Your SlideShare is downloading. ×
  • Like
Collagen Central Tolerance to Arthritogenic Autoimmune ...
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Now you can save presentations on your phone or tablet

Available for both IPhone and Android

Text the download link to your phone

Standard text messaging rates apply

Collagen Central Tolerance to Arthritogenic Autoimmune ...

  • 1,284 views
Published

 

Published in Technology , Design
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
1,284
On SlideShare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
0
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Lymphotoxin Pathway-Directed, Autoimmune Regulator-Independent Central Tolerance to Arthritogenic This information is current as of October 19, 2010 Collagen Robert K. Chin, Mingzhao Zhu, Peter A. Christiansen, Wenhua Liu, Carl Ware, Leena Peltonen, Xuejun Zhang, Linjie Guo, Shuhua Han, Biao Zheng and Yang-Xin Fu J. Immunol. 2006;177;290-297 http://www.jimmunol.org/cgi/content/full/177/1/290 Downloaded from www.jimmunol.org on October 19, 2010 References This article cites 31 articles, 16 of which can be accessed free at: http://www.jimmunol.org/cgi/content/full/177/1/290#BIBL 7 online articles that cite this article can be accessed at: http://www.jimmunol.org/cgi/content/full/177/1/290#otherarticle s Subscriptions Information about subscribing to The Journal of Immunology is online at http://www.jimmunol.org/subscriptions/ Permissions Submit copyright permission requests at http://www.aai.org/ji/copyright.html Email Alerts Receive free email alerts when new articles cite this article. Sign up at http://www.jimmunol.org/subscriptions/etoc.shtml The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 9650 Rockville Pike, Bethesda, MD 20814-3994. Copyright ©2006 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.
  • 2. The Journal of Immunology Lymphotoxin Pathway-Directed, Autoimmune Regulator-Independent Central Tolerance to Arthritogenic Collagen1 Robert K. Chin,2* Mingzhao Zhu,2* Peter A. Christiansen,* Wenhua Liu,* Carl Ware,† Leena Peltonen,‡ Xuejun Zhang,§ Linjie Guo,§ Shuhua Han,§ Biao Zheng,3§ and Yang-Xin Fu3,4* Ectopic expression of peripherally restricted Ags by medullary thymic epithelial cells (mTECs) is associated with negative selec- tion. Autoimmune regulator (AIRE) is considered to be the master regulator of these Ags. We show in this study that the ectopic expression of type II collagen (CII) in mTECs and the corresponding central tolerance to CII are AIRE independent but lym- photoxin dependent. The failure to properly express CII in mTECs of Lta / and Ltbr / mice leads to overt autoimmunity to CII and exquisite susceptibility to arthritis. These findings define the existence of additional pathways of ectopic peripheral Ag expression, parallel to and independent of AIRE, which may cover an extended spectrum of peripheral Ags in the thymus. The Journal of Immunology, 2006, 177: 290 –297. Downloaded from www.jimmunol.org on October 19, 2010 A TCR repertoire that is exquisitely fitted to self-MHC is mented for Lta / and Ltbr / mice and indeed mice deficient in crucial for the sensitivity with which T cells must re- several downstream signaling molecules (5, 7–9). spond to foreign Ags. This requirement is balanced Clinical findings in APECED patients with mutations in AIRE, against the necessity of eliminating or otherwise controlling the and analysis of Aire / mice, have revealed autoimmunity and imminent threat of overtly self-reactive TCR specificities. Auto- autoimmune destruction focused predominantly on features the en- immune regulator (AIRE),5 considered a master regulator (1), docrine system (1– 4). The targeting of predominantly endocrine drives the presentation of a robust and comprehensive immuno- organs in APECED and Aire / mice raises the possibility that, logical self in the thymus through the ectopic expression of pe- even in the absence of AIRE, hosts can remain tolerized to the ripherally restricted Ags by key medullary thymic epithelial cells wide spectrum of outstanding peripherally restricted Ags. To ex- (mTECs). Mutation of AIRE is responsible for autoimmune poly- plore the possibility that, in addition to AIRE, lymphotoxin sig- enocrinopathy-candidiasis-ectodermal dystrophy (APECED), an naling drives an additional host of parallel pathways for the ectopic autosomal recessive, monogenic disorder characterized by organ- expression of peripheral Ags, we investigated self-Ags known to specific autoantibodies and multiorgan autoimmune destruction be targeted in autoimmune disease, but not targeted in APECED. (2– 4). The expression of AIRE in mTECs is itself directed by Type II collagen (CII) is a prominent target of autoimmune de- signaling through the lymphotoxin- receptor (LT R) (5). Its li- struction in rheumatoid arthritis (RA) and is the arthritogenic Ag in gand LT is expressed predominantly in the lymphoid compartment the mouse model of RA, collagen-induced arthritis (CIA) (10, 11). and is up-regulated on activated thymocytes (6). Autoimmunity It is unclear whether there is a defect at the level of central or arising from perturbed tolerance in the thymus has been docu- peripheral tolerance in the pathogenesis of disease. There is a pre- ponderance of evidence implicating CD4 T cells as the central mediators of disease induction in arthritis (12). Not only does sus- *Department of Pathology and Committee in Immunology, University of Chicago, ceptibility segregate with class II MHC (MHC-II) polymorphism, Chicago, IL 60637; †Division of Molecular Immunology, La Jolla Institute for Al- administration of mAbs in mouse models against TCR , CD4, lergy and Immunology, San Diego, CA 92121; ‡University of Helsinki and National Public Health Institute, Helsinki, Finland; and §Department of Immunology, Baylor and I-A all prevent disease (13–15). Recent gene array analysis of College of Medicine, Houston, TX 77030 mouse MECs revealed many gene transcripts that may not be con- Received for publication December 2, 2005. Accepted for publication April 12, 2006. trolled by Aire (16, 17). Interestingly, CII also is selectively ex- The costs of publication of this article were defrayed in part by the payment of page pressed in human MECs, raising the possibility that impaired cen- charges. This article must therefore be hereby marked advertisement in accordance tral tolerance may contribute to human RA (18). Given the with 18 U.S.C. Section 1734 solely to indicate this fact. 1 essential contributions of autoreactive T cells to the pathogenesis This research was supported by National Institutes of Health Grants HD062026, DK58897, and CA09296-01 (to Y.-X.F.), RO1 AI051532 (to S.H.), and RO1 of both RA and CIA, we sought to define the role of central tol- AG17149 (to B.Z.). erance in forestalling anti-CII autoimmunity and examine the input 2 R.K.C. and M.Z. contributed equally to this study. of both AIRE and LT to this process. 3 Y-X.F. and B.Z. share senior authorship. 4 Address correspondence and reprint requests to Dr. Yang-Xin Fu, Department of Materials and Methods Pathology, 5841 South Maryland Avenue, Chicago, IL 60637. E-mail address: Mice yfu@uchicago.edu 5 Lta / and Ltbr / mice, originally established on the 129 strain, were Abbreviations used in this paper: AIRE, autoimmune regulator; CII, type II colla- gen; TEC, thymic epithelial cell; mTEC, medullary TEC; MEC, medullary epithelial backcrossed to C57BL/6 mice for at least 13 and 11 generations, respec- cell; LT, lymphotoxin; APECED, autoimmune polyenocrinopathy-candidiasis-ecto- tively, and maintained under specific pathogen-free conditions as de- dermal dystrophy; CIA, collagen-induced arthritis; RA, rheumatoid arthritis; MHC-II, scribed. C57BL/6 and Rag1 / mice were purchased from The Jackson MHC type II; K14, keratin-14; WT, wild type. Laboratory. Ltbr / mice were obtained from Taconic Farms. Aire / Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00
  • 3. The Journal of Immunology 291 mice were a gift from Dr. L. Peltonen (University of Helsinki and National Autoantibody ELISA Public Health Institute, Helsinki, Finland). Animal care and use were in accordance with institutional and National Institutes of Health guidelines. For detection of anti-insulin autoantibodies, ELISA plates (Dynex Tech- nologies) were coated with 2 U/ml insulin (Lilly Research Laboratories) at 4°C overnight. For the detection of anti-collagen Abs, ELISA plates were mTEC isolation coated with ELISA-grade bovine CII (Chondrex) according to the manu- TECs were isolated largely according to previously described protocol (1). facturer’s instructions. Plates were washed with water and blocked with Briefly, five thymi from young (5- to 7-wk-old) mice were digested with PBS/0.1% BSA for 1 h at 37°C. Serum samples were serially diluted in collagenase (0.1 g/ml), dispase (2 U/ml), and DNase (10 U/ml) in RPMI PBS/0.1% BSA from 1/300 to 1/8100. Bound Abs were detected with 1640 (5% FCS) for 30 min three rounds at 37°C. Cells were resuspended alkaline phosphatase-conjugated goat anti-mouse IgG (Southern Biotech- in PBS (5 mM EDTA, 1% FCS), incubated on ice for 10 min, and then nology Associates). The OD was measured at 405 nm by a spectropho- separated on a discontinuous Percoll density gradient. The TEC-enriched tometer (Molecular Devices). Following dilution factor correction, adja- fraction was harvested and stained with G8.8, 6C3 (Ab to cortical epithelial cent OD readings on linear portion of titration curve were averaged. cell marker with the same reactivity as CDR1; BD Pharmingen), and Arbitrary units were calculated from standard curve and divided by 103 CD45.2. mTECs were sorted on a MoFlo (DakoCytomation) according to before plotting. For statistical analysis, p values were determined by Stu- the phenotype of CD45.2 G8.8 6C3 with purity of 90%. dent’s two-tailed t test. Real-time PCR Splenocyte and T cell transfer Real-time PCR was conducted on cDNA prepared from DNase-treated Splenocytes were obtained by mechanically disrupting the spleens of 5- to RNA extracted from whole thymus or sorted mTECs after four-color anal- 7-mo-old age-matched Ltbr / and WT control mice. RBCs were depleted ysis and gating. RNA from mTECs was further amplified with the Ribo- with ammonium chloride (ACK) RBC lysis buffer. Forty million cells were Amp RNA amplification kit (Arcturus) before cDNA preparation. For Aire, injected retro-orbitally into sublethally irradiated (350 rad) Rag1 / mice. the following primers were used: (forward) CCAGTGAGC Mice were bled 4 wk after transfer and analyzed for autoantibodies. For T CCCAGGTTAAC, (reverse) GACAGCCGTCACAACAGATGA, (probe) cell transfer, B cells were purified from C57BL/6 WT mice by MACS FAM-TCACCTCCGTCGTGGCACACG-TAMRA. For insulin, the fol- column (Miltenyi Biotec), and CD4 T cells were similarly purified by lowing primers were used: (forward) CTTCAGACCTTGGCGTTGGA, MACS column from age-matched C57BL/6 WT and Ltbr / mice. Two Downloaded from www.jimmunol.org on October 19, 2010 (reverse) ATGCTGGTGCAGCACTGATC, (probe) FAM-CCCGGCA million purified CD4 T cells from either C57BL/6 WT or Ltbr / mice GAAGCGTGGCATT-TAMRA. For CII, the following primers were used: were combined with 10 million purified WT B cells, and injected retroor- (forward) ATTGAGAGCATCCGCAGCC, (reverse) GTTTCAGGTCTT bitally into Rag1 / mice. Mice were bled 8 wk after transfer and analyzed GGCAAGTGC, (probe) FAM-ACGGCTCCCGCAAGAACCCTG- for autoantibodies. TAMRA. For keratin-14 (K14), the following primers were used: (for- ward) TGGGTGGAGACGTCAATGTG, (reverse) ATCTCGTTCAG Thymus transplantation GATGCGGC, (probe) FAM-ACGCCGCCCCTGGTGTGG-TAMRA For Thymi were isolated from newborn Ltbr / or WT mice and cultured in normalization, primers for GAPDH were used: The primers for GAPDH 1.35 mM 2-deoxyguanosine (Sigma-Aldrich) for 6 – 8 days to deplete bone were as follows: (forward) TTCACCACCATGGAGAAGGC, (reverse) marrow-derived cells. Thymi were then transplanted under the kidney cap- GGCATGGACTGTGGTCATGA, (probe) TET-TGCATCCTGCACCAC sule of 6-wk-old adult C57BL/6 mice that were thymectomized at 4 wk of CAACTGCTTAG-TAMRA. Duplex real-time PCR, with GAPDH as in- age. Recipients were lethally irradiated and reconstituted with WT bone ternal control, was conducted in a final volume of 25 l with 900 nM of the marrow immediately before thymus transplantation. Whole blood was col- forward and reverse primers and 200 nM of the probe using 2 Taqman lected 6 wk after transplantation. T cell reconstitution was assessed by Master Mix (Applied Biosystems) containing AmpliTaq Gold polymerase. FACS analysis of whole blood for CD4, CD8, and B220. Serum was used Reactions were run on the Cepheid SmartCycler. Analysis of AIRE, insu- for autoantibody ELISA as described above. lin, K14, and GAPDH gene expression were performed with a concurrently run standard curve, then normalized to sample GAPDH levels. The stan- In vitro T cell stimulation and collagen-induced arthritis dard curves for AIRE, insulin, CII, K14, and GAPDH had r2 values 0.98. For the induction of CIA, 12-wk-old C57BL/6 WT or Lta / animals were / injected i.d. at the base of the tail, with 100 g (in 100 l) of chicken CII In vivo stimulation of wild-type (WT) and Lta mice (Sigma-Aldrich) dissolved in 0.01 M acetic acid and emulsified in an equal / volume of CFA prepared by grinding 100 mg of heat-killed Mycobacte- WT and Lta mice received i.p. injections of 50 g of agonistic anti- rium tuberculosis (H37Ra; Difco) in 20 ml of IFA (Sigma-Aldrich). Mice LT R Ab or rat-Ig isotype control in PBS. RNA from thymi were collected were boosted with the same dose of CII in IFA by i.p. injection at day 21, at 8 and 24 h after injection. Real-time PCR was conducted on cDNA then observed daily for the onset of arthritis. The arthritis index was de- prepared from DNase-treated RNA extracted from whole thymus. rived by grading the severity of each paw from 0 to 3 as described (19), based on the degree of swelling and periarticular erythema. The scores of Histology all four paws were added up to yield the arthritic index (19). For in vitro Joint tissues collected for histologic examination were obtained 2 wk fol- T cell stimulation, CD4 T cells were purified from the spleen by MACS lowing secondary immunization, fixed in 10% buffered Formalin, and em- column (Miltenyi Biotec) from C57BL/6 WT and Lta / mice 10 days bedded in paraffin. Sections (4 –5 m) were obtained from the paraffin after secondary CII immunization or primary KLH immunization, respec- blocks and stained by H&E methods. All sections were then examined tively. Splenocytes from young, normal congenic mice were irradiated with qualitatively by a pathologist in a blinded fashion. 2000 rad and used as APCs. A total of 4 105 purified T cells and 1 106 APCs per well were used for proliferation assays. Denatured Arthrogen- CIA T cell grade type II chicken collagen (Chondrex) or keyhole limpet Immunofluorescence staining hemocyanin (Sigma-Aldrich) was added as stimulating Ag at concentra- Age-matched thymi from WT, Lta / , and Aire / were embedded in tions of 0, 10, and 50 g/ml. Cells were cultured in flat-bottom 96-well OCT and snap-frozen. Sections (8 m) were obtained from the frozen plates with DMEM supplemented with 1.5% homologous normal serum, blocks, fixed in acetone, rehydrated in PBS/0.1% saponin, and blocked penicillin-streptomycin (1 ), and 2-ME (2-ME, 5 105 M) for 5 days. with 5% goat serum in PBS at room temperature for 1 h. mAb to Ep-CAM [3H]thymidine was added 16 h before cell harvest. Cell culture superna- (clone G8.8; BD Biosciences), biotin-conjugated anti-CII mAb (Chon- tants were collected at 72 h, and IFN- concentration was analyzed by drex). This Ab also crossreacts with type XI collagen, because both types mouse Th1/Th2 cytokine CBA kit (BD Biosciences). of collagen comprise the same chain, 1(II). To simplify the presentation in this study, CII represents 1(II), polyclonal rabbit anti-AIRE (a gift from Results Dr. P. Peterson, University of Tartu, Tartu, Estonia), and FITC-conjugated Ectopic thymic expression of CII is independent of AIRE mAb to CD11c (clone N418; Biolegend) were incubated with tissue sec- tions at 4°C overnight. Appropriate fluorescence-labeled secondary Abs To determine whether CII, like insulin, is expressed in the thymus, were used for anti-Ep-CAM and anti-AIRE detection. Tyramid Signal Am- real-time PCR was used to measure CII ( 1) mRNA expression in plification-biotin amplification (PerkinElmer) was used for anti- CII-biosignal amplification in accordance with the product protocol. For 4-wk-old WT B6 thymi. CII was robustly expressed in WT thymi immunofluorescence staining of CII, strepavidin PE-cytochrome 5 was (Fig. 1a). To determine whether AIRE also is required for the used as the final reagent in TSA-biotin amplification. ectopic expression of CII, thymi from age-matched Aire / mice
  • 4. 292 AIRE-INDEPENDENT CENTRAL TOLERANCE BY LT FIGURE 1. Ectopic expression of CII is independent of AIRE. a, Real-time PCR analysis was conducted on cDNA prepared from DNase-treated RNA extracted from whole thymus. Relative abundance of mRNA levels of Ins1 and CII in 4- to 6-wk-old age-matched thymi from WT and Aire / mice is shown. The data represent the mean SEM. b and c, Production of anti-insulin (b) and anti-CII Ab (c) from age-matched (5–7 mo) WT and Aire / mice were measured by serum ELISA. Titers in arbitrary units were plotted after being divided by 103. Statistical analysis by Student’s t test. were analyzed for relative CII mRNA levels and found to be sta- agonistic LT R mAb (3C8). Mice were injected i.p. with 3C8 or tistically similar to WT (Fig. 1a). This is in striking contrast with control rat-Ig, and thymi were collected after 8 and 24 h. At 8 h, the ectopic expression of insulin, which was undetectable in the WT mice treated with 3C8 demonstrated a 7-fold induction in Aire thymi of Aire / mice (Fig. 1a). These findings raise the possi- mRNA expression and a 20-fold increase in ectopic CII mRNA bility that the ectopic expression of CII, and possibly a host of (Fig. 2c). At 24 h, expression of both genes had returned to base- other autoantigens, is AIRE independent. line levels. Agonistic LT R mAb treatment of Lta / mice re- To determine whether the divergent expression profiles of CII sulted in a similar pattern of induction (Fig. 2d). Thus, not only Downloaded from www.jimmunol.org on October 19, 2010 and insulin in the Aire / thymus manifests themselves into dif- does CII expression respond to LT R stimulation, but also the ferent susceptibility to autoimmune reactivity to these Ags with kinetics of its regulation by LT R signaling is rapid, demonstrat- age, we analyzed, by ELISA, spontaneously arising anti-insulin ing the exquisite sensitivity by which CII is controlled by the LT and anti-CII Ab titers of 5- to 7-mo-old age-matched WT and pathway. To demonstrate that the induction of CII by stimulation Aire / mice. Although there was a significant increase in the with agonistic LT R Ab is specific to appropriate downstream titers of anti-insulin Ab in Aire / mice relative to WT (Fig. 1b), targets, we used K14 as a negative control. K14 is a marker con- there was no perceptible change in anti-CII titers (Fig. 1c). These stitutively expressed by medullary epithelial cells and not known data suggest that ectopic expression of peripheral Ags in the thy- to be inducible by LT R. Under all conditions of stimulation, we mus may play a crucial role in forestalling the development of found ample expression but negligible induction of K14 (Fig. 2, c autoimmunity to those specific Ags. In contrast with the failure of and d). Together, these data suggest that thymic expression of CII ectopic insulin expression in Aire / thymi and subsequent raising is controlled by LT. of anti-insulin Abs, ectopic expression of CII and tolerance to CII were unaffected by the absence of AIRE. AIRE and CII expression may be segregated into distinct cell Thymic expression of CII is controlled by LT populations As an Ag whose expression in the periphery is tightly restricted, Having determined by real-time PCR that Aire / leave ectopic the ectopic expression of CII in the thymus is likely to be similarly expression of CII in the thymus undisturbed, whereas Lta / regulated, even if independent of AIRE. Previous studies have and Ltbr / thymi present with serious disruption of CII ex- demonstrated the rapid kinetics and acute sensitivity with which pression, we undertook to confirm these findings at the protein Aire and ectopic insulin expression respond to signaling through level by immunofluorescence localization. Double staining in the LT pathway (5). Grossly, we did not observe a major reduction WT thymi of ectopically expressed CII (red) and the MEC of the medulla area by H&E staining nor by various anti-mTEC marker G8.8 (green) localized the ectopically expressed CII Abs. To determine whether the LT pathway controls the ectopic within the epithelial cells of the thymic medulla (Fig. 3a). To expression of CII, as it does insulin, we used real-time PCR to assess whether ectopically expressed CII is disturbed in Aire / measure CII mRNA expression in age-matched WT, Lta / , and and Lta / thymi, age-matched thymi from these mice were Ltbr / thymi. Both Lta / and Ltbr / thymi showed a 75– 80% similarly stained. Although Aire / thymi presented with no reduction in their expression of CII, the level of reduction similar perturbation in ectopic CII expression (Fig. 3b), Lta / thymi to insulin (Fig. 2a). To exclude the possibility that the reduction appeared to have substantially lost CII expression (Fig. 3c). of Ag levels in Lta / and Ltbr / thymi was due to a reduc- These findings confirm our real-time PCR data, that although tion in mTEC numbers (5, 7–9), mTECs from 6-wk-old WT and ectopic expression of CII is independent of AIRE, it is critically Ltbr / thymi were isolated according to the method described dependent on LT signaling. previously (1), and CII mRNA expression level was deter- Having demonstrated that CII is expressed in the thymus in- mined. On a per-cell basis, CII expression was again reduced in dependently of AIRE, we wished to determine further whether Ltbr / mTECs relative to WT with GAPDH as internal control the pathway responsible for CII expression localizes to the same (data not shown). Furthermore, because K14 is specifically and cell population as the AIRE pathway. Double staining of WT constitutively expressed in the majority of mTECs (5, 20). K14 thymi for AIRE (green) and CII (red), revealed no significant was used as an internal control in real-time PCR, CII expression colocalization (Fig. 3, d–f). Additionally, staining of dendritic remained reduced in Ltbr / mTECs relative to WT (Fig. 2b). cell markers has excluded these lineages as the source of ec- These data suggest that the LT pathway is necessary for the topic CII (Fig. 3, g and h). Together, these data suggest that optimal expression of CII in mTECs. AIRE-dependent and parallel AIRE-independent pathways re- To explore the kinetics by which CII can be induced by signal- side in distinct cohorts of mTECs, together forming a patch- ing through LT R, young adult WT mice were treated briefly with work representation of the peripheral self.
  • 5. The Journal of Immunology 293 FIGURE 2. Ectopic expression of CII is dependent on LT. Real-time PCR analysis was conducted on cDNA prepared from DNase-treated RNA extracted from whole thymus. Relative abundance of mRNA levels of CII (a) in 4- to 6-wk-old age-matched WT, Lta / , and Ltbr / thymi is shown. Error bars indicate SD. b, Stroma from the thymi of five 6-wk-old WT or Ltbr / mice was stained with CD45.2, G8.8, and 6C3 Abs. RNA Downloaded from www.jimmunol.org on October 19, 2010 was isolated from sorted mTECs and amplified. cDNA was made and subject to real-time PCR to determine CII mRNA expression relative to the internal control, Krt1–14. Error bars indicate SD. c and d, Four-week-old WT (c) and Lta / (d) mice were injected i.p. with agonistic LT R-Ab FIGURE 3. AIRE and CII expression are segregated into distinct cell (3C8) or rat-Ig isotype control. RNA was collected from recipient thymi 8 populations. a– c, Simultaneous tissue immunofluoresence staining for ec- or 24 h later, and real-time PCR was used to evaluate the relative abun- topically expressed CII (red) and mTEC maker Ep-CAM (green) on thymic dance of Aire, CII, and Krt1–14 mRNA in recipients in response to 3C8 tissue sections from age matched WT (a), Aire / (b), and Lta / (c) mice. stimulation. Time (h) indicates hours of exposure of recipients to 3C8. Fold d–f, Simultaneous immunofluoresence staining of AIRE (green) and CII induction was calculated against respective rat-Ig isotype-treated thymi. (red): AIRE (d, green), and CII (e, red). f, Simultaneous immunofluores- The data represent the mean SEM. ence staining of ectopically AIRE (green) and CII (red). g and h, Simul- taneous staining of dendritic cell marker CD11c (green) and CII (red). Breakdown of central tolerance leads to spontaneous anti-collagen autoimmunity both the lymphoid-autonomous nature of the autoimmunity Having found profound reduction in CII expression in the thymi shown in these mice and the magnitude of autoimmune destruc- of Lta / and Ltbr / mice, in a manner reminiscent to that of tion that can arise from a defect in LT-regulated central toler- ectopic insulin expression, we investigated further whether, ance. To attribute the autoimmunity exclusively to the T cell similar to insulin, this reduction in ectopically expressed CII compartment, we transferred 2 million purified Ltbr / or WT was severe enough to represent a breakdown of tolerance. Au- T cells, in conjunction with 10 million purified WT B cells, into toantibodies to CII, a T cell-dependent response, have been Rag1 / mice. These autoantibody titers were similarly ele- shown to initiate joint inflammation by binding to articular car- vated in Rag1 / recipients of purified Ltbr / donor T cells tilage and activating complement and are sufficient on passive after 8 wk (Fig. 4, e and f). These data suggest that there is a transfer to induce severe acute arthritic damage (21, 22). We potential increase of autoreactive T cells in the spleen leading assayed for the production of spontaneously arising anti-CII to increased anti-CII Ab production. Abs as an indicator of defective T cell-dependent tolerance in Although the above splenocyte and T cell transfer experi- Lta / and Ltbr / mice by ELISA. Consistent with a break- ments have focused the autoimmune defect to the T cell com- down in tolerance to this self-Ag, we found significantly higher partment, they still do not conclusively define whether this titers of CII Ab and anti-insulin Ab in both Lta / and Ltbr / breakdown in T cell tolerance occurs centrally or in the periph- mice (Fig. 4, a and b). Despite overt anti-CII autoimmunity, ery. To unequivocally demonstrate that the absence of LT sig- analysis of both Lta / and Ltbr / mice age 1 year revealed naling in the thymus results in a breakdown of T cell central no evidence of spontaneously arising arthritis, presumably be- tolerance in Lta / and Ltbr / mice, we performed thymus cause the absence of peripheral LT signaling blocks disease transplantation experiments. Thymi from Ltbr / and WT new- pathogenesis, as demonstrated recently (23). born pups were cultured for 6 – 8 days in the presence of 1.35 To sidestep the constraint imposed by the absence of LT sig- mM 2-deoxyguanosine to deplete bone marrow-derived cells. naling in the periphery, and to confirm that the autoimmunity in These thymi were then transplanted under the kidney capsule of Lta / and Ltbr / mice represents a defect within the lym- 6-wk-old thymectomized B6 mice. Recipients were lethally ir- phoid compartment, 40 million splenocytes from 7-mo-old WT radiated before surgery and reconstituted with WT bone marrow and Ltbr / mice were transferred into lightly irradiated (350 the same day. Screening of recipients at 12 wk postop found rad) Rag1 / mice. Similar to anti-insulin Ab, serum titers of comparable reconstitution of the T cell compartments (data not anti-CII Ab also were significantly elevated in Rag1 / recip- shown). Screening for spontaneously arising autoantibodies, we ients of Ltbr / donor splenocytes (Fig. 4, c and d). Ltbr / found significant higher levels of anti-insulin and anti-CII Abs donor splenocytes in Rag1 / hosts were thus able to recapit- in recipients of Ltbr / thymi (Fig. 5, a and b). An increase in ulate the findings of Lta / and Ltbr / mice, demonstrating tissue infiltration of T cells is often seen in Ltbr / and Aire /
  • 6. 294 AIRE-INDEPENDENT CENTRAL TOLERANCE BY LT FIGURE 5. Thymic LT R expression is critical for central tolerance. Neonatal WT and Ltbr / thymi were cultured in 1.35 mM 2-deox- yguanosine (Sigma-Aldrich) for 6 – 8 days to deplete bone marrow-derived cells. Thymi were then transplanted under the kidney capsule of 6-wk-old thymectomized C57BL/6 mice. Recipients were lethally irradiated and re- constituted with WT bone marrow the same day. Recipient sera were an- Downloaded from www.jimmunol.org on October 19, 2010 alyzed by ELISA for the presence of anti-insulin (a) and anti-collagen Abs (b) 3 mo following transplant. Titers expressed in arbitrary units. Student’s t test is used for statistical analysis. Increase of infiltration of lymphocytes into liver was clearly visualized in nude mice reconstituted with Ltbr / thymi (c). Lta / and Ltbr / mice is sufficiently severe to overcome the inhibitions of their resistant C57BL/6 background in vivo, we FIGURE 4. Autoimmune inflammation in LT-deficient mice is lympho- challenged WT and Lta / mice with heterologous CII emul- cyte autonomous. a and b, Production of anti-insulin (a) and anti-CII Ab sified in CFA, boosted at day 21 with i.p. injection of IFA- (b) from age-matched (5–7 mo) WT, Lta / , and Ltbr / mice was mea- emulsified CII. At day 11 after boost, both groups display 100% sured by serum ELISA. c and d, Age-matched (5–7 mo) WT and Ltbr / incidence of arthritis symptoms. Although WT B6 mice re- splenocytes were adoptively transferred into sublethally irradiated mained only mildly symptomatic in response to repeat immu- Rag1 / recipients. Recipient sera were analyzed by ELISA for the pres- nizations, all Lta / mice developed fulminant disease pheno- ence of anti-insulin (c) and anti-collagen Abs (d). e and f, Age-matched type after the secondary immunization (Fig. 6a). In Lta / (5–7 mo) WT or Ltbr / CD4 T cells were combined with WT B cells mice, histological analysis of the interphalangeal joints 2 wk and transferred to Rag1 / mice. Recipient sera were analyzed by ELISA after secondary immunization showed typical synovial hyper- for the presence of anti-insulin (e) and anti-collagen Abs (f) Representative plasia and infiltration of the subsynovial tissue with inflamma- figure of two independent experiments. tory cells, including lymphocytes, whereas WT joints were his- tologically normal(Fig. 6b). These findings demonstrate that the breakdown in central tolerance to CII in Lta / and Ltbr / mice and as an important feature of autoimmunity. To deter- mice may be sufficiently severe to render them now susceptible mine whether recipients of Ltbr / thymi recapitulate this in- to CIA, despite their resistant C57BL/6 background. crease in tissue infiltration, various tissues were collected and To confirm that CII-responsive autoreactive T cells in Lta / submitted for histological analysis. These studies indeed re- mice play an integral role in the inexorable progression of CIA vealed increased tissue infiltration in reconstituted mice, espe- in Lta / mice, we analyzed CII-specific T cell responses. cially in the liver (Fig. 5c). These data clearly demonstrate not CD4 T cells were purified from WT and Lta / mice 10 days only that T cell central tolerance is critical for suppression of after secondary immunization, before the appearance of clinical anti-CII autoimmunity, but also that the disruption of the ec- symptoms in vivo. These purified CD4 cells were challenged topic expression of insulin and CII in the thymi of Lta / and in vitro with standardized irradiated WT splenic APCs titrated Ltbr / mice results in autoimmune responses to those Ags. with the appropriate CII Ag. Thymidine incorporation assays demonstrated that, whereas WT CD4 T cells remained firmly Lta / mice are susceptible to CIA despite their resistant unresponsive to CII challenge, CD4 T cells from Lta / mice C57BL/6 background responded with robust proliferation. (Fig. 6c) Moreover, acti- Susceptibility to CIA is profoundly influenced by MHC-II ge- vation of CD4 T cells from Lta / mice led to their efficient netics, and in genetically resistant strains, such as C57BL/6, maturation into effector cells, as IFN- , the prototypic effector even repeated immunizations fail to produce disease (10). Our cytokine in CIA pathogenesis, also was significantly increased Lta / and Ltbr / mice, despite their resistant C57BL/6 back- in Lta / cell cultures relative to WT (Fig. 6d). In contrast with ground and lack of draining LNs, spontaneously elaborate anti- the self-Ag CII, immunization with the exogenous Ag KLH CII Abs and increased T cell response to CII in a manner rem- resulted in robust in vitro CD4 T cell responses from WT iniscent of strains susceptible to CIA, such as DBA/1(10). To mice, but only weak response in Lta / mice (Fig. 6e), sug- determine whether the disruption of central tolerance to CII in gesting that the excessive inflammatory response to CII seen in
  • 7. The Journal of Immunology 295 peripherally restricted Ags (1). Our recent demonstration that AIRE and AIRE-dependent peripherally restricted Ags are ab- sent in Lta / and Ltbr / thymi defined LT’s role in directing this machinery (5). Another study has shown that, although mTECs in Ltbr / thymi appear reduced by anti-Ulex euro- paeus agglutinin staining, they are unchanged by other markers for mTECs (5, 7–9). Recent gene array analysis of mouse MECs found numerous tissue-restricted genes up-regulated in mature mTECs independent of AIRE. Most, but not all, of these genes are induced in functionally mature CD80high mTECs (16, 17). Given the focused targeting of endocrine organs in APECED and the limited reduction in expression of tissue-specific Ags in the Aire / thymus, we sought to determine whether AIRE- independent pathways exist for the remainder of peripheral Ags for autoimmune diseases that are unrelated to AIRE. In this study, we find that while ectopic expression of CII is AIRE independent, it is nevertheless under LT control. The significant reduction of ectopic CII expression in both Lta / and Ltbr / thymi and isolated mTECs, and the rapid response of thymi to in vivo agonist LT R Ab stimulation, suggest that LT acts on mTECs directly. It remains to be determined whether the ab- Downloaded from www.jimmunol.org on October 19, 2010 sence of LT signaling could impair the proper function or or- ganization of a subset of mTECs. Very little is known about the signals that permit AIRE access to particular peripheral Ags, and even less is known about AIRE-independent pathways. FIGURE 6. LT -deficient mice are susceptible to CIA despite resistant Given the prominent polyendocrinopathy seen in APECED pa- C57BL/6 background. a, Incidence of arthritis and clinical scores of tients and Aire / mice, it is interesting to speculate that as C57BL/6 WT (open symbols, n 8 mice) and Lta / (filled symbols, n AIRE controls endocrine system Ags, other pathways may sim- 8 mice). The incidences of both groups were 100% after day 11. Individual ilarly direct peripheral Ags that are grouped, and restricted arthritic paws were evaluated for the severity of inflammation, and a com- along developmental lines. Indeed, our finding that ectopic CII bined clinical score was recorded (mean SEM, p 0.01). Results are and AIRE expression do not colocalize, coupled with data from representative of four similar independent experiments. b, Severe infiltra- tion found in the joints of challenged Lta / mice. Peripheral joints of B6 others that mTECs from AIRE deficient mice express only a WT and Lta / mice following secondary immunization were fixed in 10% limited number of Ags (16, 17), it is possible that AIRE and buffered formalin and paraffin mounted. Sections (4 –5 m) were stained AIRE-independent pathways are mutually exclusive in the in- by H&E and analyzed. Representative sections are shown. c, CD4 T cells dividual mTECs. from C57BL/6 WT and Lta / mice were purified 10 days after the sec- CII is a major constituent protein of cartilage in diarthrodial ondary CII immunization, and cocultured with irradiated normal congenic joints, the predominant site of inflammation in RA, and is tar- splenocytes in the presence of denatured chicken CII for 5 days. Each well geted specifically in the autoimmune response of RA patients contained 4 105 T cells and 1 106 irradiated splenic APC. [3H]thy- midine was added 16 h before cell harvest. Average cpm values SD of (24, 25). The notion that central tolerance to arithitogenic Ags triplicate wells were plotted after being divided by 103. Representative of preempts the initiation of autoimmune destruction in the CIA two experiments. d, Cell culture supernatants from triplicate were collected model is somewhat overlooked, mostly from conceptual mis- and pooled together at 72 h, and IFN- concentration was analyzed by givings of how these Ags can come to be presented in the thy- CBA kit. Data represent the IFN- concentration in 50 g of CII-stimu- mus. The uncovering of AIRE’s role in the ectopic thymic lated cell culture. e, CD4 T cells from C57BL/6 WT and in Lta / mice expression of peripheral Ags, and our findings relating to AIRE- were purified 10 days after the primary KLH immunization and cocultured independent pathways for ectopic expression of CII and likely with irradiated normal congenic splenocytes in the presence of denatured KLH for 5 days. Each well contained 4 105 T cells and 1 106 irra- others, remove this inhibition. Suggestive work by Lamhamedi- 3 diated splenic APC. [ H]thymidine was added 16 h before cell harvest. Cherradi et al. (26) in TRAIL / mice found an association Average cpm values SD of triplicate wells. Representative of four in- between defects in thymocyte apoptosis and the susceptibility dependent experiments. of C57BL/6 mice to CIA, although their system did not permit isolation of the TRAIL / defect exclusively to the thymus. We determined not only that CII was expressed in murine mTEC in Lta / mice is not due to a global T cell dysregulation. Rather, a LT-dependent fashion, but also that transplantation of Ltbr / these findings argue that the susceptibility of Lta / mice to thymi into resistant hosts was sufficient to break tolerance, dem- CIA is the result of a failure of T cell tolerance; that rather than onstrating the crucial protective contribution of central toler- the abortive response seen in WT T cells, Lta / T cells im- ance for autoimmune arthritis. Our findings are mirrored by properly tolerized to CII actively participate in the autoimmune recent studies demonstrating human mTEC expression of a destruction of joint structures. highly diverse selection of tissue-specific genes, including CII (18). Our study raises the possibility that the breakdown of Discussion central tolerance for CII may be critical for the development of Appreciation of AIRE’s role in promoting the ectopic expres- human RA. It’s noteworthy that both CII and CXI comprise the sion of a subset of peripherally restricted Ags in the thymus same chain, 1(II). Although CII is composed of three identical provided a crucial insight into how central tolerance covers 1(II) chains, CXI has additional two chains of 1(XI) and
  • 8. 296 AIRE-INDEPENDENT CENTRAL TOLERANCE BY LT 2(XI). Whether these additional chains for CXI also are in- determined whether and how peripheral tolerance may play a volved in LT-mediated tolerance and arthritis remains to be role in the limiting autoimmune destruction in both LT and determined. AIRE deficiency. Although we have found that Ltbr / mice are more suscep- The revelation of an AIRE-independent pathway for control- tible to CIA, others have described LT R-Ig fusion protein as ling different peripheral Ags in the thymus opens new avenues an effective inhibitor of CIA development, arresting even es- for exploration of the complex mechanisms of negative selec- tablished disease (23). There are several possible explanations. tion beyond AIRE. The ability of LT to induce ectopic expres- First, the LT pathway could play different, even opposing roles sion of peripherally restricted Ags, and the loss of AIRE-de- in central tolerance vs peripheral inflammation. The thymic de- pendent and independent Ags in Lta / and Ltbr / , permit fect in the absence of LT overcomes the absence of LT in the dissection of the LT-AIRE pathway, uncover the contributions peripheral environment. For example, CII-specific T cell pro- of other mechanism of tolerance in the context of impaired neg- liferation and IFN- secretion was significantly higher in ative selection, and the identification of possible AIRE family primed Lta / mice than that in WT mice in our study. Earlier members. Understanding of the regulation of AIRE and parallel studies (23) with LT R-Ig blockade had an isolated anti- pathways responsible for central tolerance may offer novel di- inflammatory response peripherally, without affecting central agnostic possibilities and therapies in the treatment of autoim- tolerance, and thus did not result in higher CII-specific T cell mune disease. proliferation and IFN- secretion. Second, different murine strains were used. DBA is a CIA-susceptible strain, meaning Disclosures that it may already harbor defects in central or peripheral CII- The authors have no financial conflict of interest. tolerance. Thus, LT R-Ig blockade in DBA models probably could not further exacerbate the central defect but would be active only in inhibiting peripheral inflammation. In contrast, References Downloaded from www.jimmunol.org on October 19, 2010 1. Anderson, M. S., E. S. Venanzi, L. Klein, Z. Chen, S. P. Berzins, S. J. Turley, B6 is a resistant strain, susceptible to CIA only with a defect in H. von Boehmer, R. Bronson, A. Dierich, C. Benoist, and D. Mathis. 2002. central tolerance as the result of LT deficiency. In the B6 back- Projection of an immunological self shadow within the thymus by the aire pro- ground, LT deficiency affects both central tolerance and in pe- tein. Science 298: 1395–1401. 2. Ahonen, P. 1985. Autoimmune polyendocrinopathy– candidosis– ectodermal dys- ripheral inflammation, with the central defect predominant. trophy (APECED): autosomal recessive inheritance. Clin. Genet. 27: 535–542. Third, the effect of genetic LT deficiency could be more com- 3. Bjorses, P., J. Aaltonen, N. Horelli-Kuitunen, M. L. Yaspo, and L. Peltonen. prehensive than those seen with LT R-Ig blockade. LT defi- 1998. Gene defect behind APECED: a new clue to autoimmunity. Hum. Mol. Genet. 7: 1547–1553. ciency during development permits appearance of compensa- 4. Peterson, P., K. Nagamine, H. Scott, M. Heino, J. Kudoh, N. Shimizu, tory mechanisms, such as increased TNF expression in place of S. E. Antonarakis, and K. J. Krohn. 1998. APECED: a monogenic autoimmune disease providing new clues to self-tolerance. Immunol. Today 19: 384 –386. LT. Short-term LT R-Ig blockade may not lead to such com- 5. Chin, R. K., J. C. Lo, O. Kim, S. E. Blink, P. A. Christiansen, P. Peterson, pensatory effects. Fourth, because of the promiscuous nature of Y. Wang, C. Ware, and Y. X. Fu. 2003. Lymphotoxin pathway directs thymic TNF ligand/receptor pairings, LT R-Ig also blocks the co- Aire expression. Nat. Immunol. 4: 1121–1127. 6. Browning, J. L., I. D. Sizing, P. Lawton, P. R. Bourdon, P. D. Rennert, stimulatory function of LIGHT to HVEM, leading to decreased G. R. Majeau, C. M. Ambrose, C. Hession, K. Miatkowski, D. A. Griffiths, et al. cell activation in treated mice. Lta / does not affect LIGHT or 1997. Characterization of lymphotoxin- complexes on the surface of mouse HVEM signaling. lymphocytes. J. Immunol. 159: 3288 –3298. 7. Boehm, T., S. Scheu, K. Pfeffer, and C. C. Bleul. 2003. Thymic medullary epi- The role of AIRE in establishing self-Ags specific central tol- thelial cell differentiation, thymocyte emigration, and the control of autoimmu- erance is not limited to transcriptional control of thymic expression nity require lympho-epithelial cross talk via LT R. J. Exp. Med. 198: 757–769. of peripheral Ags. A recent report by Kuroda et al. (27) showed 8. Burkly, L., C. Hession, L. Ogata, C. Reilly, L. A. Marconi, D. Olson, R. Tizard, R. Cate, and D. Lo. 1995. Expression of relB is required for the development of that, although thymic fodrin expression is normal in Aire / mice, thymic medulla and dendritic cells. Nature 373: 531–536. they nevertheless go on to develop autoimmunity against fodrin. 9. Kajiura, F., S. Sun, T. Nomura, K. Izumi, T. Ueno, Y. Bando, N. Kuroda, H. Han, These data suggest that another mechanism of AIRE, in addition to Y. Li, A. Matsushima, et al. 2004. NF- B-inducing kinase establishes self-tol- erance in a thymic stroma-dependent manner. J. Immunol. 172: 2067–2075. thymic transcriptional control, is responsible for tolerance to fo- 10. Myers, L. K., E. F. Rosloniec, M. A. Cremer, and A. H. Kang. 1997. Collagen- drin. In contrast with the anti-fodrin immunity in Aire / mice, we induced arthritis, an animal model of autoimmunity. Life Sci. 61: 1861–1878. found neither perturbation of thymic expression of CII nor auto- 11. Luross, J. A., and N. A. Williams. 2001. The genetic and immunopathological processes underlying collagen-induced arthritis. Immunology 103: 407– 416. immunity to CII. This additional mechanism is thus unlikely to be 12. Ranges, G. E., S. Sriram, and S. M. Cooper. 1985. Prevention of type II collagen- involved in CII tolerance. induced arthritis by in vivo treatment with anti-L3T4. J. Exp. Med. 162: Although clonal deletion has occupied the center of attention 1105–1110. 13. Chiocchia, G., M. C. Boissier, and C. Fournier. 1991. Therapy against murine as the mechanism of central tolerance mediated by ectopically collagen-induced arthritis with T cell receptor V -specific antibodies. Eur. J. Im- expressed peripheral Ags, this may not be the full story (28). It munol. 21: 2899 –2905. has been demonstrated that resistant MHC-II, such as E d, E s, 14. Yoshino, S., L. G. Cleland, and G. Mayrhofer. 1991. Treatment of collagen- induced arthritis in rats with a monoclonal antibody against the T cell antigen and I-Ab, not only resist CIA in their native hosts, but also will receptor. Arthritis Rheum. 34: 1039 –1047. actively protect genetically susceptible hosts when transgeni- 15. Wooley, P. H., H. S. Luthra, W. P. Lafuse, A. Huse, J. M. Stuart, and C. S. David. 1985. Type II collagen-induced arthritis in mice. III. Suppression of arthritis by cally expressed (29 –31). This protection is difficult to be ex- using monoclonal and polyclonal anti-Ia antisera. J. Immunol. 134: 2366 –2374. plained by clonal deletion alone, because the endogenous au- 16. Derbinski, J., J. Gabler, B. Brors, S. Tierling, S. Jonnakuty, M. Hergenhahn, toreactive repertoire would be not be deleted by the resistant L. Peltonen, J. Walter, and B. Kyewski. 2005. Promiscuous gene expression in thymic epithelial cells is regulated at multiple levels. J. Exp. Med. 202: 33– 45. MHC-II. Regulatory cells could provide a more elegant expla- 17. Johnnidis, J. B., E. S. Venanzi, D. J. Taxman, J. P. Ting, C. O. Benoist, and nation. Ectopic expression of CII by mTECs, presented on re- D. J. Mathis. 2005. Chromosomal clustering of genes controlled by the aire tran- sistant MHC-II, may instead facilitate efficient production of scription factor. Proc. Natl. Acad. Sci. USA 102: 7233–7238. 18. Gotter, J., B. Brors, M. Hergenhahn, and B. Kyewski. 2004. Medullary epithelial CII-specific regulatory T cells. Coexpression of susceptible and cells of the human thymus express a highly diverse selection of tissue-specific resistant MHCs on all APCs permits these regulatory T cells to genes colocalized in chromosomal clusters. J. Exp. Med. 199: 155–166. restrain even endogenous autoreactive clones raised on suscep- 19. Han, S., S. Cao, R. Bheekha-Escura, and B. Zheng. 2001. Germinal center re- action in the joints of mice with collagen-induced arthritis: an animal model of tible MHCs, a finding revealed only in systems using endoge- lymphocyte activation and differentiation in arthritis joints. Arthritis Rheum. 44: nous self-Ag and a polyclonal T cell repertoire. It remains to be 1438 –1443.
  • 9. The Journal of Immunology 297 20. Klug, D. B., C. Carter, I. B. Gimenez-Conti, and E. R. Richie. 2002. Cutting 26. Lamhamedi-Cherradi, S. E., S. J. Zheng, K. A. Maguschak, J. Peschon, and edge: thymocyte-independent and thymocyte-dependent phases of epithelial pat- Y. H. Chen. 2003. Defective thymocyte apoptosis and accelerated autoimmune terning in the fetal thymus. J. Immunol. 169: 2842–2845. diseases in TRAIL / mice. Nat. Immunol. 4: 255–260. 21. Holmdahl, R., L. Jansson, A. Larsson, and R. Jonsson. 1990. Arthritis in DBA/1 27. Kuroda, N., T. Mitani, N. Takeda, N. Ishimaru, R. Arakaki, Y. Hayashi, mice induced with passively transferred type II collagen immune serum. Immu- Y. Bando, K. Izumi, T. Takahashi, T. Nomura, et al. 2005. Development of nohistopathology and serum levels of anti-type II collagen auto-antibodies. autoimmunity against transcriptionally unrepressed target antigen in the thymus Scand. J. Immunol. 31: 147–157. of Aire-deficient mice. J. Immunol. 174: 1862–1870. 22. Stuart, J. M., and F. J. Dixon. 1983. Serum transfer of collagen-induced arthritis 28. Liston, A., S. Lesage, J. Wilson, L. Peltonen, and C. C. Goodnow. 2003. Aire in mice. J. Exp. Med. 158: 378 –392. regulates negative selection of organ-specific T cells. Nat. Immunol. 4: 350 –354. 23. Fava, R. A., E. Notidis, J. Hunt, V. Szanya, N. Ratcliffe, A. Ngam-Ek, 29. Gonzalez-Gay, M. A., E. Zanelli, S. D. Khare, C. J. Krco, P. Zhou, H. Inoko, A. R. De Fougerolles, A. Sprague, and J. L. Browning. 2003. A role for the M. M. Griffiths, H. S. Luthra, and C. S. David. 1996. Human leukocyte antigen- lymphotoxin/LIGHT axis in the pathogenesis of murine collagen-induced arthri- DRB1*1502 (DR2Dw12) transgene reduces incidence and severity of arthritis in tis. J. Immunol. 171: 115–126. mice. Hum. Immunol. 50: 54 – 60. 24. Londei, M., C. M. Savill, A. Verhoef, F. Brennan, Z. A. Leech, V. Duance, 30. Gonzalez-Gay, M. A., G. H. Nabozny, M. J. Bull, E. Zanelli, J. Douhan, III, R. N. Maini, and M. Feldmann. 1989. Persistence of collagen type II-specific M. M. Griffiths, L. H. Glimcher, H. S. Luthra, and C. S. David. 1994. Protective T-cell clones in the synovial membrane of a patient with rheumatoid arthritis. role of major histocompatibility complex class II Ebd transgene on collagen- Proc. Natl. Acad. Sci. USA 86: 636 – 640. induced arthritis. J. Exp. Med. 180: 1559 –1564. 25. Terato, K., Y. Shimozuru, K. Katayama, Y. Takemitsu, I. Yamashita, 31. Mitchison, N. A., and M. C. Brunner. 1995. Association of H2Ab with resistance M. Miyatsu, K. Fujii, M. Sagara, S. Kobayashi, M. Goto, et al. 1990. Specificity to collagen-induced arthritis in H2-recombinant mouse strains: an allele associ- of antibodies to type II collagen in rheumatoid arthritis. Arthritis Rheum 33: ated with reduction of several apparently unrelated responses. Immunogenetics 1493–1500. 41: 239 –245. Downloaded from www.jimmunol.org on October 19, 2010