The Tria Project: Genomics of the Mountain Pine Beetle System
Upcoming SlideShare
Loading in...5
×
 

The Tria Project: Genomics of the Mountain Pine Beetle System

on

  • 1,526 views

This is a presentation given by Dr.Janice Cooke to the Genome Alberta Board of Directors on Sept,25, 2012.

This is a presentation given by Dr.Janice Cooke to the Genome Alberta Board of Directors on Sept,25, 2012.

Statistics

Views

Total Views
1,526
Views on SlideShare
827
Embed Views
699

Actions

Likes
0
Downloads
2
Comments
0

4 Embeds 699

http://genomealberta.ca 695
http://masterate2.rssing.com 2
http://ps27.sb.marqui.com 1
http://ranksit.com 1

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment
  • Spatially delinate adaptive variation on the landscape (associating selected loci with variables, application to other aspects of forest management

The Tria Project: Genomics of the Mountain Pine Beetle System The Tria Project: Genomics of the Mountain Pine Beetle System Presentation Transcript

  • The Tria Project: Genomics of the Mountain Pine Beetle System Janice Cooke and the Tria Consortium
  • OutlineState of the mountain pine beetle outbreak: context forusing a genomics approach in combatting the epidemic Introduction to the Tria Project and the Tria Team Key outcomes from the Tria Project to date  Filling knowledge gaps and making discoveries  Linking genomics and risk assessment  Using genomics to inform policy makers and forest managers Perspectives and future directions
  • Unprecedented spread of mountain pine beetle during the current outbreak 10 µm 10 µm Adrianne Rice Jack Scott, University of Alberta
  • Unprecedented spread of mountain pine beetle during the current outbreak Data: Little (1971); S. Taylor, G. Thandi, D. Yemshinov (Canadian Forest Service)
  • The Tria Project: A large-scale multidisciplinary collaborative effort MPB vector How gene Genetic variation products work across landscapes Jack Scott Physiological Stakeholders Population & Functional & End Users Genomics Genomics PolicyGenomic Environmental Pine Fungal development;Resources & Economic Forest host pathogen Risk Models management and spread control programme Ecology planning Janice Cooke Adrianne Rice How organisms function & interact in nature
  • The Tria Project:A large-scale multidisciplinary collaborative effort University of Alberta University of British Columbia University of Northern British Columbia Natural Resources Canada – Canadian Forest Service Michael Smith Genome Sciences Centre – BC Cancer Agency University of Minnesota
  • Genomic resources Bohlmann, Breuil, J Re Cooke, Hamelin, Huber, Jones, Keeling, Murray, Sperling UBC, UNBC, UA, BCGSC Functional & Population Ecosystem Risk physiological genomics ecology modeling, monit genomics oring & Sperling, assessment Stakeholders Mountain Huber, Keeling Erbilgin, Coltman, and Endusers pine Bohlmann Evenden Murray beetle UNBC, UBC B. Cooke, Policy UA, UNBC UA, UBC Aukema, development; Hauer, Forest Breuil, Hamelin, Sper Breuil, K Lewis Lewis management Fungal Bohlmann ling J. Cooke, Erbilgin and spreadassociates UA, CFS, control UBC UBC, UA UBC, UNBC, UA UMinn programme planning J Cooke, Coltman, Erbilgin, Pines Bohlmann J Cooke K Lewis UA, UBC UA UA, UBC Huber, Breuil, Coltman, Erbilgin, J Cooke, Sperling, EvendenInteractions Bohlmann Hamelin UNBC, UBC, UA UA, UNBC UA, UBC
  • Genomes and Genomic Resources Chromosomes Genetic linkage map (relative positions of gene-based or anonymous markers) Genome sequence Expressed gene sequences …AAGAGAGCCTGTCGCTAAATGCAAGCCTTGAGTACC…(Adapted from Paul & Ferl, 2000)
  • Sequence data enables high-throughput analyses ofmany genes and/or many individuals simultaneously Physiological genomics: monitoring large numbers of genes simultaneously for gene activity levels
  • Sequence data enables high-throughput analyses ofmany genes and/or many individuals simultaneously Population genomics: assessing genetic variation in large numbers of individuals simultaneously Gene Markers A B C … n A/A A/G G/G 1 Individuals 2 3 … n
  • Tria-Generated Genomic Resources Mountain Fungal spp. Pines – lodgepole Pine Beetle and jack pine Mountain Pine Beetle Whole genome Draft High-quality reference plus Nosequence  Draft whole genome sequence additional strains (G. clavigera); Draft (O. piceae)  Expressed gene sequences Jack ScottExpressed gene Yes Yes (G. clavigera, O. piceae) Yessequences  Expressed gene sequence clonesExpressed gene  Microsatellite markers Yes Yes (G. clavigera) Yessequence clones  Single nucleotide polymorphism gene markersMicrosatellite markers Adrianne Rice Yes Yes – multiple spp. Yes  Protein “fingerprints”Single nucleotide Yes Yes – multiple spp. Yespolymorphism genemarkersProtein “fingerprints” Yes No NoHigh-throughput gene Janice Cooke Ref-Seq Ref-Seq Microarraysexpression tools
  • Genomic resources enabled Tria researchers to document beetle spread into jack pine
  • Lodgepole and jack pine can be difficult to tell from hybrids, and the hybrid zone was not well-defined Catherine Cullingham, University of Alberta
  • Using molecular markers to distinguishlodgepole pine, jack pine and their hybrids Lodgepole pine Jack pine Hybrid Catherine Cullingham, University of Alberta
  • Pine marker analyses revealed mountain pine beetle range expansion into jack pine Catherine Cullingham, University of Alberta
  • Bringing a regional issue to national significance Data: Little (1971), D. Yemshinov (Canadian Forest Service) Catherine Cullingham, University of Alberta
  • Defenses differ in lodgepole and jack pine, and are further altered by drought Janice Cooke Alberta Sustainable Resources Development Adriana Arango
  • At least some mountain pine beetle fungalassociates can detoxify pine defense compounds 10 µm http://flickr.com/photos/19964825@N00/2495786445/ 10 µm Adrianne Rice
  • Genetic analyses provided strong evidence of beetle dispersal from northern BC into northwestern AB Beetles can migrate longer distances than previously supposed Samarasekara et al 2012
  • Beetles in novel habitats: are they becoming more cold tolerant?Frequency 5% Selection (cold winter temperatures) Frequency 20% Cullingham and Janes, unpublished
  • Pines, beetle and fungal associates all show genetic variation across the landscape Geographic EcoregionsGenetic variation features
  • Pathways by which genomics data inform model-based risk assessment
  • PerspectivesThe current MPB outbreak has provided excellent proof ofconcept for application of genomics to forest pest management.  MPB, fungal and pine populations are heterogeneous  This landscape-level non-uniformity could affect MPB spread  Genomics is already informing Risk Assessment  Risk Assessment and risk models also inform genetics research by identifying knowledge gaps  Genomics is already informing Tree Improvement  Other possibilities for applying genetics to reforestation and genetic conservation strategies
  • Mountain pine beetle at the leading edge of the outbreak: new surprises at every turnLorraine Maclauchlan, BC Ministry of Forests and Range Rory McIntosh, Saskatchewan Environment
  • Mountain pine beetle at the leading edge of the outbreak: new surprises at every turn
  • Future Research Needs East of the Rockies, why isn’t the outbreak unfolding as models predicted in the mid 2000s? Will the outbreak reach Ontario? If so, when?  Genomics-enhanced risk models How much does genetic variation in mountain pine beetle, pine host and fungal pathogen matter in outbreak dynamics?  Integrated genomic landscape mapping We are only just beginning to understand how the players in the mountain pine beetle system interact, and how these interactions might affect outbreak dynamics  Functional and physiological genomics investigations have provided novel insights
  • Future Research Needs Continued integration of mountain pine beetle research across disciplines and across scales  Complex problems require holistic approaches  Genomics enables integration
  • Postdocs / Research Associates Research Technicians Eri Adams Neils Jensen Sean Bromilow Jay Anderson Ljerka Lah Jeremiah Bolstad Adriana Arango Inka Lusebrink Stephanie BeauseigleProject Leaders Celia Boone Mario Pineda-Krch Tiffany BonnetJanice Cooke (U of A) Catherine Cullingham Isidro Ojeda Marie Bourassa Walid El Kayal Caitlin Pitt Stephanie BoychukJörg Bohlmann (UBC) Katrin Geisler Adrianne Rice William Clark Dawn Hall Jeanne Robert Amanda Cookhouse Sajeet Haridas Amanda Roe Pat CraneCo-Investigators Uljana Hesse Kishan Sambaraju Sophie DangBrian Aukema (U Minn) Kate Hrinkevich Amy Thommasen Christina Elliot Patrick James Clement Tsui Harpreet DullatColette Breuil (UBC) Jasmine Janes Ye Wang Matt FergusonDavid Coltman (U of A) Joël FillonBarry Cooke (CFS) Graduate Students Leonardo Galindo Sepideh Alamouti Hannah HendersonNadir Erbilgin (U of A) Lina Farfan Nic Bartell Ed Hunt Jordie FraserMaya Evenden (U of A) Christine Chui Chris Hansen Robert Jagodzinski Erin Clark Brad JonesRichard Hamelin (CFS) Lily Khadempour Chelsea Ju Scott DiGuistini Euwing TeenGrant Hauer (U of A) Honey-Marie de la Giroday Ye Wang Laura KennedyRobert Holt (GSC) Susanne King-Jones Gayathri Weerasuriya Chris KonchalskiDezene Huber (UNBC) Jordan Koopmans Undergraduate StudentsSteven Jones (GSC) Simon Allard Jean Linsky Ben Lai Maria LiChristopher Keeling (UBC) Travis Allen Rosalyn Loerke Yisu LiMarco Marra (GSC) Kyle Artym Fang Yuan Luo Emilia Lim Kathryn Berry Mehvash Malik Linette LimBrent Murray (UNBC) Simren Brar Sophia McClair Miranda MeentsFelix Sperling (U of A) Huang-Ju Chen Genny Michiel Dominik Royko Tiffany Clarke RhiannonTim Williamson (CFS) Charles Copeland Montgomery Harpreet Sandhu Bin Shan Julia Dam Marcelo Mora Andrea Singh Shane Doddridge Boyd Mori Bill SperlingProject Management Patrick Gaudet Mike Prior Talya TruantMatthew Bryman (U of A) Andrew Ho Ting Pu Tyler Watson Cierra Hoecher Andrew Sharp Caroline WhitehouseKaren Reid (UBC) Byron Knoll Patrick Welsh Mack Yuen Siew Law Christina Wong