Biología del Movimiento Dental

16,022 views
15,532 views

Published on

Aspectos moleculares, celulares y tisulares implicados en el movimiento dental ortodontico

Published in: Health & Medicine
0 Comments
20 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
16,022
On SlideShare
0
From Embeds
0
Number of Embeds
1,379
Actions
Shares
0
Downloads
0
Comments
0
Likes
20
Embeds 0
No embeds

No notes for slide

Biología del Movimiento Dental

  1. 2. <ul><li>Generalidades </li></ul><ul><li>Remodelado óseo </li></ul><ul><li>Mecanismos de movimiento dental </li></ul><ul><ul><ul><li>Presión - Tensión </li></ul></ul></ul><ul><ul><ul><li>Bone bending </li></ul></ul></ul><ul><ul><ul><li>Señales bioeléctricas </li></ul></ul></ul><ul><li>4. Procesos celulares y moleculares </li></ul><ul><ul><ul><li>El proceso inflamatorio </li></ul></ul></ul><ul><ul><ul><li>Transducción de señales </li></ul></ul></ul><ul><li>Conclusiones. </li></ul>CONTENIDO
  2. 3. El propósito del tratamiento dental ortodóntico es desplazar los dientes lo mas eficientemente posible con los mínimos efectos adversos posibles para el diente y los tejidos de soporte Introducción Martina von Bohl y Anne Marie Kuijpers-Jagtman (2008) . European Journal of Otrthodontics. 31: 30 - 36 Krishnan and Davidovitch, 2006; Masella and Meister, 2006; Meikle, 2006; Wise and King, 2008 Durante los últimos 100 años se han publicado muchos estudios relacionados con el movimiento dental ortodóntico y las reacciones celulares, tisulares y moleculares.
  3. 4. <ul><li>El movimiento dental por aplicación de fuerzas ortodónticas se caracteriza por el remodelado en los tejidos dentales y periodontales </li></ul><ul><li>Complejo dentinopulpar </li></ul><ul><li>Periodonto </li></ul>El movimiento dental fisiológico es el desplazamiento realizado por el diente para mantener su posición funcional; asociado a erupción, crecimiento dental y movimientos por fuerzas externas. Krishnan V, Davidovitch Z (2006) Am J Orthod Dentofacial Orthop 129, 469 e.1 – 469 e.26 GENERALIDADES El ligamento periodontal y el hueso alveolar resisten el movimiento dental.
  4. 5. El movimiento dental fisiológico es un proceso lento que ocurre principalmente en dirección vestibular gracias a regiones de tensión – presión en el periodonto El movimiento ortodóntico puede ocurrir rápida o lentamente según las características físicas de la fuerza aplicada y la respuesta biológica del ligamento periodontal (PDL): <ul><li>Alteraciones de la vascularización del PDL. </li></ul><ul><li>Alteraciones hemodinámicas y de la permeabilidad vascular. </li></ul><ul><li>Síntesis y liberación de mediadores bioquímicos y factores solubles. </li></ul>Reitan K. (1960) Am J Ortho. 46 881 - 890 . Neuropéptidos, citocinas, factores de crecimiento y metabolitos del ácido araquidónico
  5. 6. <ul><li>La fuerza ortodóntica: </li></ul><ul><li>Fuerza aplicada al diente con el propósito de efectuar un movimiento dental, con una magnitud de 20 – 150 g / diente. </li></ul><ul><li>Tratamiento ortodóntico para efectuar el movimiento dental mediante el remodelado y cambios adaptativos en el periodonto. </li></ul><ul><li>La fuerza ortopédica: </li></ul><ul><li>Fuerza destinada a producir un efecto esquelético en el complejo maxilofacial, con una magnitud de > 300 g. </li></ul><ul><li>Ortopedia craneofacial para modificar la forma de los huesos craneofaciales. </li></ul>Movimiento ortodóntico / Movimiento ortopédico
  6. 7. <ul><li>“ La fuerza que permite un cambio en la presión tisular similar a la presión sanguínea de los vasos capilares, para prevenir su oclusión en las regiones de compresión del ligamento periodontal” </li></ul><ul><li>Schwarz A. Int J Orthod. 1932 . 18: 331- 352. </li></ul><ul><li>Estímulos mecánicos extrínsecos que evocan una respuesta celular que busca restaurar la homeostasis mediante el remodelado de los tejidos periodontales de soporte. </li></ul><ul><li>Proffit W. R. Biologic basis of orthodontic therapy. 3 ed. 2000. Mosby </li></ul>Fuerza ortodóntica óptima Carga mecánica que permite el máximo movimiento dental con mínimo daño irreversible a la raíz, PDL y hueso alveolar (150 – 200 G. Oppenheim & Reitan; Storey & Smith)
  7. 8. Principales mecanismos propuestos: <ul><li>Teoría “PRESION – TENSION” </li></ul><ul><li>BONE BENDING </li></ul><ul><li>SEÑALES BIOELECTRICAS </li></ul>Masella R, Meister M. (2006) American Journal Of Orthodontics and Dentofacial Orthopedics 129: 458 – 468. Mecanismos de movimiento dental
  8. 9. <ul><li>ZONA PRESION: </li></ul><ul><li>Desorganización del PDL, disminución celular y de la producción de fibras, contracción vascular, reducción del flujo sanguíneo, hipoxia, reabsorción ósea </li></ul><ul><li>ZONA TENSION: </li></ul><ul><li>Estiramiento del PDL, aumento del número de células, incremento en la producción de fibras colágenas, inducción de la actividad osteoblástica </li></ul>Sandstet (1904); Oppenheim (1911); Schwarz (1932) TEORIA PRESION TENSION <ul><li>Reabsorción en áreas de presión y reabsorción indirecta o socavante (hialinización) en los espacios adyacentes de la medula ósea. </li></ul>
  9. 10. HIALINIZACION <ul><li>Presencia de núcleos picnóticos, </li></ul><ul><li>Zona acelular en el PDL. </li></ul><ul><li>Pérdida de la arquitectura tisular </li></ul><ul><li>Coloración eosinofila (hialina) </li></ul><ul><li>Células fagocitarias periféricas. </li></ul><ul><li>Actividad osteoclástica </li></ul><ul><li>Resorción ósea. </li></ul>HISTOLOGIA Las fuerzas ortodónticas no deben exceder la presión del lecho vascular capilar (20 -25 g/cm2 de superficie radicular)
  10. 11. HIALINIZACION Se asume que un sistema de fuerzas óptimo es importante para producir una respuesta biológica adecuada en el periodonto <ul><li>Tipo y magnitud de la fuerza </li></ul><ul><li>Storey and Smith, 1952; Reitan 1985; Maltha y col/2004 </li></ul><ul><li>Duración del tratamiento </li></ul><ul><li>Pilon y col/1996 </li></ul><ul><li>Respuesta individual </li></ul><ul><li>Von Bohl y Kuijpers, 2008 </li></ul><ul><li>Estado de salud del paciente </li></ul>
  11. 12. BONE BENDING El PDL es un sistema hidrostático continuo Farrar J N, 1888; Baumrind S, 1969. El flexionamiento del hueso alveolar juega un papel importante en el movimiento ortodóntico. Farrar J N, 1888. New York, De Vinne Press. 658 <ul><li>Cualquier fuerza distribuida a lo largo del PDL debería transmitirse equitativamente a lo largo de todas sus regiones </li></ul><ul><li>Las fibras del PDL no afectan la distribución por estar inmersas en la sustancia fundamental. </li></ul>Baumrind S (1969) American Journal Of Orthodontics. 55: 12 – 22
  12. 13. SEÑALES BIOELECTRICAS La aplicación de fuerzas mecánicas genera potenciales eléctricos en los tejidos implicados Basset CAL & Becker RO, Science. 1962 <ul><li>Se generan cargas en las macromoléculas que interactúan en sitios específicos o mobiliza iones a lo largo de las membrana celular. </li></ul><ul><li>El lado cóncavo del hueso sometido a tratamiento ortodóntico es ELECTRONEGATIVO y favorece la actividad osteoblástica. </li></ul><ul><li>Las superficies convexas son ELECTROPOSITIVAS / NEUTRAS muestran elevada actividad osteoclástica. </li></ul>Zengo AN, Basset CA et al (1974) American Journal Of Orthodontics. In vivo bioelectric potentials in the dentoalveolar complex. 66: 130 – 139
  13. 14. REMODELADO OSEO
  14. 15. MATRIZ EXTRACELULAR Fernández-Tresguerres I. (2006) Med Oral, Patol Oral, Cir Buc.11; 47 – 51. Fracción inorgánica: 65%. Cristales de Hidroxiapatita (Ca 10 (PO4) 6 (OH) 2 . Calcio, Fosfato y Carbonato. Proporción de 10:6:1 SIBLINGS Small Integrin Binding Ligand, N-Linked Glycoprotein
  15. 16. CELULAS IMPLICADAS <ul><li>FIBROBLASTOS </li></ul><ul><li>ENDOTELIO </li></ul><ul><li>OSTEOBLASTOS </li></ul><ul><li>OSTEOCITOS </li></ul><ul><li>OSTEOCLASTOS </li></ul><ul><li>CELULAS DE REVESTIMIENTO </li></ul><ul><li>(linning cells) </li></ul><ul><li>OTRAS </li></ul>
  16. 17. REMODELADO OSEO Renovación continu a de la matriz org á nica y mineral del hueso que involucra en primer lugar un aumento en la resorción y mas tarde reactiva la formación ósea que se efectúa en sitios especificos de actividad celular ciclica (BMU) . P ermite la renovación de un 5% del hueso cortical y un 20 % del trabecular al año. L a tasa de renovación es de un 5-10% del hueso total al año. El remodelado óseo existe toda la vida, pero sólo hasta la tercera década el balance es positivo. Frost, H.M., 1963. Bone Remodeling Dynamics, Charles C. Thomas, Springfield,
  17. 18. Fernández-Tresguerres I. (2006) Med Oral, Patol Oral, Cir Buc.11; 151 – 57.
  18. 19. E l proceso de modelado óseo (los huesos aumentan de longitud y diametro) carece de actividades ciclicas localizadas de acoplamiento entre resorción y formación sobre la superficie ósea en modelado. La resorción y la aposición óseas en el modelado óseo ocurren en superficies separadas; por lo tanto la activación en el modelado óseo puede efectuarse por resorción o formación óseas (Frost, 1973; Burr and Martin, 1989) MODELADO OSEO
  19. 20. HORMONAS CALCIOTROPAS HORMONAS INESPECIFICAS PTH VIT. D 3 (Calcitriol) CALCITONINA ESTROGENOS GLUCOCORTICOIDES <ul><li>Favorece la mineralización. </li></ul><ul><li>Absorción intestinal y renal de Ca2+ </li></ul>TIROXINA <ul><li>Estimula la resorción ósea </li></ul><ul><li>Adsorción intestinal y renal de Ca 2+ </li></ul><ul><li>Excreción renal de Ca2+ </li></ul><ul><li>Inhibe la resorción ósea </li></ul>REGULACION ENDOCRINA
  20. 21. PROCESOS CELULARES Y MOLECULARES
  21. 22. PROCESO INFLAMATORIO Mediadores bioquímicos 3 FASES DEL MOVIMIENTO DENTAL: Inicial, estacionaria, post estacionaria <ul><li>ALTERACIONES: </li></ul><ul><li>Hemodinámicas </li></ul><ul><li>Permeabilidad vascular </li></ul><ul><li>Celulares </li></ul>
  22. 23. La respuesta inflamatoria causa destrucción tisular Activación de linfocitos B, Linfocitos T, síntesis y liberación de mediadores químicos de la inflamación. Citocinas pro inflamatorias y factores de crecimiento asociados con la reabsorción ósea : IL-1 TNF- α Teng YT. (2003) Crit Rev Oral Biolo Med. 14: 237 - 252 REMODELADO OSEO - Depósito Resorción
  23. 24. <ul><li>Elevada actividad de remodelado del colágeno en el ligamento periodontal </li></ul><ul><ul><li>La perturbación de la función de los fibroblastos durante el proceso inflamatorio </li></ul></ul><ul><ul><li>Aumento de la expresión de MMP’s que degradan colágeno </li></ul></ul>Pérdida del tejido conectivo Bloqueo de mecanismos que controlan la destrucción tisular: Inhibidores Tisulares de las Metaloproteinasas de la Matriz
  24. 25. Factores solubles moduladores del remodelado óseo
  25. 26. OPG c-Fms- RANK- c-Fms+ RANK- c-Fms+ RANK+ TNF  , IL-1, IL-6, IL-7, otras IL’s OPG, RANKL, M-CSF HSC GCs Prostaglandinas, citocinas, IL’s y vitamina D M-CSF Estroma/osteoblastos RANKL TNF  T T E 2 T M-CSF RANKL + TGF  IFN  Dentina Hueso
  26. 27. Osteoclastos <ul><li>Célula Gigante Multinucleada. </li></ul><ul><li>Características ultra estructurales. </li></ul><ul><li>Actividad TRAP (+) </li></ul><ul><li>Responde a Calcitonina. </li></ul><ul><li>Expresión de RANK. </li></ul><ul><li>Integrina α v ß 3 </li></ul>FENOTIPO M.E.C
  27. 28. RANK RANK Borde rugoso Zona clara Zona clara Osteoclastos C-Fms C-Fms M.E.C HCO 3 - Cl - H + HCO 3 - Cl - Cat K  v  3 H + Cl - M.E.C
  28. 29. ............................. HCO 3 - Cl - H + HCO 3 - Cl - Cat K  v  3 H + Cl - M.E.C xxxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxx :: :: Estímulos Borde en cepillo :: . . . . . . . . . . . . M.E.C. Núcleo Microtúbulos  v  3 :: :: :: :: :: :: :: . . . . . . . .
  29. 30. Diferenciación y destino Apoptosis Adhesión Polarización Resorción Célula Stem Proliferación Diferenciación CSF-GM Fusión PTH, IL1, Vit. D
  30. 31. © American Society for Bone and Mineral Research. Primer, F. Patrick Ross, Ph.D.
  31. 32. Resorción ósea.
  32. 33. RANK = PRECURSORES DE OSTEOCLASTOS, OSTEOCLASTOS OPG = CELULAS DEL ESTROMA DE MEDULA OSEA, OSTEOBLASTOS, FIBROBLASTOS DEL LIGAMENTO PERIODONTAL RANK-L = OSTEOBLASTOS, CELULAS ESTROMALES DE LA MEDULA ÓSEA, FIBROBLASTOS RECEPTORES FAMILIA TNF Inhibidor de la activación y la diferenciación osteoclástica <ul><li>La interferencia con el sistema RANK/RANKL/OPG podría desencadenar el desequilibrio óseo: </li></ul><ul><li>>Formación ósea </li></ul><ul><li>> Resorción ósea. </li></ul>
  33. 34. REGULACION DEL SISTEMA RANKL/OPG/RANK.
  34. 35. RANK (Receptor of Nuclear Factor Kappa) y su ligando RANK-L: Diferenciación de preosteoclastos Activación y mantenimiento de osteoclastos. REMODELADO OSEO ALTERADO Goldring S R. (2003) inflammatory mediators as essential elements in bone remodeling. Calcif Tissue Int 73: 97-100
  35. 36. OSTEOCLASTOGENESIS
  36. 38. TRANSDUCCION DE SEÑALES
  37. 39. Juan Carlos Munévar N Definición Mecanismo por el cual una célula responde a los estímulos que recibe del medio ambiente mediante difusión de esas señales hacia sus compartimentos internos.
  38. 40. <ul><li>Sintesís de la molécula señal. </li></ul><ul><li>Liberación de la molécula señal </li></ul><ul><li>Transporte de la señal a la célula blanco </li></ul><ul><li>Deteccción de la señal por una proteína receptora especifica. </li></ul><ul><li>Cambio en el metabolismo celular, en la función, o desarrollo desencadenado por el complejo señal – receptor. </li></ul><ul><li>Remoción de la señal, lo cual termina usualmente la respuesta celular </li></ul>ETAPAS DE LA COMUNICACIÓN CELULAR POR SEÑALES EXTRACELULARES
  39. 45. Señalización RANK RANK / RANKL <ul><li>MyD88 </li></ul><ul><li>(adaptador) </li></ul><ul><li>IRAKs </li></ul><ul><li>(IL-1RI associated kinases) </li></ul><ul><li>TAK1 </li></ul><ul><li>(TGFB activated kinase) </li></ul><ul><li>TAB1 / 2 </li></ul><ul><li>(TAK binding protein) </li></ul><ul><li>TRAF6 </li></ul><ul><li>(TNF receptor associated factor 6) </li></ul>RANK
  40. 46.  v  3 c-Fms RANK TNFR1 IL1-R1 ERKs ERKs Mitf P c-src PI3K AKT C S D JNK AP1 NFATc1 D p38 Ca ++ CaM c-src PI3K AKT C S NF  B D JNK AP1 D NF  B D NFATc1 IKK  IRAK E2F = Cinasa = Factor de Transcripción P = Proliferación C = Reorganización del citoesqueleto S = Supervivencia D = Diferenciación CN
  41. 47. Papel de la transdución de señales en la regulación de la expresión de genes
  42. 49. <ul><li>Estructura de la cromatina </li></ul><ul><li>Inicio de la transcripción </li></ul><ul><li>Procesamiento y modificación del transcrito </li></ul><ul><li>Transporte del ARNm </li></ul><ul><li>Estabilidad del transcrito </li></ul><ul><li>Inicio de la traducción </li></ul><ul><li>Modificaciones post - traduccionales </li></ul><ul><li>Transporte de proteínas </li></ul><ul><li>Control de la estabilidad proteíca </li></ul>REGULACION DE LA EXPRESION DE GENES.
  43. 50. Heterodímero inactivo en el citosol: 2 subunidades p50 / p65 asociado con un inhibidor I  B Expresión génica p50 / p65 Poseen dominios que reconocen motivos específicos de ADN. Análogos de AMPc NF- B k Factor de Transcripción activado por: Citocinas Factores de crecimiento Esteres de forbol Lipopolisacáridos TNF Ácido Okadaico
  44. 51. Factor de Transcripción con dominios que reconocen motivos específicos de ADN. NFkB se transloque al núcleo Motivo  B en el ADN Secuencias promotoras / enhancers La disociación del complejo p50 / p65 / IkB : NF- B k I  B Inactivado por PKC / PKA Fosforilación / Desfosforilación 5’-GGGPuNNPiPiCC-3’
  45. 52. Genes con motivo  B <ul><li>IL-6 </li></ul><ul><li>GM-CSF </li></ul><ul><li>Interferón  </li></ul><ul><li>Regula: </li></ul><ul><li>Expresión de citocinas </li></ul><ul><li>Proliferación celular </li></ul><ul><li>Diferenciación celular </li></ul><ul><li>Respuesta inflamatoria </li></ul><ul><li>Respuesta inmune </li></ul>Linfocitos T y B Actividad antiviral / antiproliferativa Activación de neutrófilos, macrófagos Sensible a estímulos que señalan un proceso inflamatorio NF- B k
  46. 53. La transcripción de genes activados por el AMPc está regulada por FACTORES DE TRANSCRIPCION que se unen al elemento de respuesta CRE en el ADN. CRE: AMPc response element. CREB Expresión génica
  47. 54. GENES CON MOTIVO C.R.E. 1. Enzimas metabolismo intermedio 2. Péptidos Bioactivos. 3. Fibronectina plasmática. 4. Proto oncogen c-fos 1. Tiroxina hidroxilasa 2. Somatostatina
  48. 55. MOTIVO C.R.E. Motivos octaméricos Secuencia CONSENSUS: 5’-TGACGTCA - 3’ Elementos de respuesta al AMPc del ADN CREB : CRE BINDING PROTEINS . Factores de transcripción de genes que poseen el motivo C.R.E. Localización: 1. Núcleo celular. 2. Fosforilados por PKA
  49. 56. MECANISMO DE ACCION. 1. La P.K. A fosforila las proteínas CREB. 2. Factores de Transcripción se une a C.R.E. 3. TRANSCRIPCION DE GEN ESPECIFICO > [cAMP]° inducen la translocación de la subunidad catalítica P.K. A
  50. 57. EXPRESION DE GENES. Los factores de transcripción C.R.E.B pueden ser fosforilados por: 1. P.K.A (Células mesenquimatosas.) 2. Quinasas I y II Ca2/Calmodulina (Neuronas.) Transcripción de genes distintos.
  51. 58. FACTOR MOTIVO INFORMACION C-Myc / Max CACGTG C-Myc: oncogen retroviral, se asocia con Max. c-Fos / c-Jun TGAC/GTC/AA Oncogenes retrovirales Factor AP-1 CREB TGACGC/7C/AG/A Une a CRE, familia de al menos 10 factores, dímeros con c-Jun C-ErbA; (TR: Receptor de la hormona Tiroidea) G/CA/CGGAA/TGT/C Oncogen retroviral, miembro de la superfamilia de receptores hormonales esteroides/tiroides C-Ets G/CA/CGGAA/TGT7C Oncogen retroviral predominante en células B y T GATA T/AGATA Familia de factores específicos de líneas eritroides C-Myb T/CAACG/TG Oncogen retroviral, factor especifico de células hematopoyéticas NFkB & c-Rel GGGAA/CTNT/CCC c-Rel: Oncogen retroviral, predominan en células B y T RAR ACGTCATGACCT Une elementos RARES, así como sitios c-Jun / c-Fos SRF (Serum response factor) GGATGTTCCATATTAGGACATCT Presente en genes inducibles por factores de crecimiento presentes en suero ISGF3 (Interferon  stimulated gene factor 3) A/GGAAAA/GNGAAACT Activación por proteínas quinasa. El motivo ISRE presente en genes de respuesta antiviral y antitumoral
  52. 60. FORMACION OSEA
  53. 61. OSTEOBLASTOS <ul><li>Célula Polarizada, diferenciada y especializada </li></ul><ul><li>Vesículas matriciales. </li></ul><ul><li>Cbfa-1 (Runx-1/2) </li></ul><ul><li>Actividad PAL (+) </li></ul><ul><li>Responde a PTH </li></ul><ul><li>Expresión de RANKL. </li></ul><ul><li>Sintesís de OPG, proteínas colágenas y no colágenas óseas </li></ul>http://depts.washington.edu/bonebio/ASBMRed/cells.html#oclasts FENOTIPO
  54. 62. Osteoblasto Mesenquima Alberts et al. Mol Bio. Cell, 4th Ed. Osteoblastos Producción MEC Mineralización/Osteoide maduración ~10días Osteocito Apoptosis
  55. 63. Factores solubles Endocrina Paracrina Autocrina Hormona Paratiroidea (PTH) (  resorción ósea*) Proteína relacionada PTH TGF β 1, 2, 3 Vitamina D (  resorción ósea*) Factores de crecimiento transformante (TGF) β 1,2,3 FGF 1, 2 Calcitonina (  resorción ósea*) Factor de crecimiento fibroblástico (FGF) 1, 2 IGF´s Glucocorticoides IGF’s PDGF’s Esteroides (E, T) Proteínas óseas morfogéneticas (BMP) 2-7 BMP 2-7 Insulina (PDGF’s) OTROS Interleucina-6
  56. 64. BIOMINERALIZACION
  57. 65. DEFINICIÓN Precipitación de sales insolubles de fosfato de Calcio inducida por los productos de metabolismo celular. <ul><li>Mineralización Controlada: </li></ul><ul><li>Intracelular (Vesículas) </li></ul><ul><li>Epicelular ( Bacterias) </li></ul><ul><li>Extracelular ( M.E.C) </li></ul>ETAPAS: 1 .Nucleación 2. Crecimiento Cristalino BIOMINERALIZACION Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca
  58. 66. Mecanismos Controlados <ul><li>Químicamente </li></ul><ul><li>Biológicamente </li></ul><ul><li>Control Químico </li></ul><ul><li>Paso de iones a través de la </li></ul><ul><li>membrana. </li></ul><ul><li>Regulación enzimatica. (Anhidrasa </li></ul><ul><li>Carbónica) </li></ul><ul><li>Aporte de iones exteriores </li></ul><ul><li>Agua </li></ul><ul><li>Control Biológico </li></ul><ul><li>Presencia de proteínas de M.E.C </li></ul><ul><li>Son sitios de nucleación o controlan la </li></ul><ul><li>talla y morfología de los cristales. </li></ul><ul><li>Mecanismos Físico Químicos </li></ul><ul><li>Regulan la especificidad de los tejidos </li></ul><ul><li>formados </li></ul>
  59. 67. NUCLEACION En todo sistema biológico encontramos dos fases químicas diferentes (Fase Orgánica y una Fase Inorgánica). EQUILIBRIO Ruptura de equilibrio Transformación de masas Sobresaturación La concentración de las dos fases Tejidos Conectivos, epitelio, Etc. Las partículas neoformadas crecen hasta un tamaño critico en donde los núcleos no podrán disolverse
  60. 68. FASES MINERALES <ul><li>Numerosos fenómenos biológicos de mineralización tisular. </li></ul><ul><li>Los tipos de minerales implicados son restringidos. </li></ul>TEJIDOS DUROS Minerales en forma cristalina Calcita Aragonita Ácido sílico coelestina apatita witlockite
  61. 69. Los fosfatos de calcio poco solubles (apatita) son de gran interes por ser componentes del esqueleto y la dentina FASES MINERALES Calcita Aragonita Ácido silico coelestina apatita witlockite Fosfato octacálcico CaC03, Moluscos, artrópodos, Diatomeas. Radiolares Dientes, esqueleto Calcificaciones patológicas.
  62. 70. TEORIAS <ul><li>La formación de la fase mineral en un tejido calcificado no es un fenómeno biológico fortuito. </li></ul><ul><li>Correlación entre precipitación mineral & desarrollo tisular general </li></ul>Ej: PRECIPTACION DENSA, cristales HA alrededor de la trama colágena del hueso compacto <ul><li>Coincidencia entre el depósito mineral, la presencia de células y eventos metabólicos específicos </li></ul><ul><li>Macromoléculas no colágenas (osteocalcina, </li></ul><ul><li>fosfoproteínas, fosfatasa alcalina, amelogeninas) </li></ul>¿Las interacciones moleculares y los procesos físico-químicos...?
  63. 71. <ul><li>Iones circulantes en mamíferos permanecen en rápido intercambio con el esqueleto. </li></ul><ul><li>La concentración plásmatica: Ca 2 = 1,3 mM </li></ul><ul><li> HPO 4 2- = 1 mM </li></ul>Posición del problema b). Los hechos: <ul><li>Gran número de compuestos fosfocálcicos que pueden ser sintetizados, aislados y estudiados (métodos analíticos y estructurales) </li></ul><ul><li>Compuestos inestables a pH 7, recristalizan en medio acuoso a un estado sólido termodinámicamente estable = Hidroxiapatita. </li></ul>a). Tipo de mineral: MECANISMOS
  64. 72. <ul><li>SISTEMA DE CONTROL SELECCIONADO POR EL PROCESO DE EVOLUCION </li></ul><ul><li>flexible y controlable por la actividad celular </li></ul><ul><li>La solubilidad del hueso es constante y en equilibrio con el plasma sanguíneo. </li></ul><ul><li>[Ca 2 + ] , [HPO 4 2- ], [OH - ] interrelacionadas e influenciadas por la alimentación. </li></ul><ul><li>Las concentraciones permanecen en límites estrechos </li></ul><ul><li>( metabolismo de órganos y células ) </li></ul><ul><li>La fase mineral del esqueleto constituye un tampón para esos iones </li></ul><ul><li>(homeostasis intestinal y renal) </li></ul><ul><li>Durante el crecimiento la mineralización se produce en zonas nuevas </li></ul>Exigencias biológicas
  65. 73. DEFINICIONES <ul><li>NUCLEACION: Paso de una fase líquida al estado sólido. </li></ul><ul><li> Formación del primer núcleo sólido o germen. </li></ul><ul><li>NUCLEACION HOMOGENÉA: Cuando el medio mineralizable está LIBRE de cualquier elemento diferente al calcio o fosfato. </li></ul><ul><li>NUCLEACION HETEROGENÉA: Cuando el medio mineralizable CONTIENE partículas o elementos diferentes al calcio o fosfato que poseen un efecto catalizador </li></ul><ul><li>Nucleación Primaria: Es la nucleación homogénea y heterogénea. </li></ul><ul><li>Nucleación Secundaria : Es aquella que se produce en presencia de un cristal que ya está en solución. </li></ul><ul><li>EPITAXIA: Crecimiento de un cristal en contacto de otro material cristalino que actúa como un esbozo. </li></ul>
  66. 74. La sobresaturación del medio y el aumento de la energía dominan la biomineralización. En los sistemas biológicos la nucleación se efectúa a temperaturas moderadas en interfases heterogéneas Matriz inducida Sistema biológicos primitivos NUCLEACION Matriz Mediada Tejidos Calcificados M.E.C sirve de sitio de nucleación y dirige la orientación de los cristales <ul><li>La preorganización de la matriz es </li></ul><ul><li>de varios tipos: </li></ul><ul><li>Polimerización Controlada </li></ul><ul><li>Ensamble de proteínas </li></ul>
  67. 75. NUCLEACIÓN HOMOGÉNEA Aumento local de iones orgánicos, para permitir la precipitación espontánea del los cristales. NUCLEACION Ca Ca Ca La presencia de sustancias de nucleacion (sustancias que disminuyen el aporte de energía necesario para la mineralización) también puede llevar a la formación de cristales en ausencia de un incremento local de la concentración de iones. Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca Ca NUCLEACIÓN HETEROGENEA
  68. 76. INICIO DE LA MINERALIZACION ¿Como a partir de una solución iónica por debajo del producto de solubilidad se puede constituir una fase sólida? MECANISMO BOOSTER Por medio del cual se produce un aumento del producto iónico por encima del nivel de precipitación espontánea. <ul><li>COMPARTIMENTOS </li></ul><ul><li>(sitios donde aumenta la concentración de iones) </li></ul>1. COMPARTIMENTOS VERDADEROS 2. ZONAS ASIMILABLES A COMPARTIMENTOS A. VESICULAS MATRICIALES B. MITOCONDRIAS (DRIENSSENS 1982)
  69. 77. 1. VERDADEROS <ul><li>Organelos membranosos intracelulares de 25 - 200 nm de diámetro, PAS +. </li></ul><ul><li>Contienen glucoproteínas, lípidos, proteoglucanos, y una fuerte actividad PAL </li></ul><ul><li>Las membranas concentran Ca 2+ </li></ul><ul><li>Los primeros depósitos minerales se localizan dentro y alrededor de las vesículas. </li></ul><ul><li>Los agregados crecen hasta formar NODULOS DE CALCIFICACION. </li></ul><ul><li>Presentes alrededor de condrocitos, en el hueso esponjoso medular, no se observan en ESMALTE dental . </li></ul>COMPARTIMENTOS (sitios donde aumenta la concentración de iones) B. MITOCONDRIAS <ul><li>Concentran Ca 2+ para liberarlo súbitamente y que reaccione con el fósforo inorgánico abundante en el citosol. (FOSFATO DE CALCIO). </li></ul>
  70. 78. + El inicio de la nucleación se podría hacer a partir de pequeños nódulos cristalinos desprendidos de los cristales HA existentes. + Esos nódulos quedan atrapados en los espacios colágenos para permitir el crecimiento del cristal. 2. ZONAS ASIMILABLES A COMPARTIMENTOS COMPARTIMENTOS <ul><li>ESPACIOS DE COLAGENO (grupos químicos reactivos) </li></ul><ul><li>+ Los iones se acumulan a lo largo de las fibras colágeno. + Existe una estrecha relación entre las fibrillas de colágeno y las sustancias inorgánicas desde las primeras etapas de la mineralización. </li></ul>LAS FIBRILLAS SE CONSIDERAN INDUCTORES Y REGULADORES DE LA MINERALIZACION. GLIMCHER, 1976
  71. 79. INICIO DE LA MINERALIZACION ¿Como a partir de una solución iónica por debajo del producto de solubilidad se puede constituir una fase sólida? INTERVENCION DE INICIADORES MOLECULAS ORGÁNICAS A. FOSFOPROTEINAS B. PROTEINAS ACIDAS C. FOSFOLIPIDOS ACIDOS D. COLAGENO <ul><li>Fuerte afinidad por el Ca 2 , para formar un complejo terciario con el Ca 2 y P0 4 (SITIOS DE NUCLEACION). Se fijan cerca de los espacios de colágeno. </li></ul><ul><li>La Osteocalcina (proteína ácido γ carboxiglutámico se observan en donde los cristales HA se orientan a lo largo de la matriz colágeno) </li></ul><ul><li>Inducen in vitro la formación de HA en una solución saturada de fosfato de calcio. (fosfatidilserina / Inositol) </li></ul><ul><li>En tejidos duros contiene fosfato, potenciales sitios de inicio de la mineralización. Las proteínas ligadas al colageno tienen fuerte afinidad por las APATITAS. </li></ul>
  72. 80. INICIO DE LA MINERALIZACION ¿Por qué los tejidos que contienen nucleadores potenciales NO se mineralizan o bien por qué la mineralización se produce en momentos específicos? <ul><li>Al bloqueo de sitios de nucleación </li></ul><ul><li>A la competencia con iones indispensables, impidiendo la precipitación </li></ul><ul><li>de fosfato de calcio, el crecimiento y agregación de cristales. </li></ul>INTERVENCION DE INHIBIDORES A. PIROFOSFATOS B. MAGNESIO & CITRATO <ul><li>Los iones P 2 O 7 ocupan los sitios del fosfato HPO 2- inhibiendo a baja [ ]º la precipitación de fosfato de calcio. La PAL presenta actividad pirofosfatasica. </li></ul><ul><li>Impiden la evolución de la fase amorfa mineral hacia la morfología cristalina. </li></ul>C. PROTEOGLICANOS <ul><li>Son un obstáculo, al despolimerizarse se desactiva la inhibición. </li></ul>
  73. 81. CRECIMIENTO CRISTALINO 6 Etapas: <ul><li>Creación de reactivos </li></ul><ul><li>Transporte de iones </li></ul><ul><li>Adsorción a la superficie cristalina </li></ul><ul><li>Nucleación </li></ul><ul><li>Crecimiento del cristal </li></ul><ul><li>Eliminación de iones superfluos </li></ul>Predominio de la interfase sólida a la liquida EPITAXIA Formación de una nueva fase cristalina en la superficie de un cristal Fenómeno que facilita la formación de un 2do cristal
  74. 82. CRECIMIENTO DEL CRISTAL Aumento de la masa mineral que determina la NATURALEZA, NUMERO, TALLA Y FORMA de los cristales. Los procesos de regulación involucran: <ul><li>INTERACCIONES CON MOLECULAS ORGANICAS O MINERALES: ATP, PPi, Mg 2+ , F - , fosfoproteínas, proteínas séricas, proteínas ácidas, fosfolípidos ácidos, colágeno. </li></ul><ul><li>FASE TERMINAL ESTABLE </li></ul><ul><li>AUMENTO DEL ESPACIO DISPONIBLE DEBIDO A LA DEGRADACIÓN DE PROTEOGLICANOS O AMELOGENINAS. </li></ul>FASES: Fosfato octocálcico. HIDROXIAPATITA (Ca 2+ ) + (Pi) Brushita Fosfato de calcio amorfo
  75. 83. CRECIMIENTO DEL CRISTAL 1. Control de la velocidad y repartición del crecimiento en cuanto a la talla y número de cristales. Diferencia en el crecimiento en longitud y espesor de un cristal (ESMALTE DENTAL) 2. Control del cese de crecimiento; cuando se define la talla y forma de los cristales se observa la detención del crecimiento. TEORIAS Los parámetros físico-químicos no son los únicos que controlan el crecimiento del cristal. CONTROL PROTEICO In vitro # In vivo
  76. 84. BIOMINERALIZACION DENTAL TEJIDOS DENTALES MINERALIZADOS : <ul><li>Dentina </li></ul><ul><li>Cemento </li></ul>ESTRUCTURA DENTAL MINERALIZADA : <ul><li>Proceso de envejecimiento. </li></ul><ul><li>Patologías </li></ul>PULPA DENTAL <ul><li>Esmalte </li></ul><ul><li>Proceso exclusivo del organismo </li></ul><ul><li>Proceso común de algunos tejidos conectivos. </li></ul>Colágeno, Proteínas no colágenas Proteínas específicas <ul><li>Proceso de mineralización especifico </li></ul>
  77. 85. CEMENTO <ul><li>Intertubular. </li></ul><ul><li>Peritubular </li></ul><ul><li>Circumpulpar </li></ul><ul><li>Manto </li></ul>DENTINA <ul><li>El proceso de mineralización es especifico </li></ul><ul><li>Microestructuras derivadas de la célula </li></ul><ul><li>Vesículas matriciales. </li></ul><ul><li>Debris celulares. </li></ul><ul><li>M.E.C. secretada por la célula </li></ul>El PO 4 y Ca 2+ se acumulan, se combinan y estabilizan para formar HIDROXIAPATITA BIOMINERALIZACION
  78. 86. Estructura derivada de la célula o la matriz Tejido dental Componentes implicados Microestructuras celulares Mineralización inducida por la M.E.C. Vesículas matriciales Mineralizaciones intracelulares Débris celulares Manto dentina Cemento acelular Pulpolitos Fosfolípidos mb. Proteoglicanos. Anexina I. Fosfolípidos mb. Proteoglicanos. M.E.C. Proteínas colagenas no colagenas Dentina Intertubular Cemento celular acelular Colágenos I,V,VI P. Fosforiladas DSP no fosforilada Proteoglicanos Proteína GLA fosfolípidos Proteínas séricas Factores de crecimiento proteínas no colagenas M.E.C. Dentina Peritubular Esmalte Amelogeninas Enamelinas Lípidos Proteoglicanos Glicoproteínas
  79. 87. MICROESTRUCTURAS DERIVADAS DE LA CELULA 1. Vesículas matriciales 2. Débris celulares <ul><li>Protrusiones /fragmentaciones celulares, que se observan al inicio de mineralización. </li></ul><ul><li>( Dentina de Manto, inicio de cementogénesis) </li></ul><ul><li>Organelos asociados a la membrana celular, trilaminados, 30-200 nm de diámetro. </li></ul><ul><li>(lugares iniciales de mineralización.) </li></ul><ul><li>Composición y propiedades químicas específicas diferentes a la membrana celular. ANEXINA II. </li></ul><ul><li>( se originan de la membrana celular) </li></ul><ul><li> ( Calcio y fosfato inorgánico) </li></ul><ul><li>ENZIMAS </li></ul><ul><li>PAL y Pirofosfatasa </li></ul><ul><li>Adenosintrifosfatasa </li></ul><ul><li>Nucleótido-3fosfato pirofosfohidrolasa. </li></ul><ul><li>Metaloproteinasas </li></ul><ul><li>FOSFOLIPIDOS </li></ul><ul><li>Fosfatidilserina. </li></ul><ul><li>Esfingomielina. </li></ul><ul><li>Glucoesfingolípidos </li></ul><ul><li>Colesterol libre </li></ul>
  80. 88. <ul><li>Estas enzimas producen un  de la concentración de fosfato orgánico dentro de la vesículas matriciales. </li></ul><ul><ul><li>Anexina II (proteína dependiente de fosfolípidos y fijadoras de Ca ++ ) </li></ul></ul><ul><ul><li>Los fosfolípidos son distintos de aquellos de la membrana celular </li></ul></ul><ul><ul><ul><li>  fosfatidilserina </li></ul></ul></ul><ul><ul><ul><li>Esfingomielina </li></ul></ul></ul><ul><ul><ul><li>Glucoesfingolípidos </li></ul></ul></ul><ul><ul><ul><li>Colesterol libre </li></ul></ul></ul><ul><ul><ul><li>No poseen fosfatidilcolina </li></ul></ul></ul>
  81. 89. <ul><li>Grandes cantidades de Ca ++ y fosfato inorgánico presentes en las vesículas matriciales </li></ul><ul><li>En los períodos iniciales de calcificación se observa en el cartílago en crecimiento dentro de las vesículas matriciales. (Fosfato octacálcico) </li></ul><ul><li>En etapas tardías el mineral cristalino adopta la apariencia de la H.A. </li></ul><ul><li>(Bonucci, 1967; Anderson 1967) </li></ul>
  82. 90. ¿Porque los fluidos tisulares sobresaturados en iones de Fosfato y de calcio no se mineralizan? <ul><li>Por la presencia de macromoléculas que inhiben la formación de cristales. </li></ul><ul><li>Por el porcentaje de iones necesarios para formar nódulos mineralizados es inestable </li></ul><ul><li>La formación de los nódulos requieren el consumo de energía </li></ul><ul><li>Inhibidores de la mineralización aumenta la energía requerida. </li></ul>BIOMINERALIZACION
  83. 91. Este es un proceso altamente controlado. Esta mineralización no solo envuelve el colágeno como sustrato sino que también proteínas no colágenas ( son iniciadoras de la mineralización) de la matriz secretadas al frente de mineralización . En los tejidos conectivos calcificados existen dos mecanismos para la mineralización Vesículas Matriciales Nucleacion Heterogénea Pequeño organelo intracelular membranoso donde se observa la primera evidencia morfológica de un cristal BIOMINERALIZACION
  84. 92. <ul><li>Los iniciadores de la mineralización: </li></ul><ul><li>PROTEOGLUCANOS </li></ul><ul><li>Estas moléculas se depositan en los espacios localizados entre las fibras de colágeno. </li></ul><ul><li>Los proteoglucanos unen el calcio extracelular </li></ul><ul><li>Las proteoglucanasas eliminan a los proteoglucanos, dejando el calcio depositado entre las fibras colágenas </li></ul><ul><li>Las fosfoproteinas se unen al colágeno </li></ul><ul><li>Presencia de una actividad fosfatasa alcalina ( PAL +) </li></ul><ul><li>* Desfosforilacion de las </li></ul><ul><li>fosfoproteinas </li></ul><ul><li>* Aporte adicional de iones fosfato </li></ul><ul><li>( necesarios para la nucleacion y </li></ul><ul><li>crecimiento cristalino) </li></ul>BIOMINERALIZACION
  85. 93. <ul><li>Localización: </li></ul><ul><li>En la membrana celular de osteoblastos, </li></ul><ul><li>odontoblastos, cementoblastos, </li></ul><ul><li>en los vasos sanguíneos, en la matriz orgánica, </li></ul><ul><li>en las vesículas matriciales. </li></ul><ul><li>Función: </li></ul><ul><li>Hidroliza iones fosfato de radicales orgánicos </li></ul><ul><li>a pH alcalino. </li></ul><ul><li>El papel en la mineralización no esta claro: </li></ul><ul><li>El termino PAL+ no es especifico. </li></ul><ul><li>Las enzimas tienen más de una </li></ul><ul><li>función en la mineralización. </li></ul><ul><li>Desempeña un papel en transporte de iones. </li></ul><ul><li>Provee iones fosfato a los sitios de mineralización </li></ul><ul><li>Participa en el crecimiento cristalino. </li></ul>BIOMINERALIZACION FOSFATASA ALCALINA Asociada con la formación de tejidos mineralizados
  86. 94. COMO LLEGA EL MINERAL AL SITIO DE MINERALIZACIÓN 1. Papel de proteoglicanos 2. Síntesis de colágeno 3. Vía de iones inorgánicos entre células. Presumiblemente unidas a macromoléculas 4. Vía iones inorgánicos dentro de la célula. 5. Participación mitocondrial
  87. 95. CONCLUSIONES <ul><li>Los avances en biología nos permiten comprender mejor los mecanismos celulares, moleculares y genéticos involucrados en el movimiento dental ortodóntico. </li></ul><ul><li>Este estado del arte en el conocimiento científico permitirá desarrollar tratamientos ortodonticos óptimos y eficientes sin causar daño a los dientes y tejidos periodontales, ni molestias al paciente. </li></ul>
  88. 96. Dr. Juan Carlos Munévar N. INSTITUTO U.I.B.O. FACULTAD DE ODONTOLOGIA

×