.    Consider  carefully  and  remember  the  following  points:    1.   Clean  air  contains  many  bacterial  and  fungal  spores  carried  on  dust  particles  or  in  water  droplets.     Any  surface  exposed  to  air  quickly  becomes  contaminated,  and  if  material  is  to  be  kept  sterile  it   should  be  exposed  only  as  much  as  is  absolutely  necessary  for  manipulation.    Instruments  which  can   be  sterilised  by  heating  in  a  bunsen  flame  (e.g.  inoculating  loops)  can  be  left  exposed,  but  they  must   be  flamed  thoroughly  before  use,  and  again  before  being  replaced  in  the  holder.       Items  of  equipment  that  cannot  be  treated  in  this  way  (e.g.  pipettes)  are  sterilised  in  wrappings  or   containers  from  which  they  must  not  be  removed  until  actually  needed.    They  must  not  be  allowed  to   touch  unsterile  surfaces  during  use.    Plugs  and  caps  of  tubes  and  bottles  must  not  be  laid  on  the   bench  nor  must  sterile  containers  be  left  open  to  collect  falling  dust.    2.   Clothes,  hair,  skin  and  breath  all  carry  a  heavy  microbial  load  and  where  strict  asepsis  is  essential,   sterilized  gowns,  caps,  gloves  etc.  are  worn.    Even  in  normal  microbiological  work  care  must  be  taken   to  prevent  contamination  from  the  above  mentioned  sources.    A  clean  laboratory  overall  is  advised   for  all  lab  work.       Microbial  contamination  in  the  lab  is  most  often  due  to  currents  of  unsterile  air.    The  chief  merit  of   inoculation  chambers  and  screens  therefore  lies  in  the  protection  they  give  from  drafts.    This   protection  can  be  supplemented  by  keeping  all  windows  and  doors  shut  and  by  cutting  down   personal  movement  within  the  laboratory.    These  precautions  can  be  offset  by  careless  use  of   burners  that  create  convection  currents.    3.   Before  any  operation  is  started,  all  necessary  materials  should  be  assembled  in  convenient  order  with   provision  for  protecting  sterile  objects  until  needed,  and  for  disposing  of  used  apparatus  (so  as  not  to   contaminate  other  material).       54  
  •     B.   Aseptic  Culture  Manipulation    Purposes:     1)   To  prevent  the  contamination  of  the  environment  and  people  working  in  the  laboratory     from  the  cultures  used  in  the  exercises     2)   To  prevent  accidental  contamination  of  cultures  of  microorganisms  and  of  solutions  and   equipment  used  in  the  laboratory     Correct  methods  of  handling  cultures  and  apparatus  will  be  demonstrated.    These  methods  must  be   followed.    Consider  carefully  and  remember  the  following  points:     • Prior  to  starting  any  work  in  the  laboratory,  wash  hands  with  soap,  and  wash  down  bench  area   using  10%  bleach.    This  procedure  should  be  repeated  after  the  lab  is  complete.     • Avoid  working  on  your  lab  book  or  lab  notes.     • Clean  laboratory  coats  must  be  worn.    If  you  have  long  hair,  tie  it  back  before  working  in  the   laboratory  environment.     • Eating  or  drinking  is  not  permitted  in  the  laboratory.    Do  not  place  pencils,  fingers  or  anything   else  in  your  mouth.     • Clean  air  contains  many  bacteria  and  fungal  spores  carried  on  dust  particles  or  in  water  droplets.     Any  surface  exposed  to  air  quickly  becomes  contaminated.    If  material  is  to  be  kept  sterile,  it   should  be  exposed  only  as  much  as  is  absolutely  necessary  for  manipulation.     Plugs  and  caps  of  tubes,  tops  of  Petri  dishes  and  bottles  of  solutions,  (even  water!!)  must  not  be  laid  on   the  bench  nor  must  sterile  containers  and  cultures  be  left  open  and  exposed  to  the  air.     Inoculation  of  Culture  Tubes     Again,  the  important  thing  to  remember  is  that  exposure  of  sterile  liquids  or  bacterial  cultures  to  air  must   be  minimised.     -­‐Ensure  that  you  have  the  tubes,  plate  of  inoculum,  inoculating  loop  and  a  sterile  tube  of  medium   available  within  easy  reach.     -­‐Flame  the  inoculating  loop  until  red  hot.    When  removing  inoculum  from  a  tube,  remove  the  cap  from   the  tube  by  grasping  the  cap  between  the  last  finger  and  the  hand  which  is  also  holding  the  inoculating   needle  (Figure  1).    Do  not  place  the  cap  on  the  bench!!           55  
  •        Figure  1:    Technique  for  manipulating  test  tubes  aseptically.    -­‐Flame  the  mouth  of  the  tube  by  passing  it  rapidly  through  the  Bunsen  burner  2-­‐3  times.    This  sterilises  the  air  in  and  immediately  around  the  mouth  of  the  tube.  -­‐Cool  the  loop  on  the  inside  of  the  tube,  remove  the  inoculum.  -­‐Reflame  the  mouth  of  the  tube  and  replace  the  cap  -­‐Flame  the  inoculating  loop  before  replacing  -­‐Note,  when  removing  inoculum  from  a  plate,  cool  the  loop  in  the  agar  before  picking  up  the  bacteria    Streaking  for  Single  Colonies    -­‐A  loop  of  liquid  culture  or  a  small  amount  of  bacterial  growth  from  a  plate  culture  is  transferred  aseptically  to  a  sterile  plate  in  the  area  shown  by  Figure  2A.  -­‐Once  the  first  set  of  streaks  has  been  made,  the  inoculating  loop  is  reflamed  until  red  hot.    DO  NOT  REINTRODUCE  THE  LOOP  INTO  THE  ORIGINAL  CULTURE!!!  -­‐Cool  the  loop,  and  make  a  second  set  of  streaks  as  shown  in  Figure  2B,  only  crossing  over  the  initial  set  of  streaks  once.  -­‐Flame  the  loop  again,  cool,  and  repeat  for  three  more  sets  (Figure  2C).    Note,  try  not  to  gouge  the  agar  while  streaking  the  plate.     56  
  •    Figure  2:  How  to  prepare  a  streak  plate.      Preparation  of  Spread  Plates:    Generally,  volumes  of  culture  greater  than  100  µL  are  NOT  plated  as  it  takes  too  long  for  the  liquid  to  dry.    • Use  aseptic  technique  to  obtain  100  µL  of  culture  and  place  in  the  middle  of  a  plate  of  medium.  • Use  a  sterile  glass  spreader  (this  may  involve  dipping  a  spreader  into  a  beaker  of  alcohol  and  waving  it   through  a  Bunsen  Burner  flame.    If  this  is  the  case,  DO  NOT  hold  the  spreader  in  the  flame  and  avoid   tipping  the  spreader  so  that  flaming  alcohol  runs  over  your  hand.    Once  the  flame  has  burnt  out,  the   spreader  is  ready  to  use).  • Use  the  same  hand  that  holds  the  spreader  to  lift  the  lid  of  the  plate  and  keep  it  just  above  the  plate   the  entire  time.  • Gently  touch  the  spreader  to  the  side  of  the  medium  (not  directly  in  the  culture  in  case  the  spreader   is  still  a  bit  warm).    Smooth  the  culture  evenly  over  the  surface  of  the  plate  ensuring  that  you  cover   the  entire  plate.  • Invert  the  plates  and  place  in  the  incubator  when  dry.   57  
  •    C.    Sterilization    Media  must  be  sterilised  after  distribution  into  tubes,  flasks  or  bottles.    Sterilised  media  may  later  be  transferred  aseptically  to  previously  sterilised  containers,  but  this  should  only  be  done  when  really  necessary,  e.g.  in  preparing  "plate"  cultures,  since  some  risk  of  contamination  is  unavoidable.    Methods  of  Sterilization    1.   Most  media  (including  agar)  can  be  sterilised  by  treatment  with  steam  under  pressure  in  an   autoclave,  the  usual  treatment  being  15-­‐20  minutes  at  a  pressure  of  two  atmospheres.    This   raises  the  steam  temperature  to  121°C.    When  using  an  autoclave,  the  water  should  be  allowed   to  boil,  and  the  steam  to  fill  the  autoclave  before  shutting  the  valve.    This  allows  the  material  to   heat  up  and  ensures  that  the  correct  steam  pressure  is  attained.    Never  overfill  an  autoclave   since  this  will  upset  the  pressure/volume  relationship  and  the  correct  temperature  will  not  be   attained.    Materials  that  might  be  adversely  affected  by  this  treatment  may  sometimes  be   treated  for  a  short  time  or  at  a  lower  temperature,  but  this  will  not  be  effective  if  the  material  is   heavily  contaminated  to  begin  with.    Screw  caps  on  bottles  must  be  left  slightly  open  during   sterilisation  and  screwed  down  on  removal  from  the  steriliser.    2.   Media  that  are  difficult  or  impossible  to  autoclave  satisfactorily,  e.g.  gelatin  media  and  some   sugar  media,  may  be  sterilised  by  intermittent  steaming.    Objects  to  be  sterilised  are  heated  over   boiling  water  in  a  steamer  (steam  temperature  85°-­‐95°C)  for  15-­‐20  minutes  on  each  of  three  or   more  successive  days.    Time  must  be  allowed  for  the  medium  to  reach  the  same  temperature  as   the  steam.    Between  treatments  the  material  must  be  kept  at  a  temperature  allowing  spores  to   germinate  (30°-­‐37°C)  and  so  lose  their  heat  resistance.    3.   It  is  often  necessary  to  sterilise  some  ingredients  of  a  medium  separately  and  to  add  them  to  the   rest  of  the  medium  before  use.    Heat-­‐labile  ingredients,  e.g.  urea,  serum,  etc.  must  be  sterilised   by  filtration  through  a  bacteria-­‐proof  filter,  i.e.  Seitz  filters  or  membrane  filters.    4.   Dry  glassware,  e.g.  glass  petri  dishes,  empty  flasks,  pipettes  may  be  sterilised  in  the   autoclave  and  then  dried  or  may  be  sterilised  in  a  hot  air  oven.    Any  oil  material  must  also  be   sterilised  in  a  hot  air  oven.    The  minimum  effective  treatment  is  1  hour  at  150°C.    This  should   be  increased  to  160°C  or  the  time  of  heating  prolonged  to  2  or  3  hours  wherever  possible.     58  
  •  APPENDIX  4   THE  CULTIVATION  OF  BACTERIA  In  order  to  grow,  microorganisms  require  a)  water,  b)  macronutrients  eg.  –  C,  N,  K,  P,  S,  Mg,  Ca,  Na,  and  Fe  c)  micronutrients  (trace  elements)  eg.  -­‐    Fe,  W,  Zn  and  d)  growth  factors  –  vitamins,  amino  acids,  purines  and  pyrimidines.        In  general,  wild-­‐type  organisms  are  termed  prototrophs.    An  auxotroph  is  a  nutritional  mutant,  unable  to  synthesise  an  essential  component  for  growth  from  precursors.    Note  that  this  essential  component  is  normally  synthesised  by  the  wild-­‐type  or  prototrophic  strains  of  the  same  species.    Scientists  study  and  manipulate  nutritional  requirements  of  bacteria  or  yeast  using  minimal  media.    Minimal  or  defined  media  are  those  in  which  the  exact  chemical  composition  of  all  ingredients  is  known.  A  medium  where  the  exact  chemical  composition  is  not  known  is  termed  complex.    Complex  media  are  preferred  as  they  are  generally  easier  to  prepare  than  minimal  media,  they  result  in  high  levels  of  growth,  and  are  useful  when  exact  nutritional  requirements  of  an  organism  are  not  known.      Nutritional  Classification:    The  nutritional  classification  of  organisms  is  based  on  three  parameters:    the  energy  source,  the  principal  carbon  source  and  the  source  of  reducing  power.    With  respect  to  energy  source,  phototrophs  are  photosynthetic  organisms  that  use  light  as  their  energy  source  and  chemotrophs  are  organisms  that  depend  on  a  chemical  energy  source.    Organisms  able  to  use  CO2  as  a  principal  carbon  source  are  autotrophs.    Heterotrophs  depend  on  an  organic  carbon  source.    To  designate  the  source  of  reducing  power,  the  term  lithotroph  or  organotroph  is  applied.    Lithotrophs  use  inorganic  compounds  as  their  source  of  reducing  power,  and  organotrophs  use  organic  compounds  as  their  source  of  reducing  power.  To  summarise:                                       source  of               energy  source             carbon  source               reducing  power  photoautotroph   light       CO2       inorganic  (photolithotroph)                 oxidizable                     substrate  photoheterotroph   light         organic       organic  (photoorganotroph)  chemoautotroph     chemical  (oxidation  of     CO2       inorganic  (chemolithotroph)*   reduced  inorganic         compounds  e.g.  NH3,         NO2-­‐  and  H2)  chemoheterotroph   chemical     organic       organic  (chemoorganotroph)    *All  chemoautotrophs  are  chemolithotrophs,  but  not  all  lithotrophs  are  autotrophic.    For  example,  the  methylotrophic  bacteria  can  use  organic  carbon  as  their  carbon  source.     59  
  • Common  Media  Constituents:    Energy  or  Carbon  sources:   • Sugars,  alcohols,  carbohydrates  and  amino  acids   • Found  in  infusions  –  for  instance  –  beef  infusion   • Found  in  extracts  –  for  instance  –  yeast  extracts   • Also  found  in  peptones  (see  below)    Nitrogen  sources:   • Inorganic  sources  such  as  ammonia  or  nitrate   • Nitrogen  fixing  organisms  use  atmospheric  N2   • Extracts,  infusions   • Peptone  –  hydrolysis  of  proteins  produces  mixtures  of  short-­‐chains  of  amino  acids  (peptides).     Sources  of  peptones  may  include  meat,  fish,  blood,  or  soybeans   • Tryptone  –  pancreatic  digestion  of  casein    Other  Macronutrient  Source  Examples:   • MgSO4   • CaCl2   • Potassium  salts    Micronutrient  Sources:   • May  not  be  necessary  to  add  as  these  are  required  in  such  small  concentrations.    Growth  Factors:   • Some  organisms  are  able  to  synthesise  all  growth  factors  from  precursors.    Other  organisms   require  these  compounds  already  synthesised   • For  example  –  thiamine,  biotin    Buffering  Components  Buffers,  which  prevent  large  changes  in  pH,  are  often  required  to  facilitate  growth.    This  is  particularly  true  of  media  composed  of  simple  compounds  or  in  which  acid-­‐producing  bacteria  are  cultivated.    Mixtures  of  sodium  and  potassium  phosphates  are  often  employed.    In  complex  media,  buffering  is  provided  by  the  peptides  and  amino  acids.    Gelling  Agents    For  a  solid  medium,  agar,  a  water  soluble  polysaccharide,  is  added  to  the  medium.    First  discovered  in  1658  in  Japan,  agar  was  first  used  for  microbiological  purposes  by  R.  Koch  in  1882.    It  is  extracted  from  members  of  Class  Rhodophyceae  (a  group  of  red-­‐purple  marine  algae).    Agar  is  particularly  suited  to  microbial  propagation  because:   60  
  • • It  lacks  metabolically  useful  chemicals  such  as  peptides  and  fermentable  carbohydrates  (it  cannot   be  broken  down  by  bacterial  enzymes)   o • It  melts  at  a  high  enough  temperature  (85   C)  to  support  growth  of  different  temperature   requiring  microbes   • It  lacks  bacterial  inhibitors    Below  are  two  examples  of  media  used  for  cultivation  of  microbes.    TY  is  an  example  of  a  complex  medium  whereas  VMM  is  an  example  of  a  minimal  or  defined  medium:     TY  Agar    (used  for  the  cultivation  of  organisms  such  as  Rhizobium  leguminosarum,  Pseudomonas   fluorescens)   As  with  most  complex  media,  ingredients  for  TY  are  weighed  out,  1  L  of  water  is  added,  and  the   o mixture  autoclaved.    After  cooling  slightly  to  approximately  60   C,  TY  medium  is  poured  into  Petri   dishes.     Ingredient   Amount  (/L)   Source  of?   Tryptone   5.0  g   Macronutrients  (primarily   nitrogen,  also  carbon  and   growth  factors  in  the  form  of   amino  acids)   Yeast  Extract   3.0  g   Macronutrients  (primarily   carbon,  also  nitrogen  and   growth  factors)   CaCl2   0.5  g   Macronutrients   MgSO4   0.1  g   Macronutrients   Agar   20  g   Gelling  agent    For  the  next  example  –  VMM  –  three  different  mixtures  (Solutions  A,  B  and  C)  of  ingredients  are  made  up  separately,  autoclaved  separately,  and  then  combined.    Finally,  a  carbon  source  is  added  just  prior  to  pouring.   61  
  • VMM  (Vincent’s  Minimal  Medium  -­‐  Vincent,  1970)  (used  for  the  study  of  nutritional  requirements  of   Rhizobium  leguminosarum)  Solution  A:   Compound   Amount  (/L)   Source  of?   K2HPO4   1.0  g   Buffering  agent/   Macronutrients   KH2PO4   1.0  g   Buffering  agent/Macronutrients   KNO3   0.6  g   Macronutrients  (nitrogen  in   particular)   For  Solid  Medium:    Agar   12.5  g   Gelling  agent    Solution  B  (10x):   Compound   Amount  (/L)   Source  of?   FeCl3   0.1  g   Macro/Micronutrients   MgSO4   2.5  g   Macronutrients   CaCl2   1.0  g   Macronutrients  Autoclave  and  add  to  a  final  concentration  of  1x    Solution  C  (100x)   Compound   Amount  for:    1  L   Source  of?   Biotin   0.01  g   Growth  factors   Thiamine   0.01  g   Growth  factors   Calcium  Pantothenate   0.01  g   Growth  factors  Autoclave  and  add  to  a  final  concentration  of  1x.    Carbon  sources:    Depending  on  the  organism  studied,  a  variety  of  carbon  sources  may  be  added.    For  instance,  when  studying  genes  required  for  catabolism  of  a  certain  carbon  source,  a  scientist  will  often  first  create  a  mutant  or  auxotroph  unable  to  catabolise  that  carbon  source.    To  confirm  presence  of  the  mutation,  it  is  necessary  to  plate  the  putative  auxotroph  on  medium  containing  the  carbon  source  of  interest,  and  plating  on  a  medium  containing  a  carbon  source  that  the  organism  is  able  to  utilise.    In  Rhizobium  leguminosarum,  some  examples  of  carbon  sources  that  are  useful  for  these  types  of  experiments  are  mannitol,  sorbitol  (both  are  sugar  alcohols),  or  rhamnose.    Each  carbon  source  is  prepared  as  a  stock  solution,  filter  sterilised,  and  added  to  a  final  concentration  of  0.4%    (w/v).    Oxygen  Requirements  of  Microorganisms.    Many  species  of  bacteria  are  facultative  aerobes,  i.e.  they  can  grow  under  aerobic  or  anaerobic  conditions,  the  latter  ability  being  dependent  upon  the  presence  of  some  substance  that  can  be  utilised  as  an  electron  acceptor  by  the  species  concerned.    Some  bacteria  are  obligate  aerobes,  unable  to  use  anything  but  oxygen  as  a  final  electron  acceptor.    Others  are  obligate  anaerobes  that  cannot  use  oxygen  as  an  electron  acceptor.    A  few  bacteria  are  somewhat  intermediate,  growing  best  in  low  oxygen  tensions.    These  are  called  microaerophilic  bacteria.  During  growth  in  liquid  culture,  microorganisms  tend  to  utilise  all  available  oxygen  and  so  reduce  the  medium.    Thus,  the  oxidation-­‐reduction  potential  (Eo)  of  the   62  
  • medium  may  become  low  enough  to  allow  anaerobic  growth  to  occur.    One  example  of  this  is  found  in  the  fermentation  of  sugar  to  produce  alcohol  by  yeast  (Exercise  8  part  C).    Unless  the  mixture  is  stirred  frequently,  the  little  oxygen  available  in  the  grape  juice  solution  is  utilised  rapidly  by  the  growing  culture.    Organisms  then  switch  to  anaerobic  growth.    In  order  to  sample  material  containing  anaerobes,  specimens  must  be  obtained  and  immediately  placed  into  an  environment  containing  an  oxygen-­‐free  gas  and  an  indicator  that  changes  colour  when  oxidised  to  indicate  when  oxygen  has  contaminated  the  sample.    Organisms  may  then  be  cultured  in  sealed  jars  containing  gas  mixtures  of  N2  and  CO2  or  even  by  cultivation  in  an  anaerobic  chamber.    Temperature  Requirements  of  Microorganisms    Cultures  should  be  incubated  at  the  temperature  most  favourable  to  growth  or  the  specific  activity  being  studied.    Human  pathogens  and  commensal  species  grow  best  at  body  temperature,  i.e.  37°C.    Soil  organisms  and  plant  pathogens  are  normally  incubated  at  20-­‐30°C.    The  optimum  temperature  is  that  temperature  at  which  the  growth  rate  is  maximal  for  a  particular  organism.    Note  that  for  every  organism,  there  is  also  a  minimum  temperature  below  which  no  growth  occurs,  and  a  maximum  temperature,  above  which  no  growth  occurs.    The  terms  used  to  describe  microorganisms  according  to  their  temperature  requirements  are  as  follows:     • thermophiles  require  temperatures  of  45°C-­‐65°C     • extreme  thermophiles  (which  are  usually  archaebacteria)  will  grow  at  temperatures  above  65°C.   • mesophiles  grow  best  at  temperatures  of  20°C-­‐45°C.   • psychrophiles  require  low  temperatures  -­‐  below  15°C.    References:    Difco  Manual.    1998.    Difco  Laboratories,  Division  of  Becton  Dickinson  and  Company,  Maryland.    Madigan,  M.  T.,  Martinko,  J.  M.,  and  Parker,  J.  2003.  Brock  Biology  of  Microorganisms  10th  Edition.  Prentice-­‐Hall  Canada  Inc.,  Toronto.    Ross,  H.  1992/3.  Microbiology  241  Lab  Manual.  University  of  Calgary  Press,  Calgary.     63  
  • APPENDIX  5   BACTERIAL  OBSERVATION  Bacterial  genera  may  be  differentiated  in  two  ways:  1)   by  the  cellular  morphology  which  is  observed  microscopically  2)   by  the  colony  morphology  which  is  observed  on  a  plate  culture    Cellular  Morphology  includes:  1)   Shape:    rods,  cocci,  spirilli  2)   Size  (in  µm):    diameter  (cocci);  lengthxwidth  (rods)  3)   Typical  arrangement  of  the  cells:    chains,  clusters,  pairs,  random  4)   Gram  reaction  A  diagram  drawn  to  scale  accompanies  the  cellular  morphology.    Colony  Morphology  is  that  of  a  single  isolated  colony  on  the  plate,  not  the  morphology  of  the  entire  bacterial  growth  on  the  plate.    Colony  morphology  is  influenced  by  medium  composition;  type  of  medium  organism  is  grown  on  (defined,  complex,  specific  type)  should  be  noted  in  conjunction  with  the  description  of  colony  morphology.  The  following  characteristics  are  those  most  commonly  used  to  describe  colony  morphology:    1)   Shape  or  form      Circular   Irregular  Rhizoid   Filamentous   Punctiform  (1mm  or  less                     in  diameter)    2)   Surface:    smooth/rough;  mucoid/moist/dry/powdery    3)   Elevation:      Flat     Raised     Convex     Umbonate   Umbilicate    4)   Size:    measure  a  single  colony  with  a  ruler  5)   Pigment:    cream,  white  or  beige  coloured  organisms  are  usually  considered  to  be  non-­‐ pigmented.    Pigments  may  be  purple,  red,  pink,  yellow,  brown,  blue,  grey,  etc.    Water  soluble   pigments  diffuse  into  the  medium.  6)   Opacity:    Transparent  (can  see  through)  or  opaque.     64  
  • APPENDIX  6   LABORATORY  REPORTS  Lab  reports  shall  be  in  the  style  of  scientific  papers  published  in  refereed  journals.    This  scientific  style  is  relatively  similar  across  journals  although  specific  formats  vary,  including  the  form  of  literature  citations.    The  journals  Microbiology  or  Canadian  Journal  of  Microbiology  will  be  used  as  models  for  the  specific  format  of  Biology  3200  reports.      Please  do  not  use  formats  from  journals  such  as  Nature  or  Proceedings  of  the  National  Academy  of  Sciences  as  this  will  result  in  loss  of  marks.    For  detailed  information  on  preparation  of  scientific  reports,  please  refer  to  the  Biology  3200  web  site.    The  text  should  be  in  prose  form  and  standard  rules  of  grammar  apply.    Check  spelling,  including  technical  terms  and  names  of  bacterial  species  which  are  italicised  or  underlined;  for  instance,  Escherichia  coli  or  Escherichia  coli.    The  reports  shall  be  double-­‐spaced,  single-­‐sided  and  typed.    Staple  the  report  together  and  do  not  submit  it  in  a  cover.      The  reports  shall  contain  the  normal  components  of  a  scientific  paper  including:    Title  -­‐  the  title  should  identify  the  experimental  topic  as  completely  as  possible.        Abstract  -­‐  the  abstract  is  an  abbreviated  version  of  the  complete  report.    Typically  containing  no  more  than  250  words,  the  abstract  picks  out  the  highlights  of  the  introduction,  methods,  results  and  discussion.    The  abstract  should  be  complete  enough  that  it  can  be  removed  from  the  report  and  will  still  provide  a  meaningful  description  of  the  study.    Introduction  -­‐  The  introduction  serves  to  (i)  provide  background  information  and  a  description  of  what  is  known  prior  to  the  study,  and  (ii)  offer  a  justification  for  the  study.    This  justification  describes  why  the  experiment  was  performed  -­‐  how  does  it  fit  into  science  and  are  there  any  applied  aspects  of  the  knowledge  (i.e.  is  it  relevant  to  medicine,  agriculture  or  other  disciplines).    Relevant  literature  is  used  and  cited.    Methods  -­‐  The  methods  or  Materials  and  Methods  describes  the  materials  involved  in  the  study,  including  biological  materials  (bacteria,  etc.),  and  outlines  the  procedures  used  in  the  study.  Reference  must  be  made  to  this  laboratory  manual  (Pacarynuk  and  Danyk,  2004).    Other  references,  the  text  by  Madigan  et.  al.,  (2003),  or  other  published  materials  may  be  cited.    Global  referencing  (“All  of  the  following  methods  are  taken  from…”)  should  be  avoided.    The  methods  section  should  be  adequate  for  the  reader  to  completely  understand  what  was  done  and  also  to  be  able  to  repeat  fully  the  study.    Results  -­‐  The  results  describe  the  observations  or  experimental  outcomes,  providing  figures,  tables  or  other  data  as  suitable.  This  section  answers  the  question  “What  Happened?”    The  author  should  decide  what  is  the  most  suitable  format  for  experimental  information  and  draft  the  report  accordingly.    Figures  may  include  drawings  that  should  be  in  pencil.    Graphs  or  other  figures  may  also  be  included  as  appropriate.  Experimental  results  should  be  presented  only  once.    If  information  is  presented  in  a  figure  then  it  should  not  be  repeated  in  a  table.    Each  figure  and  table  must  have  a  caption  which  is  complete  enough  that  the  figure  and  caption  can  be  removed  from  the  report  and  still  be  understandable.      Figures   65  
  • and  tables  must  be  referred  to  in  the  text  and  described  so  that  if  the  reader  did  not  have  the  figure  or  table,  trends  or  highlights  of  the  results  would  still  be  evident.    Never  include  a  figure  or  table  without  referring  to  it  and  describing  it;  to  do  so  will  result  in  loss  of  marks.      Avoid  evaluating  or  interpreting  your  results  in  this  section.    Discussion  -­‐  The  discussion  should  refer  to  concepts  or  questions  posed  in  the  introduction  and  relate  these  concepts  from  the  literature  to  the  results.    Do  not  restate  the  results  in  this  section.    Your  discussion  will  be  graded  based  on  your  evaluation  of  the  results  with  respect  to  the  literature.  Any  time  you  use  information  from  another  source,  it  must  be  immediately  cited  within  the  text.    Failure  to  do  this  constitutes  plagiarism  and  may  result  in  a  mark  of  zero  being  assigned  for  the  entire  document.    For  examples  of  how  to  cite  properly,  refer  to  peer-­‐reviewed  journal  articles  in  Microbiology  or  Canadian  Journal  of  Microbiology.    Never  include  quotations,  such  as  phrases  from  the  course  text  or  this  lab  manual.    Direct  quotes  are  inappropriate  in  scientific  writing.    Always  introduce  relevant  concepts  using  your  own  wording  and  then  cite  using  the  format  found  in  Microbiology  or  in  Canadian  Journal  of  Microbiology.    Literature  Cited  –  This  section  only  includes  references  cited  within  the  body  of  the  text.    Again,  use  the  format  found  in  Microbiology  or  the  Canadian  Journal  of  Microbiology.      References  will  include  journal  papers,  books  and  most  likely,  Holt  (1989)  or  Holt  (1994)  (Bergey’s  Manual  of  Systematic  Bacteriology).      It  is  important  to  note  that  Bergey  did  not  write  Bergey’s  Manual  of  Systematic  Bacteriology;  the  proper  formats  for  referencing  are  as  follows:    Holt,  J.  G.  (editor-­‐in-­‐chief).  Bergey’s  Manual  of  Systematic  Bacteriology,  Vol.  I,  1984;  vol.  II,  1986;  vols,  III  and  IV,  1989.  Williams  and  Wilkins,  Baltimore.    Holt,  J.  G.  (editor-­‐in-­‐chief)  (1994).  Bergey’s  Manual  of  Determinative  Bacteriology,  9th  edition.  Williams  and  Wilkins,  Baltimore.   66  
  • APPENDIX  7   USE  OF  THE  SPECTROPHOTOMETER  Many  procedures  for  the  quantitative  analysis  of  compounds  in  biological  fluids  are  based  on  the  fact  that  such  compounds  will  selectively  absorb  specific  wavelengths  of  light.    For  example,  a  solution  that  appears  red  to  us  (such  as  blood)  absorbs  the  blue  or  green  colours  of  light,  while  the  red  is  reflected  to  our  eyes.    The  eye,  however,  is  a  poor  quantitative  instrument,  and  what  appears  bright  red-­‐orange  to  one  person  may  appear  dull  red-­‐purple  to  another.  A  spectrophotometer  is  one  instrument  that  will  objectively  quantify  the  amount  and  kinds  of  light  that  are  absorbed  by  molecules  in  solution.    A  source  of  white  light  is  focused  on  a  prism  to  separate  it  into  its  individual  bands  of  radiant  energy  (Figure  1).    One  particular  wavelength  is  selected  to  pass  through  a  narrow  slit  and  then  through  the  sample  being  measured.    The  sample,  usually  dissolved  in  a  solvent,  is  contained  in  an  optically  selected  tube  or  cuvette,  which  is  standardized  for  wall  thickness  and  has  a  light  path  exactly  one  centimeter  across  (these  tubes  are  therefore  expensive!).      Figure  1.    A  photoelectric  spectrophotometer.    After  passing  through  the  sample,  the  selected  wavelength  of  light  strikes  a  photoelectric  tube.    If  the  substance  in  the  cuvette  has  absorbed  any  of  the  light,  the  light  transmitted  out  the  far  side  will  then  be  reduced  in  total  energy  content.    When  it  hits  the  photoelectric  tube,  it  generates  an  electric  current  proportional  to  the  intensity  of  the  light  energy  striking  it.    By  connecting  the  photoelectric  tube  to  a  device  that  measures  electric  current  (a  galvanometer),  a  means  of  directly  measuring  the  intensity  of  the  light  is  achieved.    The  galvanometer  has  two  scales:  one  indicates  the  %  transmittance,  and  the  other,  a  logarithmic  scale  with  unequal  divisions  graduated  from  0.0  to  2.0,  indicates  the  absorbance.    Zeroing  the  Spectrophotometer  Because  most  biological  molecules  are  dissolved  in  a  solvent  before  measurement,  a  source  of  error  can  be  the  absorption  of  light  by  the  solvent.    To  assure  that  the  spectrophotometric  measurement  will  reflect   67  
  • only  the  light  absorption  of  the  molecules  being  studied,  a  mechanism  of  "subtracting"  the  absorbance  of  the  solvent  is  necessary:  1)   Align  the  needle  to  0  on  the  transmittance  scale  using  the  knob  on  the  left  hand  side  of  the   machine  (as  you  face  the  machine).    Note,  this  step  should  be  performed  prior  to  placing  any   tubes  into  the  machine.      2)   Insert  the  reagent  "blank"  (the  solvent)  into  the  instrument,  and  align  the  needle  to  0  on  the   absorbance  scale  using  the  knob  on  the  right  hand  side  of  the  machine  (as  you  face  the   machine).   1) The  sample,  containing  solute  plus  solvent,  is  then  inserted.    Any  reading  on  the  scale  that  is  less   than  100%  transmittance  (or  greater  than  0.0  absorbance)  is  considered  to  be  due  to  absorbance   by  the  solute  only.   Units  of  measurement:    The  transmittance  scale  is  a  %  number;  a  ratio  of  the  light  exiting  the  sample  tube  to  the  light  entering  the  tube.    However,  this  number  is  not  a  linear  reflection  of  the  concentration  of  the  solute  molecules  (Figure  2).    The  absorbance  scale,  on  the  other  hand,  does  reflect  a  linear  relationship.    Although  you  do  not  necessarily  know  the  exact  concentration  of  the  solute  molecules  in  your  sample,  you  do  know  that  if  the  absorbance  value  doubles,  the  concentration  of  solute  in  your  sample  has  doubled.    Absorbance  has  no  units,  but  the  wavelength  of  the  light  is  usually  indicated  by  a  subscript.      Figure  2.    The  relationship  between  %  transmittance  and  solute  concentration  (on  the  left),  and  absorbance  and  solute  concentration  (on  the  right).     68  
  • APPENDIX  8   Media,  Reagents  and  pH  Indicators  MEDIA:    Tryptic  Soy  Broth:     A  general  purpose  medium  used  to  cultivate  a  variety  of  microorganisms.     Composition  (g/L):   Bacto  tryptone           17.0  g   Bacto  soytone           3.0  g   Dextrose           2.5  g   NaCl             5.0  g   Dipotassium  phosphate         2.5  g     Dissolve  in  distilled  water  to  a  final  volume  of  1  L,  dispense  into  test  tubes,  and  autoclave  for  15   min  at  121oC.    Tryptic  Soy  Agar:     Used  for  cultivation  of  a  variety  of  microorganisms.     Composition  (g/L):   Bacto  tryptone           15.0  g   Bacto  soytone           5.0  g   NaCl             5.0  g   Agar             15.0  g     Dissolve  in  distilled  water  to  a  final  volume  of  1  L,  autoclave  for  15  min  at  121oC,  and  pour  into   sterile  Petri  dishes.    LB  Medium  (Luria-­‐Bertani  Medium):     Used  for  cultivation  of  Enterobactereaceae  family  members,  Sinorhizobium  and  Agrobacterium     Composition  (g/L):   Tryptone           10.0  g   Yeast  extract           5.0g     NaCl             10.0  g   Dissolve  in  distilled  deionised  H2O  to  a  final  volume  of  1  L,  autoclave  for  20  minutes  at  15  psi   (1.05  kg/cm2)  on  liquid  cycle,  and  pour  into  sterile  Petri  dishes.     69  
  • Terrific  Broth  (TB)   Used  for  the  cultivation  of  E.  coli     Composition  (g/L)   Tryptone   12.0  g   Yeast  Extract   24.0  g   Glycerol   4.0  mL     Dissolve  in  distilled  deionised  H2O  to  a  final  volume  of  900  mL,  autoclave  for  20  minutes  at  15  psi   2 o (1.05  kg/cm )  on  liquid  cycle.    Allow  the  solution  to  cool  to  60   C  or  less,  and  then  add  100  mL  of   a  sterile  solution  of  0.17M  KH2PO4,  0.72M  K2HPO4  (this  is  the  solution  resulting  from  dissolving   2.31  g  of  KH2PO4  and  12.54g  of  K2HPO4  in  90  mL  of  deionised  H2O.    After  the  salts  have  dissolved,   adjust  the  volume  of  the  solution  to  100  mL  with  deionised  H2O  and  sterilise  by  autoclaving  for   20  minutes  at  15  psi  on  liquid  cycle).    Nutrient  Agar:     Used  for  the  cultivation  of  a  wide  variety  of  microorganisms.     Composition  (g/L)   Peptone             5.0  g   NaCl             5.0  g   Yeast  extract           2.0  g   Beef  extract           1.0  g   Agar             15.0  g     Dissolve  in  distilled  water  to  a  final  volume  of  1  L,  autoclave  for  15  min  at  121oC,  and  pour  into   sterile  Petri  dishes.    TY  Agar     Used  for  the  cultivation  of  Pseudomonas  and  Rhizobium.     Composition  (g/L):   Tryptone       5.0  g   Yeast  Extract       3.0  g   CaCl2       0.5  g   MgSO4       0.1  g   Agar       13.0  g     Add  distilled  water  to  a  final  volume  of  1  L,  autoclave  for  15  min.  at  121  oC,  and  pour  into  sterile   Petri  dishes.     70  
  • Luria  Methylene  Blue  Agar     Used  for  the  observation  of  coliphage  plaques.     Composition  (g/L):   Tryptone       10.0  g   Yeast  Extract       5.0  g   NaCl       5.0  g   Glucose       1.0  g   Methylene  Blue       0.02  g   Agar       15.0  g     Dissolve  in  distilled  deionised  H2O  to  a  final  volume  of  1  L,  autoclave  for  20  minutes  at  15  psi   (1.05  kg/cm2)  on  liquid  cycle,  and  pour  into  sterile  Petri  dishes.    Luria  Agar  Overlay     Used  for  the  propagation  of  coliphage.     Composition  (g/L):   Tryptone           10.0  g   NaCl             5.0  g   Glucose             1.0  g   CaCl2             0.11  g   Agar             6.0  g     Add  3  mL  of  NaOH  per  L  and  check  for  a  pH  of  7.2.    Add  agar,  dissolve,  then  autoclave  for  20   minutes  at  15  psi  (1.05  kg/cm2)  on  liquid  cycle.      Eosin  Methylene  Blue  Agar:     Used  for  selection  of  Gram  negative  bacteria,  and  differentiation  of  lactose  fermenting   organisms.     Composition  (g/L):   Peptones           10.0  g   Di-­‐potassium  hydrogen  phosphate       2.0  g   Lactose             5.0  g   Sucrose             5.0  g   Eosin  Y,  yellowish           0.4  g   Methylene  blue           0.07  g   Agar             15  g   71  
  •   o Dissolve  in  distilled  water  to  a  final  volume  of  1  L,  autoclave  15  min  at  121 C,  and  pour  plates.    MacConkey  Agar:     Used  for  selection  of  Gram  negative  bacteria,  and  differentiation  of  lactose  fermenting   organisms.     Composition  (g/L):   Peptone             20.0  g   NaCl             5.0  g   Lactose             10.0  g   Bile  salts             5.0  g   Neutral  red           0.075  g   Agar             12.0  g     Dissolve  in  distilled  water  to  a  final  volume  of  1  L,  autoclave  15  min  at  121oC,  and  pour  plates.                References:    Atlas,  R.M.,  and  Parks,  L.C.  1993.    Handbook  of  Microbiological  Media.    CRC  Press,  Inc.    Boca  Raton,  Florida.    Difco  Manual:    Dehydrated  Culture  Media  and  Reagents  for  Microbiology.    10th  Ed.    (1984).    Difco  Laboratories,  Detroit,  Michigan.    Merck  Microbiology  Manual  1994.    Merck,  Darmstadt,  Germany.    Ross,  H.  1992/3.  Microbiology  241  Lab  Manual.  University  of  Calgary  Press,  Calgary.    Sambrook,  J.  and  Russell,  D.  W.  2001.  Molecular  Cloning  –  A  Laboratory  Manual.    3rd  edition.    Cold  Spring  Harbor  Laboratory  Press,  New  York. 72  
  • REAGENTS:    Ethanol,  70%:   95%  Ethanol           36.8  mL   Distilled  Water           13.2  mL    Barritt’s  Reagents:   Solution  A:    Dissolve  6  g  alpha  naphthol  in  100  mL  95%  ethanol   Solution  B:    Dissolve  16  g  potassium  hydroxide  in  100  mL  distilled  water.    Crystal  Violet  Stain:   Solution  A:  Dissolve  2.0  g  of  crystal  violet  in  20  mL  of  95%  ethanol.   Solution  B:    Dissolve  0.8  g  of  ammonium  oxalate  in  80  mL  of  distilled  water.   Mix  solutions  A  and  B.    Gram’s  Iodine:   Dissolve  2  g  of  potassium  iodide  in  300  mL  of  distilled  water;  then  add  1  g  of  iodine  crystals.    Kovac’s  Reagent:   Mix  the  following:   n-­‐Amyl  alcohol           75  mL   Hydrochloric  acid           25  mL   p-­‐dimethylamine-­‐benzaldehyde       5.0  g    Malachite  Green  Stain:   Dissolve  5  g  of  malachite  green  oxalate  in  100  mL  of  distilled  water.    Nigrosin  Solution:   Add  10  g  of  nigrosin  (water  soluble)  to  100  mL  of  distilled  water.    Boil  for  30  min,  and  add  0.5  mL   of  formaldehyde  (40%).    Filter  twice  through  double  filter  paper.    Store  under  aseptic  conditions.    Oxidase  Test  Reagent:   Dissolve  1  g  of  dimethyl-­‐p-­‐phenylenediamine  hydrochloride  in  100  mL  of  distilled  water.    Make   fresh.    Phloxine  B:   Dissolve  1  g  of  phloxine  in  100  mL  of  distilled  water.    Safranin:   Dissolve  0.25g  safranin  in  10  mL  of  95%  ethanol.    Add  to  100  mL  of  distilled  water.         73  
  • Sudan  Black  Stain:   Dissolve  0.3  g  of  Sudan  Black  in  100  mL  of  70%  ethanol.    Shake  before  each  use.          References:    Clark,  G.  (1984)  Staining  Procedures.    4th  Ed.    Williams  and  Wilkins,  Baltimore,  Maryland.    Benson,  H.J.  (1985).    Microbiological  Applications:  A  Laboratory  Manual  in  General  Microbiology,  4th  Ed.    Wm.  C.  Brown  Publishers,  Dubuque,  Iowa.             74  
  • pH  INDICATORS:       Table  1:    Indicators  of  Hydrogen  Ion  Concentration.             pH  Indicator   pH  Range   Full  Acid  Colour   Full  Alkaline  Colour   Cresol  Red   0.2  -­‐  0.8   Red   Yellow   Meta  Cresol  Purple   1.2  -­‐  2.8   Red   Yellow   (acid  range)     Thymol  Blue   1.2  -­‐  2.8   Red   Yellow   Brom  Phenol  Blue   3.0  -­‐  4.6   Yellow   Blue   Brom  Cresol  Green   3.8  -­‐  5.4   Yellow     Blue   Chlor  Cresol  Green   4.0  -­‐  5.6   Yellow   Blue   Methyl  Red   4.4  -­‐  6.4   Red   Yellow   Chlor  Phenol  Red   4.8  -­‐  6.4   Yellow   Red   Brom  Cresol  Purple   5.2  -­‐  6.8   Yellow   Purple   Bromothymol  Blue   6.0  -­‐  7.6   Yellow   Blue   Neutral  Red   6.8  -­‐  8.0   Red   Amber   Phenol  Red   6.8  -­‐  8.4   Yellow   Red   Cresol  Red   7.2  -­‐  8.8   Yellow   Red   Meta  Cresol  Purple   7.4  -­‐  9.0   Yellow   Purple   (alkaline  range)   Thymol  Blue     8.0  -­‐  9.6   Yellow   Blue   (alkaline  range)   Cresolphthalein   8.2  -­‐  9.8   Colourless   Red   Phenolphthalein   8.3  -­‐  10.0   Colourless   Red       Adapted  from:  Benson,  H.J.  (1985).    Microbiological  Applications:  A  Laboratory  Manual  in  General   Microbiology,  4th  Ed.    Wm.  C.  Brown  Publishers,  Dubuque,  Iowa.   75  
  • APPENDIX  9   Care  and  Feeding  of  the  Microscopes  Checklist  For  Compound  Microscopes  Name:________________________________________  Class  and  section:  ______________________________  Date:_________________________________________  Microscope  #:  _________________________________  Did  you  find  the  microscope  in  proper  working  order?  Y  or  N  If  not,  what  was  the  problem?  _____________________________________________  _____________________________________________  _____________________________________________  _____________________________________________  __  Slide  removed  from  stage  __  Slide,  stage,  and  objectives  are  free  of  oil  __  Mechanical  stage  is  centered  __  Stage  placed  at  its  lowest  position  __  4x  objective  placed  into  working  position  __  Ocular  micrometer  replaced  with  regular  ocular  __  Binocular  head  secured  in  “start”  position  __  Rheostat  turned  to  0  and  lamp  is  turned  off  __  Cord  is  wrapped  tightly  around  arm  and  lamp  __  Cord  is  secured  with  cord  clip  __  Dust  cover  is  placed  over  scope    Checklist  For  Dissecting  Scopes  Name:________________________________________  Class  and  section:  ______________________________  Date:_________________________________________  Microscope  #:  _________________________________  Did  you  find  the  microscope  in  proper  working  order?  Y  or  N  If  not,  what  was  the  problem?  _____________________________________________  _____________________________________________  _____________________________________________  _____________________________________________  __  Turn  off  transformer  __  Unplug  transformer  and  lamp  __  Wrap  cord  tightly  around  transformer  __  Place  transformer  on  stage  with  binocular  head  well  above     the  transformer  __  Replace  dust  cover         76