The                           University of                           Lethbridge     BIOLOGY 3400Principles of Microbiolog...
TABLE	  OF	  CONTENTS	  	  Exercise:	                 	            	            	             	            	            	 ...
BIOLOGY	  3400	  LAB	  SCHEDULE	                                                         SPRING,	  2012	  Jan.	  10	   	  ...
Laboratory	  Grade	  Distribution:	  The	  laboratory	  component	  of	  Biology	  3400	  is	  worth	  50%	  of	  your	  c...
Preparation	  of	  a	  Lab	  Book:	  Your	  lab	  book	  provides	  you	  with	  a	  detailed	  record	  of	  your	  exper...
                     THE	  UNIVERSITY	  OF	  LETHBRIDGE	                      Policies	  and	  Procedures	                ...
GUIDELINES	  FOR	  SAFETY	  PROCEDURES	  Students	  enrolled	  in	  laboratories	  in	  the	  Biological	  Sciences	  shou...
•         Contain	  and	  wipe	  up	  any	  spills	  immediately	  and	  notify	  your	  lab	  instructor	  (see	  SPILLS	...
This	  form	  must	  be	  completed,	  signed,	  and	  submitted	  to	  the	  laboratory	                          instruc...
EXERCISE	  1	                                                INTRODUCTION	  TO	  MICROSCOPY	  	  	  MICROSCOPY	  To	  view...
caused	  by	  differential	  bending	  of	  light	  passing	  through	  different	  thicknesses	  of	  the	  lens	  center...
cells	  separating	  after	  division;	  showing	  random	  association.	  	  Cells	  may	  remain	  together	  after	  di...
Once	  an	  ocular	  micrometer	  has	  been	  calibrated,	  objects	  may	  be	  measured	  in	  ocular	  divisions	  and...
EXERCISE	  2	                                   GENERAL	  LABORATORY	  PROCEDURES	  AND	  BIOSAFETY	  A	  primary	  featur...
EXERCISE	  3	                                                          FREE-­LIVING	  NITROGEN	  FIXATION	  PART	  A:	  IS...
•      Swirl	  gently	  to	  mix.	  	  Label	  the	  flask	  with	  your	  lab,	  bench	  number,	  and	  date.	  	  Make	...
For	  preparation	  of	  your	  reaction	  mixtures:	  Benches	  1,	  3,	  and	  5:	  Working	  with	  the	  people	  at	 ...
codes	  for	  labeling	  the	  tubes	  (keeping	  in	  mind	  that	  other	  groups	  are	  carrying	  out	  the	  same	  ...
o       12	  minutes	  at	  95	   C	  (used	  not	  only	  in	  initial	  DNA	  denaturation,	  but	  also	  to	  lyse	  t...
Woese,	  C.	  R.,	  Kandler,	  O.,	  and	  Wheelis,	  M.	  L.,	  1990.	  Towards	  a	  natural	  system	  of	  organisms:	...
purchased	  as	  commercial	  preparations.	  	  	  For	  an	  example	  please	  see:	             http://www.neb.com/neb...
EXERCISE	  4	                                                                WINOGRADSKY	  COLUMNS	  All	  life	  on	  ear...
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Biol3400 labmanual
Upcoming SlideShare
Loading in...5
×

Biol3400 labmanual

4,315

Published on

0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
4,315
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
8
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Transcript of "Biol3400 labmanual"

  1. 1. The University of Lethbridge BIOLOGY 3400Principles of Microbiology LABORATORY MANUAL Spring, 2012 Written by: L. A. Pacarynuk and H.C. Danyk Revised: December, 2011
  2. 2. TABLE  OF  CONTENTS    Exercise:                     Page    Biology  3400  Laboratory  Schedule.............................................................................................................2  Grade  Distribution.....................................................................................................................................3  Occupational  Health  and  Safety  Guidelines...............................................................................................5  Guidelines  for  Safety  Procedures...............................................................................................................6  Exercise  1  –  Introduction  to  Microscopy....................................................................................................9  Exercise  2  –  General  Laboratory  Principles  and  Biosafety.......................................................................13  Exercise  3  –  Free-­‐Living  Nitrogen  Fixation...............................................................................................14  Exercise  4  –  Winogradsky  Column  ..........................................................................................................21  Exercise  5  -­‐  Bacterial  and  Yeast  Morphology...........................................................................................23  Exercise  6  –  Bacterial  Reproduction.........................................................................................................28  Exercise  7  –  Ames  Test.............................................................................................................................31  Exercise  8  –  Biochemical  Tests.................................................................................................................34  Exercise  9  –  Yeast  Fermentation..............................................................................................................39  Exercise  10  -­‐  Virology...............................................................................................................................43  Appendix  1  –  The  Compound  Light  Microscope......................................................................................49  Appendix  2  –  Preparation  of  Scientific  Drawings.....................................................................................52  Appendix  3  –  Aseptic  Technique..............................................................................................................54  Appendix  4  –  The  Cultivation  of  Bacteria.................................................................................................59  Appendix  5  –  Bacterial  Observation.........................................................................................................64  Appendix  6  –  Laboratory  Reports...........................................................................................................  65  Appendix  7  –  Use  of  the  Spectrophotometer..........................................................................................67  Appendix  8  –  Media,  Reagents,  pH  Indicators.........................................................................................69  Appendix  9  –  Care  and  Feeding  of  the  Microscopes................................................................................76     1  
  3. 3. BIOLOGY  3400  LAB  SCHEDULE   SPRING,  2012  Jan.  10     No  lab  Jan.  12     No  lab    Jan.  17     Introduction,  Microscopy  Jan.  19       General  Lab  Procedures,  Biosafety    Jan.  24     General  Lab  Procedures,  Biosafety  –  Complete;  N-­‐Fixation    Jan.  26     Winogradsky  Column      Jan.  31     Bacterial  Morphology;  N-­‐fixation  Feb.  2   Bacterial  Morphology    Feb.  7   Bacterial  Morphology;  N-­‐fixation      Feb.  9     Bacterial  Morphology      Feb.  14   Bacterial  Growth    Feb.  16     Bacterial  Morphology  –  Complete;  N-­‐fixation:  Polymerase  Chain  Reaction    Feb.  21   Reading  Week    Feb.  23     Reading  Week    Feb.  28     Ames  Test  Mar.  1   Ames  Test  –  Complete;  N-­‐fixation:  Agarose  Gel  Electrophoresis    Mar.  6     Biochemical  Tests  -­‐  Selective  and  Differential  Media,  IMViC  Tests  Mar.  8     Selective  and  Differential  Media,  IMViC  tests  –  Complete    Mar.  13     Yeast  Fermentation  Mar.  15     Winogradsky  Column      Mar.  20   Virology  (phage  isolation)    Mar.  22     Virology  (phage  elution)    Mar.  27     Virology  (amplification)  Mar.  29   Virology  (titre/host  range)    Apr.  3     Virology  -­‐  Complete  Apr.  5     no  lab    Apr.  10     Lab  report  due     2  
  4. 4. Laboratory  Grade  Distribution:  The  laboratory  component  of  Biology  3400  is  worth  50%  of  your  course  mark.    It  is  distributed  as  follows:    • Skills  Tests             10%  • Assignments             20%  • Lab  Books             10%  (to  be  handed  in  three  times)    • Lab  Report             10%   th                On  Yeast  Fermentation;  due  Tuesday  April  10  at  the  beginning  of  lab  Performance:      Up  to  10%  of  laboratory  grade  (5  marks  out  of  50)  will  be  subtracted  for  poor  laboratory  performance.    This  includes  (but  is  not  limited  to)  failure  to  be  prepared  for  the  laboratory,  missing  lab  notebook  or  lab  manual,  poor  time  management  skills,  improper  handling  and  care  of  equipment  such  as  microscopes  and  micropipettors,  and  unsafe  practices  such  as  not  tying  hair  back,  chewing  gum,  applying  lipstick,  eating,  drinking,  or  chewing  on  pencils,  and  sloppy  technique  leading  to  poor  results.    As  we  are  working  with  potential  pathogens,  students  displaying  improper  or  careless  techniques  will  be  asked  to  leave  the  lab  and  will  have  at  least  5%  of  their  laboratory  grade  deducted  immediately.    Missing  a  lab  for  which  there  is  a  skills  test  or  assignment  requires  documentation.    Upon  presentation  of  this  documentation,  you  will  either  have  to  complete  the  assignment  or  skills  test  as  soon  as  possible  or,  if  this  is  not  possible,  your  lab  grade  will  be  recalculated.        The  lab  books  will  be  collected  and  graded  three  times  during  the  semester.    Although  most  exercises  are  completed  as  groups,  the  lab  books  are  to  be  completed  individually,  and  must  represent  individual  effort.      The  following  page  provides  you  with  tips  on  how  to  construct  your  books.    Unannounced  skills  tests  will  be  given  during  the  semester.    Students  are  expected  to  work  independently  on  some  technical  aspect  of  microbiology  and  will  be  graded  based  on  their  techniques  and  their  results.    As  proficiency  in  microbiological  techniques  is  considered  an  essential  component  of  the  course,  students  are  only  permitted  three  lab  period  absences  (you  do  not  require  any  documentation).      Missing  more  than  three  labs  will  result  in  a  grade  of  0  being  assigned  for  the  lab  (at  this  point,  it  is  recommended  that  students  consult  with  Arts  and  Science  Advising  for  the  option  of  completing  the  laboratory  the  following  year).    Students  are  still  responsible  for  the  material  missed  (and  their  assignments,  lab  reports  etc.  will  be  graded  as  such).    There  are  no  make-­‐up  laboratories.      Late  Assignments  will  be  penalized  as  follows:    For  Assignments  and  the  Lab  Report:    after  the  start  of  lab,  but  by  4:30  pm  on  the  due  date  –25%;  by  9:00  am  the  next  morning  -­‐50%,  and  after  9:00  am  the  following  day,  no  marks  will  be  given.        Extensions  for  the  lab  report  and  Assignments  will  only  be  granted  for  situations  involving  prolonged  illness  (documentation  is  required).         3  
  5. 5. Preparation  of  a  Lab  Book:  Your  lab  book  provides  you  with  a  detailed  record  of  your  experiments  performed.    This  record  proves  invaluable  when  preparing  manuscripts  for  publication,  or,  more  immediately,  when  preparing  lab  reports.    This  lab  book,  as  with  all  of  the  reports  and  assignments  is  an  individual  effort.    Choice  of  Lab  Book  Standard  black  lab  books  can  be  purchased  from  the  book  store  but  these  are  not  required  for  this  course.  The  only  required  features  are:   • Pages  are  non-­‐removable  (no  spiral  bindings)   • All  pages  must  be  numbered  in  the  top  outer  corner   • page  numbers  may  be  hand-­‐written  on  EVERY  page  in  INK  In  General   • all  entries  must  be  made  in  blue  or  black  ink  (except  drawings)   • date  EVERY  entry   • never  remove  a  page  or  use  white-­‐out   • if  an  entry  needs  to  be  deleted,  strike  out  the  entry  with  a  single  straight  line  (the   deleted  entry  must  be  readable)   • keep  up  to  date,  a  lab  book  is  meant  to  be  filled  out  as  the  experiments  are  carried  out  and  NOT   after  the  fact   • record  anything  that  may  be  useful  to  you  when  preparing  your  lab  reports   • leave  plenty  of  space  throughout  the  lab  book  to  add  comments  after  the  fact  Table  of  Contents  Designate  the  first  2  pages  as  the  Table  of  Contents   • record  information  and  pages  numbers  as  you  go  Lab  Entries  For  each  lab  be  sure  to  include  the  following;   1. Objective   2. Method  Summary   • do  not  rewrite  the  protocol  from  the  lab  manual   • highlight  any  specific  changes  to  the  lab  protocol   • include  times  and  dates  for  when  work  was  performed   • record  product  names  and  manufacturers  used       -­‐  enzymes,  chemicals,  equipment  (micropipettors,  baths)   • include  incubation  conditions  for  cultures  and  reaction   3. Observations  &  Results   • record  any  &  all  observations,  this  goes  beyond  number  results   • include  diagrams  and  any  other  form  of  raw  data   • include  calculations  as  appropriate   4. Conclusions   • did  you  achieve  your  objective?  Why  or  why  not?   • use  your  results  to  support  your  conclusions   5. Answer  the  thought  questions  at  the  end  of  the  lab  (as  applicable)   • use  reference  citations  as  needed   • these  may  be  graded   4  
  6. 6.   THE  UNIVERSITY  OF  LETHBRIDGE   Policies  and  Procedures   Occupational  Health  and  Safety  Manual      SUBJECT:   CHEMICAL  SPILLS  PROCEDURE    Precaution  should  be  taken  when  approaching  any  chemical  spill.     1. UNKNOWN  SPILL   a. Clear  the  area   b. Call  Security  at  329-­‐2345   c. Secure  the  area  and  do  not  let  anyone  enter   d. Call  Utilities  at  329-­‐2600  and  request  air  be  turned  on  at  the  spill  site   e. Security  will  respond  and  determine  the  severity  of  the  spill   f. Security  will  immediately  notify  the  spill  team  as  follows:   • Chemical  Release  Officer:  331-­‐5201     • Risk   and   Safety   Services   (OHS   Officers):   329-­‐2350/329-­‐2190   (office)   or   394-­‐ 8716/330-­‐4495  (cellular)   • Risk  and  Safety  Services  (Manager):  382-­‐7176  (office)   • DBS  Environmental  only  if  above  not  available  328-­‐4483  (24  hrs)       2. KNOWN  SPILL   a. Clear  the  area   b. Call  Security  at  329-­‐2345   c. Secure  the  area   d. Call  Utilities  at  329-­‐2600  and  request  air  be  turned  on  at  the  spill  site   e. Security  will  respond  and  determine  the  severity  of  the  spill   f. Security  will  immediately  notify  the  spill  team  as  follows:   • Chemical  Release  Officer:  331-­‐5201     • Risk   and   Safety   Services   (OHS   Officers):   329-­‐2350/329-­‐2190   (office)   or   332-­‐ 2350/394-­‐8716  (cellular)   • Risk  and  Safety  Services  (Manager):  382-­‐7176  (office)   • DBS  Environmental  only  if  above  not  available  328-­‐4483  (24  hrs)       3. NOTIFICATION   a. Risk  and  Safety  Services  will  notify  the  appropriate  departments,  including  notification   of  appropriate  government  agency.   5  
  7. 7. GUIDELINES  FOR  SAFETY  PROCEDURES  Students  enrolled  in  laboratories  in  the  Biological  Sciences  should  be  aware  that  there  are  risks  of  personal  injury  through  accidents  (fire,  explosion,  exposure  to  biohazardous  materials,  corrosive  chemicals,  fumes,  cuts,  etc).    The  guidelines  outlined  below  are  designed  to:       a)  minimize  the  risk  of  injury  by  emphasizing  safety  precautions  and             b)  clarify  emergency  procedures  should  an    accident  occur.  EMERGENCY  NUMBERS:  City  Emergency       911  Campus  Emergency     2345  Campus  Security       2603  Student  Health  Centre     2484  (Emergency  -­‐  2483)     THE  LABORATORY  INSTRUCTOR  MUST  BE  NOTIFIED  AS  SOON  AS   POSSIBLE  AFTER  THE  INCIDENT  OCCURS.      EMERGENCY  EQUIPMENT:  Your  lab  instructor  will  indicate  the  location  of  the  following  items  to  you  at  the  beginning  of  the  first  lab  period.     • Closest  emergency  exit   • Closest  emergency  telephone  and  emergency  phone  numbers   • Closest  fire  alarm   • Fire  extinguisher  and  explanation  of  use   • Safety  showers  and  explanation  of  operation   • Eyewash  facilities  and  explanation  of  operation   • First  aid  kit  GENERAL  SAFETY  REGULATIONS:   • Eating  and  drinking  is  prohibited  in  the  laboratory.    Keep  pencils,  fingers  and  other  objects   away  from  your  mouth.    These  measures  are  to  ensure  your  safety  and  prevent  accidental   ingestion  of  chemicals  or  microorganisms.   • Personal  protective  wear  is  mandatory.    Lab  coats,  safety  glasses  and  closed-­‐toed  shoes  must   be  worn  at  all  times  during  lab  exercises  which  involve  potential  for  chemical  or  biological   spills.         • Coats,  knapsacks,  briefcases,  etc.  are  to  be  hung  on  the  hooks  provided,  stowed  in  the   cupboards  beneath  the  countertops,  or  placed  along  a  side  designated  by  your  instructor.     Take  only  the  absolute  essentials  needed  to  complete  the  exercise*  with  you  to  your   laboratory  bench.    (*  e.g.  manual,  pen  or  pencil)   • Mouth  pipetting  is  NOT  permitted;  pipet  pumps  are  provided  and  must  be  used.   • Always  wash  your  hands  prior  to  leaving  the  laboratory.   • Students  are  not  allowed  access  to  the  central  Biology  Stores  area  for  any  reason.    Consult  your   instructor  if  you  require  additional  supplies.   • Report  any  equipment  problems  to  instructor  immediately.    Do  NOT  attempt  to  fix  any  of  the   equipment  that  malfunctions  during  the  course  of  the  lab.   • Use  caution  when  handling  chemical  solutions.    Consult  the  lab  instructor  for  instruction   regarding  the  clean-­‐up  of  corrosive  or  toxic  chemicals.   6  
  8. 8. • Contain  and  wipe  up  any  spills  immediately  and  notify  your  lab  instructor  (see  SPILLS  below).     Heed  any  special  instructions  outlined  in  the  lab  manual,  those  given  by  the  instructor  or  those   written  on  reagent  bottles.   • Long  hair  must  be  restrained  to  prevent  it  from  being  caught  in  equipment,  Bunsen  burners,   chemicals,  etc.   • Dispose  of  broken  glass,  microscope  slides,  coverslips  and  pipets  in  the  specially  marked  white   and  blue  boxes.    There  will  be  NO  disposal  of  glassware  in  the  wastepaper  baskets.       • You  are  responsible  for  leaving  your  lab  bench  clean  and  tidy.    Glassware  must  be  thoroughly   rinsed  and  placed  on  paper  toweling  to  dry.    SPILLS:   • Spill  of  SOLUTION/CHEMICAL:  While  wearing  gloves,  wipe  up  the  spill  using  paper  towels  and  a   sponge  as  indicated  by  the  lab  instructor.     • Spill  of  ACID/BASE/TOXIN:  Contact  instructor  immediately.    DO  NOT  TOUCH.     • BACTERIA  SPILLS:  If  necessary,  remove  any  contaminated  clothing.    Prevent  anyone  from  going   near  the  spill.    Cover  the  spill  with  10%  bleach  and  leave  for  10  minutes  before  wiping  up.     Discard  paper  towels  in  biohazard  bag.    Discard  contaminated  broken  glass  in  designated   biohazard  sharps  container.  DISPOSAL:   •   Broken  glass,  microscope  slides,  coverslips  and  Pasteur  pipets  are  placed  in  the  upright  white   ‘broken  glass’  cardboard  boxes.    NO  PAPER,  CHEMICAL,  BIOLOGICAL  OR  BACTERIAL  WASTE   MATERIALS  should  be  placed  in  this  container     •   Petri  plates,  microfuge  tubes,  pipet  tips  should  be  placed  in  the  orange  biohazard  bags.    The   material  in  this  bag  will  be  autoclaved  prior  to  disposal.     •   Bacterial  cultures  in  tubes  or  flasks  should  be  placed  in  marked  trays  for  autoclaving.     •   Liquid  chemicals  should  be  disposed  of  as  indicated  by  the  instructor.    DO  NOT  dispose  of   residual  solution  in  the  regent  bottles.    In  case  of  any  uncertainty  in  disposal  please  consult  the   lab  instructor.     •   Slides  of  bacteria  should  be  placed  in  the  trays  filled  with  10%  bleach  that  are  located  at  the  ends   of  the  laboratory  benches.    HEALTH  CONCERNS:  Students  who  have  allergies,  are  pregnant,  or  who  may  have  other  health  concerns  should  inform  their  lab  instructor  so  that  appropriate  precautions  may  be  taken  where  necessary.     7  
  9. 9. This  form  must  be  completed,  signed,  and  submitted  to  the  laboratory   instructor  before  any  laboratory  work  is  begun.           *  *  *  *  *  *  *  *        I  have  read  and  I  understand  the  safety  rules  that  appear  in  this  manual.    I  recognize  that  it  is  my  responsibility  to  observe  them,  and  agree  to  abide  by  them  throughout  this  course.          Name  (please  print)                                  Date                    Signature                          Course:   Biology        3400          Semester:   Spring  2012               8  
  10. 10. EXERCISE  1   INTRODUCTION  TO  MICROSCOPY      MICROSCOPY  To  view  microscopic  organisms,  their  magnification  is  essential.    The  microscope  is  the  instrument  used  to  magnify  microscopic  images.    Its  function  and  some  aspects  of  design  are  similar  to  those  of  telescopes  although  the  microscope  is  designed  to  visualize  very  small  close  objects  while  telescopes  magnify  distant  objects.  Please  review  Appendices  1  and  9.    Magnification  is  achieved  by  the  refraction  of  light  travelling  though  lenses,  transparent  devices  with  curved  surfaces.    In  general,  the  degree  of  refraction,  and  hence,  magnification,  is  determined  by  the  degree  of  curvature.    However,  rather  than  using  a  single,  severely-­‐curved  biconvex  lens  such  as  that  of  Leeuwenhoeks  simple  microscopes,  Hooke  determined  that  image  clarity  was  improved  through  the  use  of  a  compound  microscope,  involving  two  (or  more)  separate  lenses.  Operation  of  the  Compound  Microscope    Students  should  be  familiar  with  all  names  and  functions  of  the  components  of  their  compound  light  microscopes  as  demonstrated  in  Appendix  1.    Properties  of  the  Objective  Lenses    1.   Magnification    Magnification  is  a  measure  of  how  big  an  object  looks  to  your  eye.    The  number  of  times  that  an  object  is  magnified  by  the  microscope  is  the  product  of  the  magnification  of  both  the  objective  and  ocular  lenses.    The  magnification  of  the  individual  lenses  is  engraved  on  them.    Your  microscope  is  equipped  with  ocular  lenses  that  magnify  the  specimen  ten  times  (10X),  and  four  objectives  which  magnify  the  specimen  4X,  10X,  40X,  and  100X.  Each  lens  system  magnifies  the  object  being  viewed  the  same  number  of  times  in  each  dimension  as  the  number  engraved  on  the  lens.    When  using  a  10X  objective,  for  instance,  the  specimen  is  magnified  ten  times  in  each  dimension  to  give  a  primary  or  "aerial"  image  inside  the  body  tube  of  the  microscope.    This  image  is  then  magnified  an  additional  ten  times  by  the  ocular  to  give  a  virtual  image  that  is  100  times  larger  than  the  object  being  viewed.    2.   Resolution    Resolution  is  a  measure  of  how  clearly  details  can  be  seen  and  is  distinct  from  magnification.    The  resolving  power  of  a  lens  system  is  its  capacity  for  separating  to  the  eye  two  points  that  are  very  close  together.    It  is  dependent  upon  the  quality  of  the  lens  system  and  the  wavelength  of  light  employed  in  illumination.    The  white  light  (a  combination  of  different  wavelengths  of  visible  light)  used  as  the  light  source  in  the  lab  limits  the  resolving  power  of  the  100X  objective  lens  to  about  0.25  µm.    Objects  smaller  than  0.25  µm  cannot  be  resolved  even  if  magnification  is  increased.    Spherical  aberration  (distortion   9  
  11. 11. caused  by  differential  bending  of  light  passing  through  different  thicknesses  of  the  lens  center  versus  the  margin)  results  from  the  air  gap  between  the  specimen  and  the  objective  lens.  This  problem  can  be  eliminated  by  filling  the  air  gap  with  immersion  oil,  formulated  to  have  a  refractive  index  similar  to  the  glass  used  for  cover  slips  and  the  microscopes  objective  lens.    Use  of  immersion  oil  with  a  100X  special  oil  immersion  objective  lens  can  increase  resolution  to  about  0.18  µm.    Resolving  power  can  be  increased  further  to  0.17  µm  if  only  the  shorter  (violet)  wavelengths  of  visible  light  are  used  as  the  light  source.    This  is  the  limit  of  resolution  of  the  light  microscope.        The  resolving  power  of  each  objective  lens  is  described  by  a  number  engraved  on  the  objective  called  the  numerical  aperture.    Numerical  aperture  (NA)  is  calculated  from  physical  properties  of  the  lens  and  the  angles  from  which  light  enters  and  leaves.    Examine  the  three  objective  lenses.    The  NA  of  the  10X  objective  lens  is  0.25.    Which  objective  lens  is  capable  of  the  greatest  resolving  power?    3.   Working  Distance    The  working  distance  is  measured  as  the  distance  between  the  lowest  part  of  the  objective  lens  and  the  top  of  the  coverslip  when  the  microscope  is  focused  on  a  thin  preparation.    This  distance  is  related  to  the  individual  properties  of  each  objective.    4.   Parfocal  Objectives    Most  microscope  objectives  when  firmly  screwed  in  place  are  positioned  so  the  microscope  requires  only  fine  adjustments  for  focusing  when  the  magnification  is  changed.    Objectives  installed  in  this  manner  are  said  to  be  parfocal.    5.   Depth  of  Focus    The  vertical  distance  of  a  specimen  being  viewed  that  remains  in  focus  at  any  one  time  is  called  the  depth  of  focus  or  depth  of  field.    It  is  a  different  value  for  each  of  the  objectives.    As  the  microscope  is  focused  up  and  down  on  a  specimen,  only  a  thin  layer  of  the  specimen  is  in  focus  at  one  time.    To  see  details  in  a  specimen  that  is  thicker  than  the  depth  of  focus  of  a  particular  objective  you  must  continuously  focus  up  and  down.    Observing  Bacteria    Three  fundamental  properties  of  bacteria  are  size,  shape  and  association.    Bacteria  generally  occur  in  three  shapes:    coccus  (round),  bacillus  (rod-­‐shaped),  and  spirillum  (spiral-­‐shaped).    Size  of  bacterial  cells  used  in  these  labs  varies  from  0.5  µm  to  1.0  µm  in  width  and  from  1.0  µm  to  5.0  µm  in  length,  although  there  is  a  range  of  sizes  which  bacteria  demonstrate.    Association  refers  to  the  organization  of  the  numerous  bacterial  cells  within  a  culture.    Cells  may  occur  singly  with   10  
  12. 12. cells  separating  after  division;  showing  random  association.    Cells  may  remain  together  after  division  for  some  interval  resulting  in  the  presence  of  pairs  of  cells.  When  cells  remain  together  after  more  than  a  single  division,  clusters  result.    Cell  divisions  in  a  single  plane  result  in  chains  of  cells.    If  the  plane  of  cell  division  of  bacilli  is  longitudinal,  a  palisade  results,  resembling  a  picket  fence.    Both  bacterial  cell  shape  and  association  are  usually  constant  for  bacteria  and  hence,  can  be  used  for  taxonomic  identification.    However,  both  properties  may  be  influenced  by  culture  condition  and  age.    Further,  some  bacteria  are  quite  variable  in  shape  and  association  and  this  may  also  be  diagnostic.    Micrometry    When  studying  bacteria  or  other  microorganisms,  it  is  often  essential  to  evaluate  the  size  of  the  organism.  By  tradition,  the  longest  dimension  (length)  is  generally  stressed,  although  width  is  sometimes  useful  for  identification  or  other  study.        Use  of  an  Ocular  Micrometer  (Figure  1)    An  ocular  micrometer  can  be  used  to  measure  the  size  of  objects  within  the  field  of  view.    Unfortunately,  the  distance  between  the  graduations  of  the  ocular  micrometer  is  an  arbitrary  measurement  that  only  has  meaning  if  the  ocular  micrometer  is  calibrated  for  the  objective  being  used.    1) Place  a  micrometer  slide  on  the  stage  and  focus  the  scale  using  the  40x  objective.  2) Turn  the  eyepiece  until  the  graduations  on  the  ocular  scale  are  parallel  with  those  on  the  micrometer   slide  scale  and  superimpose  the  micrometer  scale.  3) Move  the  micrometer  slide  so  that  the  first  graduation  on  each  scale  coincides.  4) Look  for  another  graduation  on  the  ocular  scale  that  exactly  coincides  with  a  graduation  on  the   micrometer  scale.  5) Count  the  number  of  graduations  on  the  ocular  scale  and  the  number  of  graduations  on  the   micrometer  slide  scale  between  and  including  the  graduations  that  coincide.  6) Calibrate  the  ocular  divisions  for  the  40x  and  the  100x  objective  lenses.    Note  that  immersion  oil  is   not  necessary  for  calibration.        Figure  1.    Calibration  of  an  ocular  micrometer  using  a  stage  micrometer.    The  mark  on  the  stage  micrometer  corresponding  to  0.06  mm  (60  µ m)  is  equal  to  5  ocular  divisions  (o.d.)  on  the  ocular  micrometer.    ∴  1  ocular  division  equals  60  µ m/5  ocular  divisions  or  12  µ m.     11  
  13. 13. Once  an  ocular  micrometer  has  been  calibrated,  objects  may  be  measured  in  ocular  divisions  and  this  number  converted  to  µm  using  the  conversion  factor  determined.    Bacterial  size  is  generally  a  highly  heritable  trait.  Consequently,  size  is  a  key  factor  used  in  the  identification  of  bacterial  taxa.  However,  for  some  bacteria,  cell  size  can  be  modified  by  nutritional  factors  such  as  culture  media  composition,  environmental  factors  such  as  temperature,  or  other  factors  such  as  age.    METHODS:    For  each  student:  • Compound  light  microscope  • Various  prepared  slides  of  bacteria.  • Stage  micrometer  • Ocular  micrometer  • Immersion  oil    1) Use  the  diagram  in  Figure  1  to  calibrate  the  40x  and  the  100x  objectives  on  your  compound   microscopes.    Record  these  values  in  your  lab  book  as  you  will  then  use  these  values  when   measuring  cells  and  structures  for  the  rest  of  the  lab.        Note:    Do  NOT  use  immersion  oil  when  calibrating  the  100x  objective.    This  is  the  ONLY  time  during  the  term  that  you  will  not  use  immersion  oil  with  this  objective.    2) Use  the  compound  microscope  to  observe  the  prepared  slides  of  bacteria  using  the  10x  and  40x   objective  lenses.    Observe  the  same  slides  under  the  100x  objective  using  immersion  oil.  3) Diagram  two  of  the  organisms  viewed  following  the  instructions  found  in  Appendix  2. 12  
  14. 14. EXERCISE  2   GENERAL  LABORATORY  PROCEDURES  AND  BIOSAFETY  A  primary  feature  of  the  microbiology  laboratory  is  that  living  organisms  are  employed  as  part  of  the  experiment.    Most  of  the  microorganisms  are  harmless;  however,  whether  they  are  non-­‐pathogenic  or  pathogenic,  the  microorganisms  are  treated  with  the  same  respect  to  assure  that  personal  safety  in  the  laboratory  is  maintained.    Careful  attention  to  technique  is  essential  at  all  times.    Care  must  always  be  taken  to  prevent  the  contamination  of  the  environment  from  the  cultures  used  in  the  exercises  and  to  prevent  the  possibility  of  the  people  working  in  the  laboratory  from  becoming  contaminated.    Ensure  that  you  have  read  over  the  guidelines  on  Safety,  and  those  on  Aseptic  technique  (Appendix  3).    As  well,  you  should  be  familiar  with  the  contents  of  the  University  of  Lethbridge  Biosafety  web  site:    www.uleth.ca/artsci/biological-­‐sciences/bio-­‐safety    METHODS  Part  1:  General  Laboratory  Procedures  Work  individually  to  prepare  a  streak  plate  and  a  broth  culture  using  the  E.  coli  cultures  provided.    Refer  to  Appendix  3  as  necessary.    Part  2:  Biosafety  You  will  be  provided  with  the  following:  • Sterile  swabs  • Sterile  water  • Potato  Dextrose  Agar  (PDA)  plates  and  Luria  Bertani  (LB)  plates    Work  in  pairs  to  complete  the  following  exercise:  1) Draw  a  line  on  the  back  of  each  plate  to  divide  the  plates  in  half.    Label  one  half  of  the  plate  with  the  name  of   the  surface  to  be  tested.    Label  the  other  half  of  the  plate  as  “after  disinfection”.  2) Moisten  the  swabs  provided  with  a  small  amount  of  sterile  water.    Brush  the  surface  to  be  tested  with  the   swab,  and  then  use  the  swab  to  inoculate  one-­‐half  of  each  of  your  two  plates.  3) Disinfect  the  surface,  moisten  another  swab,  and  repeat  using  the  other  half  of  both  plates.    Wrap  the  plates   with  parafilm.  4) Your  plates  will  be  incubated  for  16-­‐20  hours  at  30oC,  and  then  refrigerated  at  4oC.    During  the  next   laboratory  period,  evaluate  your  plate  results  and  record  the  number  of  colonies  present  on  each  half  of  both   plates.    Make  observations  of  colony  morphology.    Thought  Questions:    (Use  the  Biosafety  Web  Site  as  a  reference)  • Were  differences  in  colony  morphology  and  number  observed  on  the  two  types  of  media?    Why?  • Does  disinfection  of  work  surfaces  completely  eliminate  all  microbial  organisms?    What  evidence  do  you   have?  • What  is  an  MSDS  and  where  can  you  find  one?  • In  Canada,  the  Laboratory  Centre  for  Disease  Control  has  classified  infectious  agents  into  4  Risk  Groups  using   pathogenicity,  virulence  and  mode  of  transmission  (among  others)  as  criteria.    What  do  these  terms  mean?  • What  criteria  would  characterize  an  organism  classified  in  Risk  Group  1,  2  3  or  4?      • There  are  many  “Golden  Rules”  for  Biosafety.    Identify  4  common  sense  practices  that  will  protect  you  in  your   microbiology  labs. 13  
  15. 15. EXERCISE  3   FREE-­LIVING  NITROGEN  FIXATION  PART  A:  ISOLATION  OF  FREE-­‐LIVING  NITROGEN  FIXING  MICROORGANISMS    Nitrogen  is  an  important  component  of  amino  acids,  cell  walls  and  other  cofactors  present  in  all  cells.    Nitrogen  gas  comprises  greater  than  75%  of  our  atmosphere,  but  it  is  one  of  the  most  stable  bonds  in  nature,  and  is  unavailable  for  use  in  this  form.    At  one  time  early  in  the  evolutionary  history  of  life  on  earth,  all  cells  may  have  had  the  ability  to  fix  N2  gas  into  a  more  usable  form  (nitrate,  nitrite  or  ammonia).    Today  however,  only  a  few  species  of  bacteria  and  archaea  are  capable  of  converting  N2;  all  other  organisms  rely  on  N2-­‐fixing  prokaryotes  for  their  fixed  nitrogen  requirements.    M.W.  Beijerinck,  a  Dutch  microbiologist,  successfully  isolated  free  living  nitrogen  fixing  bacteria  in  1901.    He  inoculated  soil  samples  into  enrichment  media  containing  glucose  and  mineral  salts,  but  lacking  any  source  of  nitrogen  other  than  atmospheric  nitrogen.    He  observed  cells  that  are  today  identified  as  members  of  the  genus  Azotobacter.    Subsequently,  other  aerobic,  free-­‐living  nitrogen  fixing  genera  of  bacteria  have  been  isolated  and  identified,  including  Azomonas,  Azospirillum  and  Beijerinckia.        Nitrogen  fixation  occurs  only  when  an  enzyme  called  nitrogenase  is  present.    The  enzyme  consists  of  two  distinct  proteins  (i)  dinitrogenase,  which  reacts  with  N2,  and  (ii)  dinitrogenase  reductase,  which  reduces  nitrogen  gas  to  ammonia.    The  dinitrogenase  reductase  component  is  irreversibly  inactivated  by  the  presence  of  oxygen.  Several  strategies  have  evolved  to  enable  free-­‐living,  aerobic  organisms  like  Azotobacter  to  fix  nitrogen.    Azotobacter  has  a  very  high  respiratory  rate,  which  is  thought  to  prevent  any  stray  oxygen  from  coming  into  contact  with  the  nitrogenase  enzyme.    Additionally,  free-­‐living  nitrogen  fixers  often  secrete  copious  amounts  of  slime  which  may  prevent  extra  oxygen  from  entering  the  cells.        There  is  also  evidence  suggesting  that  in  the  presence  of  oxygen  nitrogenase  can  combine  with  a  specific  protein  inside  the  cell  that  shields  the  oxygen  sensitive  site  and  prevents  it  from  interacting  from  oxygen.    When  oxygen  levels  drop,  nitrogenase  can  resume  its  activity.    Over  the  course  of  the  semester  we  will  isolate  free  living  nitrogen  fixing  bacteria  from  prairie  soil,  establish  pure  cultures  and  attempt  to  identify  cultures  using  modern  day  molecular  techniques.    METHODS:    For  each  lab:   • 5,  250  mL  flasks  containing  N-­‐free  medium;  10  plates  N-­‐free  medium   • Balance,  weigh  boats  and  spatula   • N-­‐free  soil  sample    Work  in  groups  of  4  to  inoculate  your  flasks.   • Weigh  out  1  g  of  the  soil  sample  provided,  and  add  it  to  an  Erlenmeyer  flask  containing  100  mL  of  N-­‐ free  medium.   14  
  16. 16. • Swirl  gently  to  mix.    Label  the  flask  with  your  lab,  bench  number,  and  date.    Make  sure  that  the  cap  or   foil  is  loosened  sufficiently  to  allow  air  to  enter  the  culture.   • After  7  days,  remove  the  flask  and  look  for  the  presence  of  a  thin  film  of  growth  on  the  surface  of  the   medium.    Use  a  sterile  inoculating  loop  to  remove  some  of  this  film  and  prepare  a  streak  plate.    The  streak   o plate  will  be  incubated  for  a  further  7  days  at  30 C.       • Examine  wet  mounts  from  your  broth  culture  using  the  phase  contrast  microscope.    Prepare  Gram  stains  of   the  film  and  look  for  large  Gram  negative  cells  that  may  be  bacillus  or  coccoid  in  shape.    They  may  occur   singly,  or  in  arrowhead-­‐shaped  pairs.    Record  observations  in  your  lab  book.       • After  the  incubation  period  is  complete,  examine  your  streak  plate.    Look  for  large,  translucent,   mucoid  colonies.    Prepare  a  wet  mount  from  an  isolated  colony  and  view  it  using  a  phase-­‐contrast   microscope.    Prepare  another  streak  plate  using  cells  from  the  same  colony.    This  plate  will  be   incubated  again,  and  observations  will  be  made  later  in  the  term.    Additionally,  this  culture  will  be   used  in  Part  B  of  this  exercise.    Thought  Questions:   • Define  enrichment.    What  aspect(s)  of  the  medium  used  in  this  exercise  made  it  an  enrichment  medium?     Why  did  we  use  the  same  medium  for  plating  after  free-­‐living  nitrogen  fixers  were  isolated?    What  term   would  we  use  to  describe  the  medium  in  this  case?   • Why  did  we  sample  the  film  on  top  of  the  culture,  rather  than  the  sediment  on  the  bottom  of  the  flask?   • When  you  viewed  your  Gram  stains,  you  may  have  observed  cells  on  your  slides  that  didn’t  appear  to  be   Azotobacter.    Why  might  these  other  genera  be  present?      PART  B:  IDENTIFICATION  OF  MICROORGANISMS  USING  PCR  OF  16s  rDNA  The  DNA  from  microbes  can  be  isolated  and  may  be  studied  via  construction  of  BAC  (Bacterial  Artificial  Chromosome)  libraries  (for  an  example,  see  Rondon,  et  al.,  2000).    More  simply,  an  appreciation  of  diversity  may  be  obtained  by  using  universal  primers  for  PCR  amplification  of  rDNA  genes  from  the  Bacterial  domain  on  a  preparation  of  total  DNA  from  an  environmental  sample.    The  resulting  pool  of  nucleotide  fragments  may  then  be  cloned,  unique  clones  sequenced,  and  the  resulting  sequences  analyzed  in  order  to  characterize  and  potentially  identify  the  microbes  present.    In  Part  B  of  this  exercise  you  will  perform  PCR  using  primers  specific  for  prokaryotic  16s  rDNA  to  isolate  ribosomal  DNA  from  putative  Azotobacter  cultures  and  then  visualise  this  DNA  using  Agarose  Gel  Electrophoresis.    In  addition,  DNA  from  successful  PCRs  will  be  sent  for  sequencing  and  you  will  then  be  using  online  tools  to  perform  sequence  analysis  to  confirm  the  identity  of  your  cultures.    PCR  of  Soil  Bacteria  Two  different  primer  sets  will  be  employed.    Each  group  will  only  be  using  one  set  on  their  particular  culture.    Note  that  the  primer  designations  refer  to  location  of  primer  binding  site  on  the  16s  rDNA  molecule.    Given  this  information,  predict  the  sizes  of  your  PCR  products  for  both  primer  sets.         15  
  17. 17. For  preparation  of  your  reaction  mixtures:  Benches  1,  3,  and  5:  Working  with  the  people  at  your  bench,  each  group  will  be  setting  up  3x  reactions  as  outlined  below:    Primer   Template  Source  FP1/1492R   Unknown  Culture  FP1/1492R   E.  coli  FP1/1492R   No  template    Benches  2/4:  Working  with  the  people  at  your  bench,  each  group  will  be  setting  up  3x  reactions  as  outlined  below:    Primer  Set   Template  Source  27F/805R   Unknown  Culture  27F/805R   E.  coli  27F/805R   No  template    METHODS:    Reagents:   • Taq  (Invitrogen)   • 10x  PCR  buffer   • 50  mM  MgCl2  Primers  (*Y  =  C  or  T)   • FP1  (AGAGTTYGATYCTGGCT)*1  (10  pmol/µL)   • RP1492  (TACGGYTACCTTGTTACGACT)*1  (10  pmol/µL)   • 27F  (AGAGTTTGATCCTGGCTCAG)2  (10  pmol/µL)   • 805R  (GACTACCAGGGTATCTAATCC)2  (10  pmol/µL)   • dNTP  mix  (8  mM)   • Optima  Water  (Fisher  Scientific)  Cultures:   • Pure  culture  of  organism  isolated  from  soil   • Plate  culture  of  E.  coli    Equipment:     • Thermocyclers  (BioRad)   • Micropipettors  and  sterile  tips     • Parafilm   • Ice  buckets  and  ice   • Sterile  0.5  mL  tubes   • Sterile  0.2  mL  PCR  tubes   • Biohazard  bags   • Permanent  markers  Note:    Use  aseptic  technique  throughout.    Keep  your  tubes  on  ice  at  all  times!   • Obtain  three  0.2  mL  PCR  tubes  from  the  sterile  container  at  the  side  of  the  lab.    Decide  on  appropriate   16  
  18. 18. codes  for  labeling  the  tubes  (keeping  in  mind  that  other  groups  are  carrying  out  the  same  reactions).    Label   the  tubes  on  the  tops  and  on  the  sides  using  permanent  marker.    Place  the  tubes  on  ice.   • Obtain  a  0.5  mL  tube  for  your  Master  Mix.    Keep  this  tube  on  ice.    Use  the  information  outlined  in  Table  1   to  set  up  your  Master  Mix.    This  mix  contains  everything  required  in  order  for  DNA  replication  to  occur.     Generally,  Master  Mixes  contain  enough  volume  to  set  up  the  number  of  reactions  +  1.    In  your  case,  you   will  be  preparing  enough  mix  for  4  reactions.    Work  carefully.        Table  1.    Components,  starting  concentrations  and  volumes  for  set-­‐up  of  PCRs.   Component  and  Starting   Final   Amount  to  add   Master  Mix  vol.  (for   Concentration   Concentration     for  ONE  reaction   total  #  Reactions  +   (µL)   1)  (µL)       Optima-­‐Water     32   128   10x  PCR  buffer   1x   5   20   50  mM  MgCl2   1.5  mM   2   8   dNTP  mix  (8  mM  of  all  4)   40  nmoles  (0.8  mM   5   20   of  all  4)   Primer  1   0.4  µ M   2   8   Primer  2   0.4  µ M   2   8   Taq  DNA  polymerase  (5  U/µL)   5  U    (units)   1   4     Template  DNA     1     Leave  Template  out   of  Master  Mix!   Final  Volume   50  µ L   50  µ L      Note:    One  primer  set  per  reaction  mixture!       • While  the  Master  Mix  is  being  set  up,  other  group  members  should  be  setting  up  template  preparations.     Obtain  a  small  square  of  parafilm.    For  each  bacterial  culture  (soil  bacteria  and  E.  coli  –  what  is  the  role  of  E.   coli?),  use  a  micropipettor  with  a  sterile  tip  to  pipette  20  µ L  of  sterile  Optima-­‐water  (Fisher  Scientific)  onto   the  parafilm.       • Take  a  10  –  100  µL  micropipettor  and  put  on  a  sterile  tip.    Touch  the  tip  to  a  single  colony  from  your  soil   bacterial  culture  plate.    Pipette  up  and  down  into  the  Optima  water  on  the  parafilm.    This  mixture  will  be   used  as  your  template  source.   • Mix  E.  coli  in  the  same  fashion  with  your  second  drop  of  Optima  water  on  the  parafilm.    Again,  1  µL  of  this   mixture  will  be  used  as  template  in  your  second  reaction.   • For  your  third  reaction,  you  will  be  leaving  out  template  and  replacing  it  with  an  equal  volume  of  sterile   Optima  water.    What  is  the  purpose  of  this  reaction?     • After  preparation  of  Master  Mix,  add  the  appropriate  volume  of  template  (1  µL)  to  each  tube,  then  check   with  the  Instructor  to  see  where  everyone  else  is  at.    When  all  of  the  groups  are  at  the  same  stage,  add  the   appropriate  volume  of  Master  Mix  (49  µL  )  to  each  tube.    Keep  your  tubes  on  ice  until  in  the  PCR  machine.      GENTLY  tap  tubes  to  mix.    When  everyone  is  ready,  the  instructor  will  then  show  you  how  to  operate  the  thermocycler.          The  parameters  you  are  using  for  the  PCR  are:   17  
  19. 19. o 12  minutes  at  95   C  (used  not  only  in  initial  DNA  denaturation,  but  also  to  lyse  the  bacterial  cells)   30  cycles  of:   o • 1  minute  at  94   C   o • 45  seconds  at  55   C   o • 90  seconds  at  72   C   A  final  elongation  of:   o • 20  minutes  at  72   C     oThe  samples  will  be  stored  at  -­‐20   C  upon  completion.    Thought  Questions:    • What  are  the  purposes  of  the  primers  in  PCR?  • What  happens  at  each  temperature?  • How  is  annealing  temperature  determined?  • What  is  meant  by  stringency?    How  can  you  ensure  high  stringency?  • If  you  left  out  the  forward  primer,  would  you  expect  to  see  a  band  resulting  on  the  gel?    If  you  did,  explain  what   this  would  mean.  • Is  it  possible  to  design  PCRs  given  only  an  isolatable  protein?    Why  or  why  not?    What  are  some  of  the  problems   associated  with  such  an  experiment?    How  might  you  adapt  the  reaction  conditions  to  optimise  yield  of  desired   product?    Suggested  Background  Reading:  Amann  et.  al.,  1995.    Phylogenetic  identification  and  in  situ  detection  of  individual  microbial  cells  without  cultivation.  Microbiol.  Rev.  59  (1):  143-­‐169.    Aas,  J.  A.,  Paster,  B.  J.,  Stokes,  L.  N.,  Olsen,  I.,  and  Dewhirst,  F.  E.  2005.  Defining  the  Normal  Bacterial  Flora  of  the  Oral  Cavity.  J.  Clin.  Microbiol.  43:  5721-­‐5732.  Cole,  J.  R.,  Chai,  B.,  Farris,  R.  J.,  Wang,  Q.,  Kulam,  S.  A.,  McGarrell,  D.  M.,  Bandela,  A.  M.,  Cardenas,  E.,  Garrity,  G.  M.,  and  Tiedje,  J.  M.  2007.  The  ribosomal  database  project  (RDPII):  introducing  myRDP  space  and  quality  controlled  public  data.  Nuc.  A.  Res.  35:  D169-­‐D172.  DeLong  and  Pace,  2001.  Environmental  diversity  of  bacteria  and  archaea.  Syst.  Biol.  50(4):  470-­‐478.  Gabor,  E.  M.,  deVries,  E.  J.,  and  Janssen,  D.  B.  2003.    Efficient  recovery  of  environmental  DNA  for  expression  cloning  by  indirect  extraction  methods.    FEMS.    44(2):  153-­‐163.    Kelley,  S.T.,  Theisen  U.,  Angenent,  L.T.,  Amand,  A.S.,  and  Pace,  N.R.    Molecular  Analysis  of  Shower  Curtain  Biofilm  Microbes.    Appl.  Environ.  Microbiol.    70:  4187-­‐4192.  Pace,  1997.  A  molecular  view  of  microbial  diversity  and  the  biosphere.  Science.  276:  734-­‐740.      Whitford,  M.  F.,  Forster,  R.  J.,  Beard,  C.  E.,  Gong,  J.,  and  Teather,  R.  M.  1998.  Phylogenetic  analysis  of  rumen  bacteria  by  comparative  sequence  analysis  of  cloned  16S  rRNA  genes.    Anaerobe.  4:  153-­‐163.   18  
  20. 20. Woese,  C.  R.,  Kandler,  O.,  and  Wheelis,  M.  L.,  1990.  Towards  a  natural  system  of  organisms:  Proposal  for  the  domains  Archaea,  Bacteria,  and  Eucarya.  Proc.  Natl.  Acad.  Sci.  USA.  87:  4576-­‐4579.    Agarose  Gel  Electrophoresis    METHODS  Reagents:  • 1x  TBE  buffer  • 0.8%  agarose  gels  (1  per  2  benches)  • 10x  loading  dye  • 2-­‐log  NEB  ladder  premixed  with  loading  dye  • Ethidium  bromide  bath  • PCR  samples  from  last  lab    Equipment  • Power  supplies  (1  per  2  benches)  • Micropipettors  • Sterile  tips  • Parafilm  • Transilluminator/camera  • Biohazard  bags    • Gloves    Note:    Two  groups  will  load  their  samples  (6  tubes  total)  onto  one  gel.        We  will  be  using  0.8%  agarose  prepared  in  1x  TBE.     • Obtain  and  completely  thaw  your  PCR  samples.       • Using  a  micropipettor,  dot  out  1  µL  aliquots  of  10x  loading  dye  in  a  line  on  a  thin  strip  of  parafilm.  Remove   a  7.5  µL  aliquot  of  your  first  sample,  mix  gently  with  the  loading  dye  on  the  parafilm,  and  proceed  with   loading.    Aim  for  approximately  1-­‐2x  final  concentration  of  loading  dye  per  sample  loaded  (and  recognise   that  this  is  NOT  exact).     Loading  Dye  –  1)  increases  the  density  of  the  sample  ensuring  that  it  drops  evenly  into  the  well;  2)  adds   colour  to  the  sample  to  simplify  loading;  and  3)  contains  dyes  that  in  an  electric  field  move  toward  the   anode  at  predictable  rates.  In  this  laboratory,  we  are  making  use  of  mixtures  containing  xylene  cyanol  FF.     This  dye  migrates  in  0.5x  TBE    at  approximately  the  same  rate  as  linear  DNA  of  4000  bp  in  size.    Often,   bromophenol  blue  is  used  in  conjunction  with  xylene  cyanol,  or  separately.    Bromophenol  blue  migrates  at   approximately  the  same  rate  as  linear  DNA  of  300  bp  in  size  in  0.5x  TBE  (2.2  fold  faster  than  xylene  cyanol   FF,  independent  of  agarose  concentration).         • Load  the  remainder  of  the  samples  in  the  same  manner,  leaving  at  least  one  well  empty  (to  be  used  for  a   DNA  ladder).    Be  sure  to  RECORD  the  order  in  which  the  samples  were  loaded.       • Load  10  µL  of  the  ladder.     One  type  of  size  standard  is  produced  by  ligating  a  monomer  DNA  fragment  of  known  size  into  a  ladder  of   polymeric  forms.    The  2-­‐log  DNA  ladder  from  New  England  Biolabs  consists  of  a  mixture  of  a  number  of   proprietary  plasmids  digested  to  completion  with  different  restriction  enzymes.    Ladders  tend  to  be   19  
  21. 21. purchased  as  commercial  preparations.      For  an  example  please  see:   http://www.neb.com/nebecomm/products/productn3200.asp     • Turn  on  the  power  supply  and  set  the  voltage  to  100  V.    Place  the  lid  on  the  gel  and  start  the  run.    The  gel   will  run  for  30  minutes,  then  shut  off  automatically.     • After  the  run  is  complete,  turn  off  the  power.    Designate  one  group  member  to  put  on  gloves,  scoop  up  the   gel,  and  gently  slide  the  gel  into  the  ethidium  bromide  bath.     Caution:    Ethidium  bromide  is  a  mutagen  and  a  suspected  carcinogen.    At  very  dilute  concentrations  and   with  responsible  handling,  this  risk  is  minimised.     • Stain  the  gel  with  gentle  shaking  for  approximately  10  minutes.    One  group  member  again  should  put  on   gloves,  and  transfer  the  gel  to  the  gel  documentation  system.      View  using  the  UV  transilluminator.     Photographs  will  be  taken.    Please  ensure  that  you  bring  a  USB  memory  stick  so  that  you  can  obtain  the   photograph  of  your  gel  (these  will  NOT  be  emailed  out).     Caution:    Ultraviolet  light  is  damaging  to  naked  eyes  and  exposed  skin.    Always  view  through  filter  or   safety  glasses  that  absorb  harmful  wavelengths.     • Based  on  gel  results  and  quantification  of  your  DNA,  a  selection  of  samples  will  be  sent  off  for  sequencing.     In  order  to  facilitate  this,  use  a  piece  of  tape  to  completely  label  your  PCR  products  ensuring  that  the  label   corresponds  with  that  from  the  gel.        Thought  Questions   • What  factors  influence  DNA  migration  through  agarose?    Explain.   • Why  are  we  using  0.8%  agarose  for  resolution  of  our  PCR  products?   • Evaluate  your  gel  results  with  respect  to:    expected  fragment  sizes  and  reasoning,  and  control  results.    Do   we  have  evidence  to  suggest  that  we  were  successful  in  amplifying  16s  rDNA?    Explain  your  reasoning.     • What  are  some  of  the  advantages  and  disadvantages  of  molecular  techniques  for  identification  of  bacteria?     Compare  and  contrast  with  conventional  culturing  techniques.     20  
  22. 22. EXERCISE  4   WINOGRADSKY  COLUMNS  All  life  on  earth  can  be  categorized  based  on  what  carbon  and  energy  sources  they  utilize.    Phototrophs  obtain  energy  from  light  reactions,  while  chemotrophs  obtain  energy  from  chemical  oxidations  of  organic  or  inorganic  substances.    The  carbon  used  for  synthesis  can  be  obtained  directly  from  CO2  (autotrophs),  or  from  previously  existing  organic  compounds  (heterotrophs).      Combinations  of  these  categories  give  rise  to  the  four  basic  strategies  of  life:  photoautotrophs  (plants),  chemoheterotrophs  (animals  and  fungi),  photoheterotrophs  and  chemoautotrophs.    The  prokaryotic  bacteria  and  archaea  are  the  only  forms  of  life  where  all  four  life  strategies  can  be  observed.        Winogradsky  columns,  named  for  the  Russian  microbiologist  Sergei  Winogradsky  (1856-­‐1953)  are  model  ecosystems  that  can  be  used  to  study  the  diversity  of  life  strategies  employed  by  bacteria  and  archaea.    Columns  are  prepared  by  filling  glass  tubes  mostly  full  of  mud  supplemented  with  cellulose  (shredded  newspaper),  calcium  carbonate  and  calcium  sulphate.    Initially  there  are  low  numbers  of  organisms  present  in  the  column,  but  after  two  to  three  months  of  incubation,  many  different  types  of  organisms  proliferate  and  occupy  distinct  zones  within  the  column  where  environmental  conditions  favour  their  growth.      After  the  column  is  constructed,  it  is  sealed  and  left  in  the  dark  for  several  days  to  promote  the  growth  of  aerobic  heterotrophs,  which  will  utilize  the  cellulose  in  the  column  and  deplete  the  oxygen.    This  is  the  first  of  a  succession  of  organisms  that  will  inhabit  the  column.    The  column  is  then  placed  in  indirect  light.    Cyanobacteria  and  algae  may  appear  in  the  water  at  the  top  of  the  column,  providing  aerobic  conditions  resulting  from  the  production  of  oxygen  from  photosynthesis.    Large  populations  of  chemoautotrophic  bacteria  may  also  appear  in  this  region  (Thiobacillus,  Beggiatoa).    These  organisms  fix  carbon  dioxide  and  obtain  energy  by  oxidizing  H2S.    Conversely,  if  the  water  at  the  top  of  the  column  contains  only  small  amounts  of  oxygen,  it  may  appear  to  be  red  due  to  the  presence  of  purple  non-­‐sulphur  bacteria  (Rhodobacter,  Rhodospirillum).        The  anaerobic  mud  at  the  bottom  of  the  column  may  be  home  to  species  like  Cellulomonas,  which  degrades  cellulose  to  component  monosaccharides,  and  Clostridium  and  other  species  which  degrade  the  monosaccharides  to  organic  acids  such  as  lactacte  and  acetate.    Lactate,  along  with  the  sulphate  in  the  column,  is  utilized  by  sulphate-­‐reducing  bacteria  (Desulfovibrio),  producing  H2S.    The  H2S  may  react  with  metals  in  the  mud  to  produce  a  black  precipitate.    H2S  also  diffuses  up  through  the  column,  and  may  be  used  by  other  bacterial  populations,  including  the  phototrophic  purple  sulphur  bacteria  (Chromatium)  and  green  sulphur  bacteria  (Chlorobium).        METHODS:  For  each  lab:  • 100  mL  graduated  cylinders  • Mud  samples  • Source  of  cellulose  • CaCO3,  CaSO4,  K2HPO4  • Balance,  weigh  boats  and  spatulas  • Stirring  rods• Aluminium  foil• 250  mL  beakers 21  

×