Glossary for the Protein Necklace Activity

Please turn to page 339 in your book.

Messenger RNA (mRNA): Carries the messa...
Protein Necklace Activity
Instructions
1.

Each pair ofstudents will be assigned a color and the information for one amino...
Protein Necklace Worksheet

Name___________________________Block_________p. 1

GROUP

MRNA SEQUENCES

PINK

AC UAGCAAGCUCU...
Protein Necklace Worksheet

Name_____________________________Block__________ p.2

Mutation Types
Substitution: A swap of o...
Translation Homework

Name___________________________Block_________ p. 3

1) Underline the start and stop codons for each ...
Translation Homework

Name___________________________Block_________

p. 4

Complete the table below. Please be aware that ...
Translation Homework

Name___________________________Block_________

p. 3

4) Underline the start and stop codons for each...
MUTANT

MetAspGluLysGlnValGluArgAspTyr
Upcoming SlideShare
Loading in...5
×

Translation necklace activity v2

365

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
365
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
1
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Translation necklace activity v2

  1. 1. Glossary for the Protein Necklace Activity Please turn to page 339 in your book. Messenger RNA (mRNA): Carries the message from DNA about how to make proteins. Translation: The process of reading the message in mRNA to make proteins (by linking amino acids together). Amino acids: Chemical building blocks used to make proteins. Amino acids contain carbon, nitrogen, oxygen, hydrogen and sometimes sulfur.We will use colored beads to represent the different amino acids. Ribosome: Organelle where proteins are made.In this activity, your desks will serve as ribosomes. Transfer RNA (tRNA): Special key-shaped RNA molecules that deliver amino acids to the ribosome for protein synthesis.The cups in the back of the room that are carrying the beads represent the differenttRNAs. Codon: groups of three ribonucleotides in mRNA that indicate which amino acid will be placed on a growing protein chain. Start Codon: AUG codes for methionine which is the first amino acid in all proteins.No false starts or you’re disqualified! Stop Codons: UAA, UAG, and UGA indicate that protein translation should stop. There should be no amino acids added to a protein once a stop codon is reached.
  2. 2. Protein Necklace Activity Instructions 1. Each pair ofstudents will be assigned a color and the information for one amino acid sequence, in the form of an mRNA “map.” We’ll give you a pipe cleaner that matchesyour color. You’ll be stringing amino acid “beads” along the pipe cleaner. Roll one end as instructed so the beads won’t fall off. 2. Get out the protein coding table that shows the codon sequence for each amino acid. (It is also on page 338 of your book). 3. The amino acid beads are in cups around the classroom in alphabetical order. The cups are transfer RNAs (tRNAs) because they hold specific amino acids. Notice that the cups have tRNA molecules drawn on them. 4. Your desk is the ribosome. You may only assemble the protein necklace at your ribosome. 5. One of you may move one cup at a time from its place in the back of the room. Your partner should stay at the ribosome to do the assembly. Put the cups back immediately after you add new amino acids to your protein, so they will be available for the construction of other proteins, elsewhere in the cell. 6. On your worksheet page 1, identify the normal and mutant sequences for your group’s color. Right now we are making the necklace for theNoRMAL sequence. Later you will make the necklace for the mutant sequence and compare them, but not yet. 7. On the worksheet, circle the start codon, AUG, which codes for methionine. All proteins begin with methionine. 8. Find and underline the stop codon which is the first instance of UAA, UGA, or UAG that comes after (to the right of) the methionine. You should stop making your protein necklace when you reach a stop codon. 9. Start assembling your necklace. When finished, check with your teacher to see if you made the correct protein. If correct… good job!You may continue on to step 10. 10. Get a white pipe cleaner and build the protein foryour mutant sequence. If you were the code reader last time, switch with your partner so that he/she reads the code and you deliver the amino acids. Check with your teacher to ensure that you have correctly assembled the protein. 11. Next, consider how your mutation may have affected you protein’s sequence. On page 2, answer the questions for your group’s color.We will fill the rest of the table out as a class. When filling out the mutation type(s) column try to choose correctly from types given in bold face text above the table. Please be aware that in some cases we are looking for two answers for a mutation type. For example, an insertion or deletion can also cause a frame shift. 12. Turn in Pages 1 and 2. Pay attention to the class discussion because it will make your homeworkeasier.
  3. 3. Protein Necklace Worksheet Name___________________________Block_________p. 1 GROUP MRNA SEQUENCES PINK AC UAGCAAGCUCUCAGGCCUGGCAUCAUGGUGCAUUUUACUGCU GAG GAA CCC GUCUGA CCC AUUAUUU NORMAL PINK MUTANT AC UAGCAAGCUCUCAGGCCUGGCAUCAUGGUGCAUUUUACUGCU GAG G UA CCC GUCUGA CCC AUUAUUU GREEN GCAGCGAAUAAGUUAUGUUAAUCGGAUGGCGG CCC AUAAGAGUUUAGUAUGG NORMAL GREEN MUTANT GCAGCGAAUAAGUUAUGUU G AUCGGAUGGCGG CCC AUAAGAGUUUAGUAUGG ORANGE AC CGCGGAGCCCUUGCAGCCAUGAGGGAA CAG AAAGGC GAG ACUCAAACAUGAAAA CCCACUUGCUGG NORMAL ORANGE MUTANT AC CGCGGAGCCCUUGCAGCCAUGAGGGAA CAG UAAGGC GAG ACUCAAACAUGAAAA CCC ACUUGCUGG YELLOW AAUCUUACAAAAUGUGUGACGAAGAAGUUCUGAAAUUGGUUGUCUGAGACAACGGC NORMAL YELLOW MUTANT BLACK UUAAAAAAUUUAUGUGUGACGAAGAAGUUCUGAAAUUGGUUGUCUGAUUUUUUUUU AU UAAGCAAUGUCAGGCGUCCGAUAG CCC AUCAUCAACGGUAAG CCC AUUAAC CCC CGG CCC C NORMAL BLACK MUTANT AU UAAGCAAUGUCAGGC CGUCCGAUAGCCCAUCAUCAACGGUAAGCCCAUUAA CCC CCGGCCCC BROWN GGAGGGCAUG CAG GAG UUCACG GAG UUCUAGACAAGACCG NORMAL BROWN MUTANT GGAGGGCAUG CAG GAG UUCGAG AAG CCC UUCACG GAG UUCUAGACAAGACCG BLUE UUGGACCU CCC AUGGAC GAG ACAACAGGUUGAGCGGGACUAUUGAGGCGACGGCAA NORMAL BLUE MUTANT RED UUGGACCU CCC AUGGAC GAG AAA CAG GUU GAG CGGGACUAUUGAGGCGACGGCAA AAAAGCCCAACUAGAA GAG AUGUCAGUUUUC CGU UAC GCC UAUCAUUUUUGGUGAUUCUAAC NORMAL RED MUTANT AAAAGCCCAACUAGAA GAG AUGUCAGUUUUCUAUCAUUUUUGGUGAUUCUAAC PURPLE NORMAL UAUAUUUUGAUAUG CCC AGCAUU G AUAUUGAAGUAGAAUGACACUUGAGCAAC PURPLE MUTANT UAUAUUUUGAUAUG CCC AGCAUUAUAUUGAAGUAGAAUGACACUUGAGCA AC
  4. 4. Protein Necklace Worksheet Name_____________________________Block__________ p.2 Mutation Types Substitution: A swap of one nucleotide for another Insertion: Extra nucleotides Deletion: Missing nucleotides Missense: A substitution resulting in a different amino acid Nonsense: A substitution that changes an amino acid into a stop codon Frame Shift: When an insertion or deletion causes changes the downstream codons resulting in a different amino acid sequence Silent: When a mutation does not alter the amino acid sequence GROUP MISSENSE NONSENSE INSERTION DELETION FRAMESHIFT SILENT (IS THERE A (IS THERE A (WITH A DIFFERENCE IN THE AMINO ACID SEQUENCE) (WITH A DIFFERENCE IN THE AMINO (DOES THE AMINO ACID SEQUENCE READ DIFFERENTLY FOLLOWING AN INSERTION OR DELETION ?) (ISTHERE NO MUTATION TYPE(S) CHANGE TO (WRITE THE THE A MINO MUTATION TYPE ( S) ACID SEQUENCE ? USING THE ANSWERS SUBSTITUTION RESULTING IN AMINO ACID ?) A NEW SUBSTITUTION RESULTING IN A NEW STOP CODON ?) ACID SEQUENCE) TO THE LEFT OF THIS COLUMN AS YOUR GUIDE .) PINK NO NO NO YES YES YES YES YES YES NO NO NO NO NO YES YES YES YES YES YES NO NO NO NO NO YES YES YES YES YES YES NO NO NO NO NO YES YES YES YES YES YES NO NO NO NO NO YES YES YES YES YES YES NO NO NO NO NO YES YES YES YES YES YES NO NO NO NO NO YES YES YES YES YES YES NO PURPLE NO NO RED NO NO BLUE YES NO BROWN YES NO BLACK YES NO YELLOW YES NO ORANGE YES NO GREEN YES NO NO NO NO NO YES YES YES YES YES YES NO NO NO NO NO NO
  5. 5. Translation Homework Name___________________________Block_________ p. 3 1) Underline the start and stop codons for each sequence. 2) Underneath the mRNA sequences, write the amino acid sequence for the proteins. 3) Continue on to p. 4. GROUP MRNA SEQUENCES #1 AC CGCGGAGCCCUUGCAGCCAUGAGGGAA CAG AAAGGC GAG ACUCAAACAUGAAAA CCCACUUGCUGG NORMAL #1 MUTANT AC CGCGGAGCCCUUGCAGCCAUGAGGGAA CAG UAAGGC GAG ACUCAAACAUGAAAA CCC ACUUGCUGG #2 AC UAGCAAGCUCUCAGGCCUGGCAUCAUGGUGCAUUUUACUGCU GAG GAA CCC GUCUGA CCC AUUAUUU N ORMAL #2 MUTANT AC UAGCAAGCUCUCAGGCCUGGCAUCAUGGUGCAUUUUACUGCU GAG G UA CCC GUCUGA CCC AUUAUUU #3 AAAAGCCCAACUAGAA GAG AUGUCAGUUUUC CGU UAC GCC UAUCAUUUUUGGUGAUUCUAAC N ORMAL #3 MUTANT AAAAGCCCAACUAGAA GAG AUGUCAGUUUUCUAUCAUUUUUGGUGAUUCUAAC #4 GGAGGGCAUG CAG GAG UUCACG GAG UUCUAGACAAGACCG N ORMAL #4 MUTANT GGAGGGCAUG CAG GAG UUCGAG AAG CCC UUCACG GAG UUCUAGACAAGACCG #5 AU UAAGCAAUGUCAGGCGUCCGAUAG CCC AUCAUCAACGGUAAG CCC AUUAAC CCC CGG CCC C N ORMAL #5 MUTANT AU UAAGCAAUGUCAGGC CGUCCGAUAGCCCAUCAUCAACGGUAAGCCCAUUAA CCC CCGGCCCC #6 UAUAUUUUGAUAUG CCC AGCAUU G AUAUUGAAGUAGAAUGACACUUGAGCAAC N ORMAL #6 MUTANT UAUAUUUUGAUAUG CCC AGCAUUAUAUUGAAGUAGAAUGACACUUGAGCA AC #7 AAUCUUACAAAAUGUGUGACGAAGAAGUUCUGAAAUUGGUUGUCUGAGACAACGGC N ORMAL #7 MUTANT UUAAAAAAUUUAUGUGUGACGAAGAAGUUCUGAAAUUGGUUGUCUGAUUUUUUUUU #8 N ORMAL GCAGCGAAUAAGUUAUGUUAAUCGGAUGGCGG CCC AUAAGAGUUUAGUAUGG #8 MUTANT GCAGCGAAUAAGUUAUGUUG AUCGGAUGGCGG CCC AUAAGAGUUUAGUAUGG #9 N ORMAL UUGGACCU CCC AUGGAC GAG ACAACAGGUUGAGCGGGACUAUUGAGGCGACGGCAA #9 MUTANT UUGGACCU CCC AUGGAC GAG AAA CAG GUU GAG CGGGACUAUUGAGGCGACGGCAA
  6. 6. Translation Homework Name___________________________Block_________ p. 4 Complete the table below. Please be aware that in some cases there will be two answers for “mutation type.” For example, an insertion or deletion mutation might cause a frame shiftmutation. Mutation Types Substitution: A swap of one nucleotide for another Insertion: Extra nucleotides Deletion: Missing nucleotides Missense: A substitution resulting in a different amino acid Nonsense: A substitution that changes an amino acid into a stop codon Frame Shift: When an insertion or deletion causes changes the downstream codons resulting in a different amino acid sequence Silent: When a mutation does not alter the amino acid sequence # MISSENSE (IS THERE A NONSENSE INSERTION DELETION FRAMESHIFT SILENT (IS THERE A (C AUSING A DIFFERENCE IN THE AMINO ACID SEQUENCE) (C AUSING A DIFFERENCE IN THE AMINO ACID SEQUENCE) (DOES THE AMINO ACID SEQUENCE READ DIFFERENTLY FOLLOWING AN INSERTION OR DELETION ?) (ISTHERE NO MUTATION TYPE(S) CHANGE TO (WRITE THE THE AMINO MUTATION TYPE ( S) ACID SEQUENCE ? USING THE ANSWERS SUBSTITUTION SUBSTITUTION RESULTING IN A RESULTING IN NEW STOP AMINO ACID ?) CODON ?) A NEW TO THE LEFT OF THIS COLUMN AS YOUR GUIDE .) 1 NO NO NO YES YES YES YES YES YES NO NO NO NO NO YES YES YES YES YES YES NO NO NO NO NO YES YES YES YES YES YES NO NO NO NO NO YES YES YES YES YES YES NO NO NO NO NO YES YES YES YES YES YES NO NO NO NO NO YES YES YES YES YES YES NO NO NO NO NO YES YES YES YES YES YES NO 9 NO NO 8 NO NO 7 YES NO 6 YES NO 5 YES NO 4 YES NO 3 YES NO 2 YES NO NO NO NO NO YES YES YES YES YES YES NO NO NO NO NO NO
  7. 7. Translation Homework Name___________________________Block_________ p. 3 4) Underline the start and stop codons for each sequence. 5) Underneath the mRNA sequences, write the amino acid sequence for the proteins. 6) Continue on to p. 4. GROUP MRNA SEQUENCES #1 AC CGCGGAGCCCUUGCAGCCAUGAGGGAA CAG AAAGGC GAG ACUCAAACAUGAAAA CCCACUUGCUGG NORMAL MetArgGluGlnLysGlyGluThrGlnThr #1 MUTANT AC CGCGGAGCCCUUGCAGCCAUGAGGGAA CAG UAAGGC GAG ACUCAAACAUGAAAA CCC ACUUGCUGG #2 AC UAGCAAGCUCUCAGGCCUGGCAUCAUGGUGCAUUUUACUGCU GAG GAA CCC GUCUGA CCC AUUAUUU N ORMAL MetValHisPheThrAlaGluGluProVal #2 MUTANT AC UAGCAAGCUCUCAGGCCUGGCAUCAUGGUGCAUUUUACUGCU GAG G UA CCC GUCUGA CCC AUUAUUU #3 AAAAGCCCAACUAGAA GAG AUGUCAGUUUUC CGU UAC GCC UAUCAUUUUUGGUGAUUCUAAC N ORMAL MetSerValPheArgTyrAlaTyrHisPheTrp #3 MUTANT AAAAGCCCAACUAGAA GAG AUGUCAGUUUUCUAUCAUUUUUGGUGAUUCUAAC #4 GGAGGGCAUG CAG GAG UUCACG GAG UUCUAGACAAGACCG N ORMAL MetGlnGluPheThrGluPhe #4 MUTANT GGAGGGCAUG CAG GAG UUCGAG AAG CCC UUCACG GAG UUCUAGACAAGACCG #5 AU UAAGCAAUGUCAGGCGUCCGAUAG CCC AUCAUCAACGGUAAG CCC AUUAAC CCC CGG CCC C N ORMAL MetArgGluGln MetValHisPheThrAlaGluValProVal MetSerValPheTyrHisPheTrp MetGlnGluPheGluLysProPheThrGluPhe MetSerGlyValArg #5 MUTANT AU UAAGCAAUGUCAGGC CGUCCGAUAGCCCAUCAUCAACGGUAAGCCCAUUAA CCC CCGGCCCC #6 UAUAUUUUGAUAUG CCC AGCAUU G AUAUUGAAGUAGAAUGACACUUGAGCAAC N ORMAL MetProSerIleAspIleGluValGlu #6 MUTANT UAUAUUUUGAUAUG CCC AGCAUUAUAUUGAAGUAGAAUGACACUUGAGCA AC #7 AAUCUUACAAAAUGUGUGACGAAGAAGUUCUGAAAUUGGUUGUCUGAGACAACGGC N ORMAL MetSerGlyArgProIleAlaHisHisGlnArg MetProSerIleIleLeuLys MetCysAspGluGluValLeuLysLeuValVal #7 MUTANT UUAAAAAAUUUAUGUGUGACGAAGAAGUUCUGAAAUUGGUUGUCUGAUUUUUUUUU #8 N ORMAL GCAGCGAAUAAGUUAUGUUAAUCGGAUGGCGG CCC AUAAGAGUUUAGUAUGG #8 MUTANT GCAGCGAAUAAGUUAUGUU G AUCGGAUGGCGG CCC AUAAGAGUUUAGUAUGG #9 N ORMAL UUGGACCU CCC AUGGAC GAG ACAACAGGUUGAGCGGGACUAUUGAGGCGACGGCAA #9 UUGGACCU CCC AUGGAC GAG AAA CAG GUU GAG CGGGACUAUUGAGGCGACGGCAA MetCysAspGluGluValLeuLysLeuValVal MetLeuIleGlyTrpArgProIleArgVal MetLeuIleGlyTrpArgProIleArgVal MetAspGluThrThrGly
  8. 8. MUTANT MetAspGluLysGlnValGluArgAspTyr

×