Your SlideShare is downloading. ×
08 translation
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Introducing the official SlideShare app

Stunning, full-screen experience for iPhone and Android

Text the download link to your phone

Standard text messaging rates apply

08 translation

538
views

Published on

Published in: Technology, Business

0 Comments
2 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
538
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
0
Comments
0
Likes
2
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. pp 313 - 320
  • 2. RNA Types Three types of RNA: 1. messenger RNA (mRNA) - brings DNA information from the nucleus to the cytoplasm 2. ribosomal RNA (rRNA) – molecule used to make ribosomes, which synthesizes protein 3. transfer RNA (tRNA) - translator molecule between nucleic acids and amino acids
  • 3. tRNA tRNA – transfer RNA; translates between nucleic acids and amino acids amino acids attach here anticodon – three bases at the bottom of the tRNA which recognize the codon triplets on the mRNA through complementary base pairing anticodon
  • 4. tRNA Activation tRNA activation - enzymes attach the appropriate amino acid to a tRNA (according to genetic code) 20 different enzymes which attach the 20 different amino acids aminoacyl-tRNA – a tRNA with the correct amino acid attached
  • 5. Ribosomes The location where translation occurs. They are made of protein and rRNA. Consists of two parts (eukaryotic) 60S subunit – larger unit 40S subunit – smaller unit final “size” is 80S S – Svedberg; a unit of measure of size based on how quickly an object sediments in a centrifuge
  • 6. Ribosome Ribosomes have three pockets which can bind tRNA amino acid (A) site peptide (P) site exit (E) site
  • 7. Translation Four steps to translation: 1. Initiation 2. Elongation 3. Termination 4. Posttranslational Modification
  • 8. 1. Translation Initiation The small ribosome subunit is responsible for finding an mRNA strand to bind.
  • 9. 1. Translation Initiation A. Prokaryotes mRNA transcripts have a Shine-Dalgarno sequence that ribosomes recognize A complementary section of rRNA can bind to this region – anti Shine-Dalgarno sequence B. Eukaryotes Ribosome recognizes 5’ cap of mRNA strand
  • 10. 1. Translation Initiation Next, the ribosome needs to identify the correct translation start site. A.Prokaryotes Initiation factors help find the start codon. B.Eukaryotes Kozak sequence on the mRNA helps ribosome find start codon.
  • 11. Ribosomes reading frame – a sequence of codon triplets which result in protein formation 5’ AUGCCAGAUGCCAUCCAAGGCC 3’ 5’ AUG CCA GAU GCC AUC CAA GGC C 3’ 5’ A UGC CAG AUG CCA UCC AAG GCC 3’
  • 12. 1. Translation Initiation Methionine tRNA binds to starting AUG. The large subunit then clamps on top of all the components, with the tRNA at the P-site.
  • 13. 1. Translation Initiation A. Prokaryotes Starting amino acid is a formyl-methionine. B. Eukaryotes Starting amino acid is a regular methionine.
  • 14. 2. Translation Elongation The next charged tRNA will enter the A-site and a peptide bond is then made between the two amino acids.
  • 15. 2. Translation Elongation The peptide bond shifts the growing amino acid chain onto the tRNA in the A-site. Now the ribosome translocates along the mRNA strand shifting the empty tRNA to the E-site, where it leaves, and the growing protein-tRNA to the P-site. The A-site is now available for the next charged tRNA. This continues until a STOP codon is reached.
  • 16. 2. Translocation Elongation
  • 17. 3. Translation Termination No tRNA exist for the STOP codons. A release factor recognizes the stop codons and releases the peptide chain from the ribosome. Ribosomes dissociate from the mRNA and the protein is released in the cytoplasm.
  • 18. 3. Translation Termination Proteins are produced N-terminus (amino) to Cterminus (carboxyl).
  • 19. Translation Animation Translation Animation
  • 20. Integral Proteins What about integral proteins? These proteins must be brought to the ER to be synthesized. Genes for these proteins code for a specific amino acid sequence to be made at the N-terminus called the signal peptide.
  • 21. Integral Proteins A signal recognition particle (SRP) recognizes the signal peptide and brings the growing protein to be completed at the ER.
  • 22. 4. Posttranslational Modification Proteins are folded properly after being released from the ribosome by chaperonin proteins. Other functional groups or larger molecules may be added to the protein. Proteins may also be cleaved into different pieces to carry out their specific functions.
  • 23. Protein Modification
  • 24. Protein Modification