2008 bioprocess biosys_eng_a._mosquera_31-6-535-540

215 views
187 views

Published on

Published in: Education, Business, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
215
On SlideShare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
2
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

2008 bioprocess biosys_eng_a._mosquera_31-6-535-540

  1. 1. Bioprocess Biosyst Eng (2008) 31:535–540DOI 10.1007/s00449-007-0194-0 ORIGINAL PAPERAnaerobic treatment of low-strength synthetic TCF effluentsand biomass adhesion in fixed-bed systemsAnuska Mosquera-Corral Æ Angela Belmar ÆJacqueline Decap Æ Katherine Sossa ÆHomero Urrutia Æ Gladys VidalReceived: 13 November 2007 / Accepted: 21 December 2007 / Published online: 12 January 2008Ó Springer-Verlag 2008Abstract Toxicity effects produced by kraft mill efflu- Keywords Anaerobic Á Biomass adhesion Áents are due to the productive process. New bleaching Ethylenediaminetetraacetic acid (EDTA) Áprocesses have been proposed (e.g. total chlorine free, Total chlorine free (TCF) effluentTCF) to reduce the production of toxic chlorine com-pounds. In the TCF processes large amounts of chelatingcompounds like the ethylenediaminetetraacetic acid Introduction(EDTA) and diethylenetriaminepentaacetic acid (DPTA)are used. The aim of this work is to research the feasi- In recent years, important technological innovations havebility of the degradation of low-strength synthetic TCF been developed worldwide in the forest industry, aimed ateffluents in a anaerobic filter reactor (AF) and the bio- reducing water consumption and generation of toxic con-mass adhesion. The effects on the operation of the AF at taminants. Thus, water circuit closures, new pulping anddifferent EDTA loading rates were tested in the range bleaching processes have been introduced in order tofrom 0.07 to 0.51 g EDTA l-1 days-1. The maximum reduce water consumption and production of chlorinatedEDTA removal percentage achieved was of 27%. Acute phenolic compounds. The TCF (total chlorine free)toxicity (measured as 24 h-LC50) with Daphnia magna bleaching process is one of these processes, which aims towas reduced from 14.23 to 54.53% before and after completely remove the discharges of chlorinated com-anaerobic treatment, respectively. Observations of bio- pounds [1]. Furthermore, it has been stated that TCFmass samples from the AF under the scanning microscope bleaching enhances the anaerobic COD biodegradability ofverified the attached biomass. the effluent generated up to 75% [2]. However, the introduction of this TCF pulp is associated to an increment on the amounts of chelating compounds used to remove the metals present in the obtained cellulose pulp [3]. The most commonly used chelating compounds are ethylenediaminetetraacetic acid (EDTA) and diethylenetri-A. Mosquera-Corral aminepentaacetic acid (DPTA) [4]. No studies have beenDepartment of Chemical Engineering, School of Engineering,University of Santiago de Compostela, completed within the pulping industry that demonstrates the ´Lope Gomez de Marzoa s/n, 15782 feasibility of removal of these chelating compounds bySantiago de Compostela, Spain anaerobic biological treatment. In some cases after a chem- ical oxidation it has been observed the aerobic degradation ofA. Belmar Á J. Decap Á G. Vidal (&)Environmental Science Center EULA-Chile, both compounds [3]. Furthermore, the recalcitrant properties ´ ´University of Concepcion, P.O. Box 160-C, Concepcion, Chile of the DPTA have been already studied [5]. EDTA has beene-mail: glvidal@udec.cl also used to decrease the inhibitory effects on the methano- genic activity of metals like cadmium, copper, nickel [6, 7].K. Sossa Á H. Urrutia ´Biotechnology Center, University of Concepcion, All this factors make it interesting the study of these com- ´P.O. Box 160-C, Concepcion, Chile pounds in the anaerobic processes. 123
  2. 2. 536 Bioprocess Biosyst Eng (2008) 31:535–540 In the half 60 s the anaerobic digestion was established as CH4an alternative to treat effluents with high organic loads (1– 540 g COD l-1 days-1), but also for low-strength (1 gCOD l-1 days-1). It was in the early 90 s when thesetechnologies were extensively applied to the forest industry[8]. The use of these technologies allows the production of 4effluents which can be reused in the production processprovoking a decrease of fresh water consumption [9].Technologies based on anaerobic biomass grown in the formof biofilms have been found to provide biomass more 6resistant to the presence of toxic compounds as those usuallycontained in the effluents of the pulp and paper industry. The aim of the present work was to study the effects of 3EDTA present in the low-strength synthetic TCF effluentson the operation of an anaerobic filter reactor (AF) and the 2biomass adhesion to PVC corrugated rings. 1Methods and materials 7Wastewater INFLUENT EFFLUENTEffluent was prepared similar to the model media from ´Rodrıguez et al. [3] as detailed in Table 1. The COD Fig. 1 Anaerobic filter reactor (AF) layout: 1 influent, 2 feeding distributor, 3 sludge bed, 4 separator system solid/liquid/gas, 5 biogasconcentration was between 0.38 and 0.48 g COD l-1 tak- measurement, 6 carrier material, 7 effluenting into account the COD supply from the differentconcentrations of organic compounds including the EDTA Reactortested (107–214 mg l-1). An anaerobic filter reactor with a working volume of 200 ml (Fig. 1) was operated in a continuous flow modeInoculum during 370 days. The AF was filled with corrugated PVC Raschig rings (1.4 cm internal diameter) acting as carrierThe reactor was inoculated with 5 g VSS l-1 of anaerobic material and with a specific surface area of 449 m2 m-3.flocculent sludge treating effluents from a kraft process and The temperature was maintained at 37°C by using a ther-with a specific activity of 0.9 g COD g-1 VSS days-1. mostatic chamber and pH was maintained in the range 7.0–8.5 by means of bicarbonate addition. Operational conditionsTable 1 TCF synthetic effluent composition The reactor was operated in five different periods with two different operational strategies: (a) decrease of HRT fromFeeding media Nutrient solution 1.25 to 0.46 days (I–IV) and (b) doubling of the EDTA -1Compound gl Compound g l-1 concentration from 107 to 214 mg EDTAÁl-1 keeping theSodium formate 0.5 H3PO4 0.314 9 10-6 HRT on 0.46 days (V).Sodium acetate 0.1 MgSO4Á7H2O 0.54 The EDTA loading rates (LREDTA) applied to the reactorSodium bicarbonate 4 CaCl2Á2H2O 0.54 ranged from 0.07 to 0.51 g EDTA l-1 days-1.EDTA 0.107–0.214 FeCl3Á6H2O 1.05FeCl3Á6 H2O NH4Cl 2.085 Adhesion experimentsNutrient solution 5 ml l-1 KH2PO4 0.285 Glyoxal 0.3 The adhesion of the anaerobic biomass to the corrugated Vanillin 0.8 PVC rings was tested in batch experiments performed by123
  3. 3. Bioprocess Biosyst Eng (2008) 31:535–540 537duplicate. Assays were carried out in dark vials of 100 ml Table 2 Oligonucleotide probes used for the Dot-Blot analysisof volume. The same inoculum as in the reactor was used Probe Target organism Probe sequence (50 –30 ) Ref.in the tests and an amount of 2 g VSS l-1 were intro-duced in each vessel. Around 30 pieces of cut corrugated EUB338 Bacteria GCTGCCTCCCGTAGGAGT [19]rings (surface of 2 9 10-4 m2 by piece) were added to ARC915 Archaea GTGCTCCCCCGCCAATTCCT [20]each vial. Different concentrations of EDTA (0, 0.05, MS1414 Methanosarcina CTCACCCATACCTCACTCGGG [21]0.10 and 0.20 g l-1) were tested. No organic substrate, species and close relativesexcept for the EDTA, was added to the tests. A propor-tional concentration of iron in the vessels medium, as thatindicated in Table 1, was used. The vials were placed in Analytical methodsa thermostated bath where temperature was fixed at 37°C.The specific activity of the adhesion experiments was Volatile suspended solid (VSS), chemical oxygen demandmonitored according to the procedure described by Soto (COD), biological oxygen demand (BOD5) were measuredet al. [10] by measuring the volumes of liquid displaced according to the ‘‘Standard Methods’’ [13]. Total alkalinitydue to biogas production. In order to quantify the number (TA) was determined by titration [14]. EDTA was deter-of microorganisms attached to the supports three pieces mined according Bhattacharya and Kundu [15]. Samplesof corrugated PVC were removed from each vial along for COD, BOD5 and EDTA analysis were filtered through athe time. The pieces were sonicated in 10 ml of water membrane of 0.45 lm (pore size).during 30 min; the liquid was filtered through filters of Biomass samples for scanning electron microscopy were0.2 lm pore size. The retained biomass on the filters was analyzed according to the technique developed by Nationtreated with the DAPI dye (0.2 ml of a solution of [16]. The identification and quantification of the microbial0.1 mg l-1). The filters were deposited on a slide covered populations were performed by means of the Dot-Blotwith vaseline and placed in the epifluorescence chamber technique [17]. The 16S rRNA of a biomass sample waswhere the number of microorganisms was counted by analyzed on a membrane using the specific oligonucleotidehand. probes detailed in Table 2 using the hybridization proce- dure described by Stahl et al. [18].Toxicity experiments Results and discussionThe acute toxicity of the EDTA was determined in the Process operationliquid samples by exposing juveniles (24 h old) Daph-nia magna and Daphnia obtusa during 24–48 h to this The reactor was operated during 370 days (periods I–V)compound. The mortality of organisms was monitored at fed with a synthetic TCF effluent and operated at differentthe end of the exposure time and it was defined as the HRT values from 1.4 to 0.46 days (see Table 3; Fig. 2).lack of organism motility when the vessel is shaken. The The EDTA concentrations in the feeding media to the AFaverage lethal concentrations at 24 and 48 h (LC50) were were chosen in the range they are usually found in theestimated using the methods of Probit and Spear- wastewater produced in TCF processes (0.06–0.10 g l-1)man–Karber [11, 12]. [5]. The chosen values did not cause inhibition on theTable 3 Operational conditions of the AFParameter Period (days) I (0–67) II (68–130) III (131–194) IV (195–340) V (341–370) -1 -1LR (g EDTA l days ) 0.08 0.13 0.07 0.22 0.51HRT (days) 1.25 ± 0.10 0.84 ± 0.06 1.44 ± 0.47 0.46 ± 0.19 0.46 ± 0.19Removal (%) Media Range Media Range Media Range Media Range Media RangeCOD 52.2 41.2–71.3 54.7 42.2–60.5 69.0 49.5–81.7 78.4 64.0–84.2 50.8 42.4–65.3BOD5 89.0 83.0–92.0 93.0 82.0–98.0 97.5 95.2–98.8 97.8 96.4–98.7 94.3 91.2–98.1EDTA 27.3 8.0–40 13.5 5.0–28.0 15.0 5.0–26.0 5.6 6.0–15.9 19.1 5.7–39.3 123
  4. 4. 538 Bioprocess Biosyst Eng (2008) 31:535–540 Biofilm formation Treatment stage corresponded to the not degraded EDTA due to the fact that this compound contributes to the 26% (periods I–IV) and to PERIOD I II III IV V 0.08 0.13 0.22 0.51 the 52% (period V) of the theoretical COD in the feedingLR EDTA(gEDTA/L·d) 0.07 100 which almost fits to the 80 and 50% of COD removal a percentages obtained, respectively. These observations are 80 ´ similar to those from Alarcon et al. [5] working with and COD removal (%) effluent containing DPTA (0.1 g l-1) in a similar reactor. 60 The apparent disappearance of EDTA in the AF was then 40 attributed to the errors associated to sampling and analyt- ical determinations. The complete depletion of the BOD5 20 was an indicative of the stable performance of the metha- nogenic process indicating the absence of negative effects 0 on this activity due to the presence of EDTA in the feeding. 100 ´ Similar behavior was observed by Alarcon et al. [5] b EDTA and BOD5 removal (%) working with DPTA. 80 The toxicity of the influent and effluent to the AF in 60 period I, determined with D. obtusa and D. magna, indi- cated a reduction of the toxicity of the media after the 40 anaerobic degradation. With D. obtusa the value of the 24 h-LC50 (acute toxicity) was reduced from 23.94 to 20 67.71%. In the experiments performed with D. magna results indicated a reduction from 14.23 to 54.53%, 0 0 100 200 300 400 slightly different due to the higher sensitivity of the latter Time (d) compared to the D. obtusa. The results obtained from the influent can be, in a certain way, compared to those fromFig. 2 Anaerobic filter reactor (AF) performance. a COD (filledcircle) removal, b BOD5 (filled circle) and EDTA (filled diamond) Martins et al. [23] who indicate that the concentration ofremoval percentages, respectively acetate corresponding to the 24 h-LC50 for D. magna is of 10.79 mg l-1 which is similar to that of the influent ofmethanogenic activity of the biomass, as it was determined 14.23 mg l-1 expressed in concentration. The results mustfrom previous batch experiments that an inhibition of 50% be interpreted with care because the feeding media to theof this activity occurred at concentrations of 0.4 g AF contained other major compounds like the formateEDTA l-1 [22]. which could contribute to the acute toxicity at different The AF was started up with an organic load lower than extent as it has been found by Cooman et al. [12] tothe maximum load feasible to be treated by the inoculated happen with other toxic compounds of the tannery efflu-amount of anaerobic sludge (around 14.5 times lower than ents. The EDTA was not expected to cause toxic effectthe maximum specific activity of the biomass) to overcome due to the fact that it has been added to the media whenthe possible detrimental effects of the presence of EDTA. the acute toxicity of metals was determined and it hasThe organic load was increased to reach a value of 1.06 g been stated that its presence reduces the toxic effect ofCOD l-1 days-1 (period V). The maximum COD removal metals like copper, cadmium, etc [6]. Taking into accountpercentages were obtained during periods III and IV that the biodegradable substrates (acetate and formate)reaching values of 78.4% (Fig. 2a) while in terms of BOD5 were degraded during the anaerobic process the residualpercentages were close to 100% (Fig. 2b). The total alka- toxicity in the effluent can be attributed to other salts likelinity was always above 2 g CaCO3 l-1 to guarantee the ammonia present in the media [12].stability of the pH value from 7.3 to 8.5. The average EDTA removal percentage obtained wasduring the whole operation of the AF in the range from 5.6 Bacteria attachmentto 27.3%. A balance calculation was performed to establishthe route of disappearance of the EDTA from the media. The reactor was inoculated with flocculent biomass char-The assumption that the readily biodegradable compounds acterized by a wide diversity (Fig. 3a). With the objective(acetate and formate) were removed in the reactor, as the to determine the formation of bacteria attachment, afterBOD5 concentration in the effluent was almost neglected, 33 days of operation samples of corrugated rings werewas made. From the COD measurements it was obtained collected from the AF. The observation under the electron-that the percentage of COD remaining in the media scanning microscope of the surface of the support material123
  5. 5. Bioprocess Biosyst Eng (2008) 31:535–540 539positively indicated that the growth of bacteria attachment 175 Microorganims number / PVC corrugatedoccurred and it was found to be mainly composed by 150bacillus-type bacteria (Fig. 3 b, c). In principle it could beestablished that the presence of EDTA in the feeding media support (cm-2) (x103) 125did not exert any prejudicial effect on the development ofthe bacteria attachment. 100 Adhesion experiments, performed with biomass with thesame origin as that inoculated to the reactor, indicated that 75no EDTA degradation occurred in the test. The amount of 50organisms adhered to the surface of the carrier materialindicated that the bacteria attachment was formed during 25the initial 12 h (Fig. 4). No significant effect on the bio-mass adhesion was observed with the different tested 0 0 10 20 30 40 50EDTA concentrations compared to the results obtained Time (d)with the blank experiment (0 g l-1). These results cor-roborated those obtained from the AF operation. Fig. 4 Adhesion experiments: blank 0 g EDTA l-1 (filled diamond), Furthermore, the microbial populations present in the 0.05 g EDTA l-1 (open circle), 0.1 g EDTA l-1 (open diamond),biomass adhesion were identified and quantified by means of 0.2 g EDTA l-1 (filled circle)Fig. 3 Scanning microscope observation of the biomass: inoculum, 910,000 a, microorganisms attached to the support material on day 33 of theAF operation, 92,500 (b) and 95,000 (c) 123
  6. 6. 540 Bioprocess Biosyst Eng (2008) 31:535–540the Dot-Blot technique. Results indicated the presence of 6. Guilhermino L, Diamantino TC, Ribeiro R, GonCalves F, Soares ¸65% of the microorganisms belonging to the domain Bac- AMVM (1997) Stability of test media containing EDTA for the evaluation of acute metal toxicity to Daphnia magna Straus.teria and 35% belonging to the domain Archaea. In the latter Ecotoxicol Environ Saf 38:292–29535% of the population was found to belong to the Methan- 7. Chen Y, Cheng JJ, Creamer S (2007) Inhibition of anaerobicosarcina species. These are common archaea organisms digestion process: a review. Bioresour Technol. doi:10.1016/present in anaerobic reactors fed with relatively high acetate j.biortech.2007.01.057 8. Lettinga G, Field J, Sierra-Alvarez R, van Lier J, Rintala J (1991)concentrations and which easily accomplish with sudden Future perspective for the anaerobic treatment of forest industryload changes [24]. Once more the appropriate operation of wastewater. Water Sci Technol 24(3/4):91–102the AF is corroborated by the grown microbial populations. 9. Van Lier LB, Lens P, Hushoff Pol LW (2001) Anaerobic treat- ment for C and S removal in ‘‘zero-discharge’’ paper mills: effects of process design on S removal efficiencies. Water Sci Technol 44(4):189–194Conclusions ´ 10. Soto M, Mendez R, Lema JM (1993) Methanogenic and non- methanogenicactivity tests. Theoretical basis and experimentalThe biodegradation of a low-strength synthetic TCF set up. Water Res 27(8):1361–1376 11. Finney D (1978) Statistical method in biological assay. Charleseffluent in an AF was successfully accomplished in the Griffin & Co. Ltd (eds), London, pp 508presence of different concentrations of EDTA (0.1– 12. Cooman K, Gajardo M, Nieto J, Bornhardt C, Vidal G (2003)0.2 g l-1). The maximum removal percentages reached Tannery wastewater characterization and toxicity effects onwere close to 100% for BOD5 and of 78.4% for COD when Daphnia spp. Environ Toxicol 17:45–51 13. APHA-AWWA-WPCF (1985) Standard methods for examinationloads up to 0.83 g CODÁl-1Ádays-1 were treated. Also, of water and wastewater, 16th eds, Washingtonanaerobic degradation of the synthetic effluent reduced the 14. Ripley LE, Boyle W, Converse J (1986) Improved alkalimetricacute toxicity measured with D. magna and D. obtusa in 64 monitoring for anaerobic digestion of high strength wastes. Jand 74%, respectively. WPCF 58(5):406–411 15. Bhattacharya SN, Kundu KP (1971) Spectrophotometric deter- The maximum EDTA removal percentage achieved was mination of EDTA. Talanta 18:446–448of 27%. 16. Nation JL (1983) A new method for using hexamethyldisilazane No detrimental effect on the attachment of the biomass for preparation of soft insect tissue for scanning electronto the carrier surface was observed caused by the presence microscopy. Stain Technol 58:347–351 17. Sambrook J, Fritsch EF, Miniatis T (1989) Dot and Slotof the EDTA in the media. An amount of 35% of the hybridization of RNA. In: Molecular cloning a laboratory man-bacteria attachment corresponded to methanogenic bacteria ual, 2nd edn. Cold Spring Harbord Laboratory Press, USA ppfrom the family Methanosarcinaceae, which conferred to 7.35–7.55the biofilm a high resistance to operational changes. 18. Stahl DA (1997) Application of phylogenetically based hybrid- ization probes to microbial ecology. Mol Ecol 4:535–542 19. Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereu R, StahlAcknowledgments This work was financially supported by DA (1990) Combination of 16S ribosomal-rRNA-targeted oli-FONDECYT 1070509. A. Mosquera-Corral thanks to the European gonucleotide probes with flow cytometry for analyzing mixedALFA N° II-0311-FA-FCD-FI-FC by supporting her stay at the microbial-populations. Appl Environ Microbiol 56(6):1919–1925Environmental Science Center EULA-Chile, Universidad de Con- 20. Stahl DA, Amann R (1991) Development and application of ´cepcion (Chile). nucleic acid probes. In: Stackebrandt E, Goodfellow M (eds) Nucleic acid techniques in bacterial systematics. Wiley, Chich- ester, pp 205–248References 21. Raskin L, Poulsen LK, Noguera DR, Rittmann BE, Stahl DA (1994) Quantification of methanogenic groups in anaerobic bio- 1. Thompson G, Swain J, Kay M, Foster CF (2001) The treatment of logical reactors by oligonucleotide probe hybridization. Appl pulp and paper mill effluent: a review. Bioresour Technol Environ Microbiol 60:1241–1248 77:275–286 22. Vidal G, Gajardo M, Belmar A, Diez M (2001) Methanogenic ´ ´ 2. Vidal G, Soto M, Field J, Mendez-Pampın R, Lema JM (1997) toxicity of ethylenediaminotetraacetic acid. XXIII Microbiology Anaerobic biodegradability and toxicity of wastewaters from ´ Chilean Congress, November 28–30, Tome, Chile, pp 61 chlorine and total chlorine-free bleaching of eucalyptus kraft 23. Martins J, Oliva-Teles L, Vasconcelos V (2007) Assays with pulps. Water Res 31(10):2487–2494 Daphnia magna and Danio rerio as alert systems in aquatic ´ 3. Rodrıguez J, Mutis A, Yeber MC, Freer J, Baeza J, Mansilla HD toxicology. Environ Int 33:414–425 (1999) Chemical degradation of EDTA and DTPA in a totally 24. Conklin A, Stensel HD, Ferguson J (2006) Growth kinetics and chlorine free (TCF) effluent. Water Sci Technol 40:267–272 competition Between Methanosarcina and Methanosaeta in ¨¨ 4. Sillanpaa M, Pirkanniem K (2001) Recent developments in mesophilic anaerobic digestion. Water Environ Res 78(5):486– chelate degradation. Environ Technol 22:791–801 496 ´ 5. Alarcon E, Decap J, Vidal G (2005) Resistance of diethylene- triaminepentaacetic acid to anaerobic biodegradation. Electron J Biotechnol 8(3):308–313 doi:10.2225/vol8-issue3-fulltext-5123

×