Chelonian diagnostics, pathology and treatment

  • 171 views
Uploaded on

2013 International Symposium on Ranaviruses …

2013 International Symposium on Ranaviruses
by Matthew Allender

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
171
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
3
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Chelonian Diagnostics, Pathology, and Treatment Matt Allender, DVM, MS, PhD, Diplomate ACZM Ranavirus Symposium July 2013 @Turtle_Doc #RV13
  • 2. Ranavirus epidemiology  Disease events are often clustered in local epizootics  Some occur on annual basis  Several sources report a significant threat to biodiversity  Population density mortality in salamander studies  Environmental factors change prevalence  Restoration efforts
  • 3. Quantitative PCR  TaqMan primer-probes were designed using Primer Express targeting a portion of the MCP that was contained within the 531 bp product  Forward: AACGCCGACCGAAAACTG  Reverse: GCTGCCAAGATGTCGGGTAA  Probe: CCGGCTTTCGGGC  Resultant segment was a 54 bp product
  • 4. Conventional PCR Level of Detection: 529,000 viral copies 52 viral copies Quantitative PCR
  • 5. Epidemiologic evidence Category Institution FV3 positive FV3 negative Prevalence 95% CI Free-living* OR 1 308 0.3% 0 – 1.8 % Rehabilitation* 7 217 3.13% 1.5 – 6.3% UT 3 35 7.9% 2.7 – 20.1 % WCV 2 120 1.6% 0.4 – 5.9 % NCSU 0 46 0.00% 0 – 7.7 % AWC 2 14 14.3% 4.0 – 39.9 % UGA 0 9 0.00% 0 – 29.9 % Total 8 525 1.5% 0.8 – 2.9% * Significant difference between prevalence in free-living population and rehabilitation populations, p=0.01, one-tailed
  • 6. Results Variable FV3 positive FV3 negative Prevalence 95% CI Female 3 168 1.8 % 0.6 – 5.0 % Male 0 218 0.00% 0 – 1.7 % Adult 2 398 0.5 % 0.1 – 1.8 % Juvenile 2 55 3.5 % 0.9 – 11.9 % Sex: p=0.157, observed power = 0.73 Age: p=0.081, observed power = 0.91
  • 7. Housing  Environmental chamber within Division of Animal Resources at UI-CVM  15’9” x 12”  Temperature was acclimated for 1 week prior to beginning study  Recorded daily and maintained +/- 1°C throughout duration of study  Adult female red-eared sliders maintained in 45 or 50 gallon plastic enclosures with ~20 gallons freshwater and basking spot
  • 8. Virus  Ranavirus isolated from infected eastern box turtle  100% sequence homology to MCP of FV3  Grown to confluence in TH-1  Divided into aliquots of 5 x 105 TCID50  Quantitative PCR performed on virus  Four animal in each temperature group were administered 1 aliquot (0.67 ml) in the right forelimb muscle  Uninfected controls administered same volume crude cell lysate
  • 9. Sample collection  Weight, whole blood, oral and cloacal swabs collected twice prior to inoculation to confirm negative status, then twice weekly throughout duration of study  PCV, TS, WBC, differential performed each sample  Clinical signs were recorded daily  Animals were euthanized when clinical signs were severe (as described in IACUC) or at 30 days post- inoculation  Control animal was euthanized at same time as inoculated animal  Gross necropsy performed within 48 hours  Histopathology of 8 tissues  qPCR of necropsy tissues
  • 10. Results  Survival  22°C – all inoculated turtles were euthanized due to severity of signs  28°C – only 2 turtles were euthanized due to clinical signs  One uninfected control died of sepsis  Median survival times  22°C = 24 days (14 -30)  28°C = 30 days (17-30) 22C 28C
  • 11. Results  *Significant increase over time (F=11.1, p=0.045)  Significant difference between control and inoculated turtles (p=0.035)  #Significant increase over time (F=7.13, p=0.026) Time 22°C Weight 28°C Weight Pre-inoculation 1693.5625* 2063.1250# Initial post- inoculation 1692.50* 2082.50# Terminal 1802.50* 2159.50#
  • 12. Results Tissue Parameter 22C Viral Copies 28C Viral Copies Tongue Mean/median* 1.25 x 109* 5.94 x 106* Skeletal Muscle Mean/median* 3.7 x 1010* 3.64 x 108* Lung Mean/median* 6.29 x 109* 5.01 x 109* Heart# Mean/median* 2.92 x 1010 1.27 x 109* Liver^ Mean/median* 2.15 x 109 1.70 x 107* Spleen Mean/median* 2.23 x 1010* 5.44 x 107* Ovary Mean/median* 8.93 x 109* 9.06 x 106* Kidney Mean/median* 3.46 x 1010* 2.54 x 108* # Significant difference between environmental temperatures, p=0.012 ^ Significant difference between environmental temperatures, p=0.011
  • 13. Results
  • 14. Temperature evidence  Mortality  22°C  Significant association between inoculation and disease (p=0.014)  28°C  No significant association between inoculation and disease (p=0.214)  Non-significant mortality was seen at lower temperature (100%) than higher temperature (50%)  Power = 0.34
  • 15. Temperature evidence  qPCR  Viral copies quickly went from undetectable to millions/billions of copies  All positive turtles had between 2 and 4 positive samples prior to death  Highest in whole blood, lowest in cloacal swab (non- significant) at 22°C  Specificity and Sensitivity  Whole blood  100% specific and 100% sensitive  Oral swab and cloacal swab  100% specific and 83% sensitive
  • 16. Results
  • 17. Conclusions  Prevalence in surveys of free-ranging populations are low  Are chelonians a spill-over host?  Natural history characteristics make it difficult to identify mortality events?  Are chelonians a reservoir host and fail to develop signs?  Are mechanisms of transmission different in chelonians which provide natural protection?
  • 18. Conclusions  Environmental temperature leads to differences in mortality in red-eared sliders  Both host and pathogen factors that may lead to protection at higher temperatures  May play a role in persistence or transmission  Do other species have similar response to changes in temperature?  Opportunity for therapeutic intervention
  • 19. Funding Sources  Morris Animal Foundation  qPCR development and prevalence study  CRESO  Prevalence study  Fluker’s Farms/Cox Pharmacology lab  PK study
  • 20. Questions?