• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Additional Tables.doc
 

Additional Tables.doc

on

  • 633 views

 

Statistics

Views

Total Views
633
Views on SlideShare
633
Embed Views
0

Actions

Likes
0
Downloads
4
Comments
0

0 Embeds 0

No embeds

Accessibility

Upload Details

Uploaded via as Microsoft Word

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Additional Tables.doc Additional Tables.doc Document Transcript

    • Additional Tables Additional Table S1 Table S1. Sequences of the primers used for transcript-specific quantitative real-time PCR assays. Primers Sequence 5’ – 3’ Gene GAAGATGTCGGAGCCCATAG Left LIPE (HSL) GGTCAGGTTCTTGAGGGAATC Right LIPE (HSL) TGCTTGACTTCTGTGGCTTTT Left BMPR2 GCATGACAGCTACGCATCTC Right BMPR2 CAGCTCGGATTCAACTACCTTAG Left SERPINE1 TTACATCCATCTTTGTGCCCTA Right SERPINE1 GCACAGAAACAGAGGAGAGTCC Left CTSD GAGTGTGTGGGTGTGTGTGG Right CTSD CCTGTCCCTGCACACCTC Left CTF1 GTGTTGCTTGTTTTGTCTCCAC Right CTF1 CTGACCCAACCACAAATGC Left IL6 GTCATGTCCTGCAGCCACT Right IL6 GCTGGAACGCAACATAGAGA Left S100A9 (CALGRANULIN) CTTTGAATTCCCCCTGGTTC Right S100A9 (CALGRANULIN) TGACAAGATGCGAGACGAGT Left SERPINH1 (HSP47) TGTCTCAGGAGCCTTTGGAT Right SERPINH1 (HSP47) CCCTTCAGCATCCTCAGTTC Left HMOX1 (HO-1) AGACAGCTGCCACATTAGGG Right HMOX1 (HO-1) TGTGTGTGTGTGAGTGGTTGA Left VEGF TCTCTGTGCCTCGGGAAG Right VEGF CGGAAGTGACTTTGAAAACTACATAA Left ALOX5AP GGAATGAGAAGTAGAGGGGAGAT Right ALOX5AP CCCAGTAGCTGCCCTATTCA Left CD36 ATTTGGTGCACATGAAATGC Right CD36 CTGACTGAAAAAGAAGGTGAAATCT Left CSRP2 TTACTGGGCATGAACAAGAGC Right CSRP2 TGTATGTGTCTTTATCAGTGATGGTC Left LPL TGTTTTGTTAAAGCCCATTTCA Right LPL ACATCATCCCTGCCTCTACTG Left GAPDH ACCACCTGGTGCTCAGTGTA Right GAPDH AACAGTCACCGACGAGAGTGCT Left GUSB GGTTTCATTGGCAATCTTCCAG Right GUSB GAACCACGGCACTGATTTTC Left TBP CCCCACCATGTTCTGAATCT Right TBP GACCAGTCAACAGGGGACAT Left HPRT1 AACACTTCGTGGGGTCCTTTTC Right HPRT1 1
    • Additional Table S2 Table S2. List of common differentially expressed genes in coronary and carotid atherosclerotic samples (human “atherogenes”). LL_ID: LocusLink ID. For each gene is reported the Gene Ontology description for the Cellular Component (CC), Biological Process (BP) and Molecular Function (MF). UP_SEQ_FEATURES: Functional Categories based on UniProt database. Informations are retrieved from DAVID database (http://david.abcc.ncifcrf.gov/home.jsp). Up-regulated LL_ID Gene Name GOTERM_CC_ALL GOTERM_BP_ALL GOTERM_MF_ALL UP_SEQ_FEATURE 6282 S100 cell, cytoplasm, intracellular, DNA metabolism, DNA replication, DNA- binding, calcium ion binding, cation calcium-binding CALCIUM intracellular membrane-bound dependent DNA replication, biopolymer binding, ion binding, metal ion region:1; low affinity, BINDING organelle, intracellular metabolism, cell communication, cell binding, calcium-binding PROTEIN organelle, membrane-bound proliferation, cellular metabolism, cellular region:2; high affinity, A11 organelle, nucleus, organelle, physiological process, cellular process, domain:EF-hand 1, (CALGIZZ macromolecule metabolism, metabolism, domain:EF-hand 2, ARIN) negative regulation of DNA metabolism, negative regulation of DNA replication, negative regulation of biological process, negative regulation of cell proliferation, negative regulation of cellular metabolism, negative regulation of cellular physiological process, negative regulation of cellular process, negative regulation of metabolism, negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, negative regulation of physiological process, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, physiological 2
    • process, primary metabolism, regulation of DNA metabolism, regulation of DNA replication, regulation of biological process, regulation of cell proliferation, regulation of cellular metabolism, regulation of cellular physiological process BUTYROP HILIN, cell, integral to membrane, lipid metabolism, metabolism, SUBFAMIL 11119 intrinsic to membrane, physiological process, primary Null Null Y 3, membrane, metabolism, MEMBER A1 cell communication, cellular metabolism, cellular physiological process, cellular process, circadian rhythm, entrainment of circadian clock, metabolism, negative regulation of biological process, negative regulation of cellular metabolism, negative regulation of cellular physiological process, negative regulation of cellular process, negative regulation of PERIOD cell, intracellular, intracellular metabolism, negative regulation of HOMOLOG membrane-bound organelle, nucleobase, nucleoside, nucleotide and binding, nucleic acid binding, protein domain:PAS 1, 5187 1 intracellular organelle, nucleic acid metabolism, negative binding, signal transducer activity, domain:PAS 2, (DROSOPH membrane-bound organelle, regulation of physiological process, ILA) nucleus, organelle, negative regulation of transcription, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, physiological process, primary metabolism, regulation of biological process, regulation of cellular metabolism, regulation of cellular physiological process, regulation of cellular process, regulation of metabolism, regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, 3
    • regulation of physiological process, regulation of transcription, regulation of transcription, DNA-dependent, rhythmic proce antigen presentation, antigen presentation, endogenous antigen, antigen processing, antigen processing, endogenous antigen via MHC class I, cellular defense response, cellular physiological process, cellular MHC class I protein complex, disulfide bond, HLA-G process, defense response, detection of MHC protein complex, cell, domain:Ig-like C1- HISTOCOM biotic stimulus, detection of external MHC class I receptor activity, cellular component unknown, type, glycosylation PATIBILIT stimulus, detection of pest, pathogen or receptor activity, signal transducer 3135 immunological synapse, integral site:N-linked Y parasite, detection of stimulus, immune activity, transmembrane receptor to membrane, intrinsic to (GlcNAc...), signal ANTIGEN, response, organismal physiological activity, membrane, membrane, plasma peptide, CLASS I, G process, physiological process, response to membrane, protein complex, transmembrane region, biotic stimulus, response to external stimulus, response to other organism, response to pest, pathogen or parasite, response to stimulus, response to stress, response to wounding, cell organization and biogenesis, cellular localization, cellular physiological process, cellular process, establishment of cellular SYNTAXIN cell, integral to membrane, localization, establishment of localization, binding, protein binding, protein domain:t-SNARE 4A 6810 intrinsic to membrane, establishment of protein localization, transporter activity, transporter coiled-coil homology, (PLACENT membrane, intracellular protein transport, intracellular activity, transmembrane region, AL) transport, localization, neurotransmitter transport, physiological process, protein localization, protein transport, transport, SIGNAL I-kappaB kinase/NF-kappaB cascade, DNA binding, binding, calcium ion cell, cytoplasm, intracellular, TRANSDU JAK-STAT cascade, STAT protein nuclear binding, cation binding, ion binding, intracellular membrane-bound domain:SH2, CER AND translocation, apoptosis, apoptotic metal ion binding, nucleic acid 6772 organelle, intracellular mutagenesis site, splice ACTIVATO program, biopolymer metabolism, binding, protein binding, signal organelle, membrane-bound variant, R OF biopolymer modification, caspase transducer activity, transcription organelle, nucleus, organelle, TRANSCRI activation, cell communication, cell cycle, factor activity, transcription regulator 4
    • cell death, cell organization and biogenesis, cellular localization, cellular macromolecule metabolism, cellular metabolism, cellular physiological process, cellular process, cellular protein metabolism, death, establishment of cellular localization, establishment of localization, establishment of protein localization, intracellular protein transport, intracellular signaling cascade, PTION 1, intracellular transport, localization, activity, 91KDA macromolecule metabolism, metabolism, nuclear import, nuclear transport, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, nucleocytoplasmic transport, peptidyl- amino acid modification, peptidyl-tyrosine modification, peptidyl-tyrosine phosphorylation, phosphate metabolism, phosphorus metabolism, phosphorylation, physiological process, positive regulation of boil I-kappaB kinase/NF-kappaB cascade, anion transporter activity, anion transport, cell communication, anion:cation symporter activity, cellular metabolism, cellular physiological SOLUTE carrier activity, cation transporter process, cellular process, establishment of CARRIER activity, electrochemical potential- cell, integral to membrane, localization, inorganic anion transport, FAMILY 20 driven transporter activity, inorganic integral to plasma membrane, intracellular signaling cascade, ion modified residue, (PHOSPHA anion transporter activity, ion 6574 intrinsic to membrane, intrinsic transport, localization, metabolism, mutagenesis site, TE transporter activity, phosphate to plasma membrane, phosphate metabolism, phosphate transmembrane region, TRANSPOR transporter activity, porter activity, membrane, plasma membrane, transport, phosphorus metabolism, TER), receptor activity, signal transducer physiological process, positive regulation MEMBER 1 activity, sodium:phosphate symporter of I-kappaB kinase/NF-kappaB cascade, activity, symporter activity, positive regulation of biological process, transporter activity, positive regulation of cellular process, 5
    • positive regulation of signal transduction, protein kinase cascade, regulation of I- kappaB kinase/NF-kappaB cascade, regulation of biological process, regulation of cellular process, regulation of signal transduction, signal transduction, transport, antimicrobial humoral response, antimicrobial humoral response (sensu Vertebrata), behavior, cell communication, cell-cell signaling, cellular process, CHEMOKI chemotaxis, defense response, humoral NE (C-C defense mechanism (sensu Vertebrata), MOTIF) humoral immune response, immune G-protein-coupled receptor binding, LIGAND 18 response, inflammatory response, binding, chemokine activity, (PULMONA extracellular region, locomotory behavior, neurophysiological disulfide bond, signal 6362 chemokine receptor binding, cytokine RY AND extracellular space, process, organismal physiological process, peptide, activity, protein binding, receptor ACTIVATI physiological process, response to abiotic binding, signal transducer activity, ON- stimulus, response to biotic stimulus, REGULATE response to chemical stimulus, response to D) external stimulus, response to other organism, response to pest, pathogen or parasite, response to stimulus, response to stress, response to wounding, sensory perception, signal transduction, taxis, SERPIN cellular macromolecule metabolism, PEPTIDASE cellular metabolism, cellular physiological ER-Golgi intermediate INHIBITOR process, cellular process, cellular protein binding, collagen binding, compartment, cell, cytoplasm, , CLADE H metabolism, macromolecule metabolism, endopeptidase inhibitor activity, glycosylation site:N- endoplasmic reticulum, (HEAT metabolism, physiological process, enzyme inhibitor activity, enzyme linked (GlcNAc...), intracellular, intracellular 871 SHOCK primary metabolism, protein folding, regulator activity, protease inhibitor signal peptide, membrane-bound organelle, PROTEIN protein metabolism, response to abiotic activity, protein binding, serine-type site:Reactive bond intracellular organelle, 47), stimulus, response to chemical stimulus, endopeptidase inhibitor activity, homolog, membrane-bound organelle, MEMBER response to protein stimulus, response to unfolded protein binding, organelle, 1, stimulus, response to stress, response to (COLLAGE unfolded protein, 6
    • N BINDING PROTEIN 1) glycosylation site:N- cell, extracellular matrix, linked (GlcNAc...), extracellular matrix (sensu glycosylation site:O- Metazoa), extracellular region, linked (Xyl...) extracellular space, integral to (glycosaminoglycan), GLYPICAN chondroitin sulfate proteoglycan, 2817 membrane, integral to plasma Null lipid moiety-binding 1 obsolete molecular function, membrane, intrinsic to region:GPI-anchor membrane, intrinsic to plasma amidated serine, membrane, membrane, plasma propeptide:Removed in membrane, mature form, signal peptide, ECTONUC binding, calcium ion binding, Golgi apparatus, Golgi stack, LEOSIDE catalytic activity, cation binding, cell, cytoplasm, integral to TRIPHOSP hydrolase activity, hydrolase activity, membrane, intracellular, HATE acting on acid anhydrides, hydrolase intracellular membrane-bound DIPHOSPH activity, acting on acid anhydrides, in 955 organelle, intracellular Null Null OHYDROL phosphorus-containing anhydrides, organelle, intrinsic to ASE 6 ion binding, magnesium ion binding, membrane, membrane, (PUTATIVE metal ion binding, nucleoside- membrane-bound organelle, FUNCTION diphosphatase activity, organelle, ) pyrophosphatase activity, TUMOR angiogenesis, blood vessel development, NECROSIS blood vessel morphogenesis, cell FACTOR, extracellular region, differentiation, cellular process, 7127 Null Null ALPHA- extracellular space, development, morphogenesis, organ INDUCED development, organ morphogenesis, PROTEIN 2 vasculature development, 5987 RET cell, cell fraction, integral to biopolymer metabolism, biopolymer DNA binding, binding, catalytic domain:B30.2-like, FINGER membrane, integral to plasma modification, cell proliferation, cellular activity, cation binding, ion binding, site:Breakpoint for PROTEIN membrane, intracellular, macromolecule metabolism, cellular kinase activity, ligase activity, ligase translocation to form intracellular membrane-bound metabolism, cellular physiological process, activity, forming carbon-nitrogen the RFP/RET organelle, intracellular cellular process, cellular protein bonds, metal ion binding, nucleic oncogene, splice 7
    • metabolism, gametogenesis, macromolecule metabolism, male gamete generation, metabolism, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, physiological process, acid binding, phosphotransferase primary metabolism, protein metabolism, activity, alcohol group as acceptor, organelle, intrinsic to protein modification, protein protein binding, protein kinase membrane, intrinsic to plasma ubiquitination, regulation of biological activity, protein-tyrosine kinase membrane, membrane, process, regulation of cellular metabolism, activity, receptor activity, signal variant, zinc finger membrane fraction, membrane- regulation of cellular physiological transducer activity, transferase region:B box-type, zinc bound organelle, nucleus, process, regulation of cellular process, activity, transferase activity, finger region:RING- organelle, plasma membrane, regulation of metabolism, regulation of transferring phosphorus-containing type, protein complex, ubiquitin nucleobase, nucleoside, nucleotide and groups, transition metal ion binding, ligase complex, nucleic acid metabolism, regulation of transmembrane receptor activity, physiological process, regulation of ubiquitin-protein ligase activity, zinc transcription, regulation of transcription, ion binding, DNA-dependent, reproduction, sexual reproduction, spermatogenesis, transcription, transcription, DNA- dependent, ubiquitin cycle, cell differentiation, cell proliferation, cellular physiological process, cellular process, defense response, development, hemopoiesis, hemopoietic or lymphoid organ development, immune response, COLONY disulfide bond, macrophage differentiation, monocyte binding, cytokine activity, growth STIMULAT cell, extracellular region, glycosylation site:N- differentiation, myeloid cell factor activity, macrophage colony ING extracellular space, integral to linked (GlcNAc...), 1435 differentiation, organ development, stimulating factor receptor binding, FACTOR 1 membrane, intrinsic to mutagenesis site, signal organismal physiological process, protein binding, receptor binding, (MACROPH membrane, membrane, peptide, splice variant, physiological process, positive regulation signal transducer activity, AGE) transmembrane region, of biological process, positive regulation of cell proliferation, positive regulation of cellular physiological process, positive regulation of cellular process, positive regulation of physiological process, 8
    • regulation of biological process, regulation of cell proliferation, regulation of cellular physiological process, regulation of cellular process, regulation of physiological process, response to biotic stimulus, response to stimulus, I-kappaB kinase/NF-kappaB cascade, catabolism, cell communication, cellular catabolism, cellular metabolism, cellular physiological process, cellular process, cofactor catabolism, cofactor metabolism, heme metabolism, heterocycle cell, cell fraction, cytoplasm, metabolism, intracellular signaling binding, catalytic activity, cation endoplasmic reticulum, cascade, metabolism, physiological HEME binding, heme oxygenase intracellular, intracellular process, pigment metabolism, porphyrin OXYGENA (decyclizing) activity, ion binding, helix, metal ion- membrane-bound organelle, catabolism, porphyrin metabolism, 3162 SE iron ion binding, metal ion binding, binding site:Iron (heme intracellular organelle, positive regulation of I-kappaB kinase/NF- (DECYCLI oxidoreductase activity, signal axial ligand), membrane fraction, membrane- kappaB cascade, positive regulation of NG) 1 transducer activity, transition metal bound organelle, microsome, biological process, positive regulation of ion binding, organelle, vesicular fraction, cellular process, positive regulation of signal transduction, protein kinase cascade, regulation of I-kappaB kinase/NF-kappaB cascade, regulation of biological process, regulation of cellular process, regulation of signal transduction, secondary metabolism, signal transduction, 10287 REGULAT Golgi apparatus, cell, cell G-protein coupled receptor protein GTPase activator activity, GTPase domain:RGS, OR OF G- fraction, cytoplasm, extrinsic to signaling pathway, autophagy, cell regulator activity, binding, enzyme mutagenesis site, PROTEIN membrane, extrinsic to plasma communication, cell surface receptor activator activity, enzyme regulator SIGNALLI membrane, heterotrimeric G- linked signal transduction, cellular activity, protein binding, signal NG 19 protein complex, intracellular, physiological process, cellular process, transducer activity, intracellular membrane-bound intracellular signaling cascade, negative organelle, intracellular regulation of biological process, negative organelle, membrane, regulation of cellular process, negative membrane fraction, membrane- regulation of signal transduction, 9
    • physiological process, regulation of bound organelle, organelle, biological process, regulation of cellular plasma membrane, protein process, regulation of signal transduction, complex, signal transduction, small GTPase mediated signal transduction, modified residue, cell, cytoplasm, intracellular, repeat:Vault 1, intracellular membrane-bound repeat:Vault 2, MAJOR organelle, intracellular response to abiotic stimulus, response to repeat:Vault 3, 9961 VAULT organelle, membrane-bound chemical stimulus, response to drug, Null repeat:Vault 4, PROTEIN organelle, nucleus, organelle, response to stimulus, repeat:Vault 5, protein complex, repeat:Vault 6, ribonucleoprotein complex, repeat:Vault 7, biopolymer catabolism, biopolymer metabolism, catabolism, cellular CATHEPSI cell, cytoplasm, extracellular macromolecule metabolism, cellular ND region, intracellular, aspartic-type endopeptidase activity, disulfide bond, metabolism, cellular physiological process, (LYSOSOM intracellular membrane-bound catalytic activity, cathepsin D glycosylation site:N- cellular process, cellular protein 1509 AL organelle, intracellular activity, endopeptidase activity, linked (GlcNAc...), metabolism, macromolecule catabolism, ASPARTYL organelle, lysosome, lytic hydrolase activity, pepsin A activity, propeptide:Activation macromolecule metabolism, metabolism, PEPTIDASE vacuole, membrane-bound peptidase activity, peptide, signal peptide, physiological process, primary ) organelle, organelle, vacuole, metabolism, protein catabolism, protein metabolism, proteolysis, 10457 GLYCOPR cell, integral to membrane, cell proliferation, cellular physiological Null domain:PKD, OTEIN intrinsic to membrane, process, cellular process, negative glycosylation site:N- (TRANSME membrane, regulation of biological process, negative linked (GlcNAc...), MBRANE) regulation of cell proliferation, negative signal peptide, splice NMB regulation of cellular physiological variant, transmembrane process, negative regulation of cellular region, process, negative regulation of physiological process, physiological process, regulation of biological process, regulation of cell proliferation, regulation of cellular physiological process, regulation of cellular process, regulation of 10
    • physiological process, PLECKSTR IN apoptosis, cell death, cellular physiological HOMOLOG process, cellular process, death, 7262 Y-LIKE Null Null domain:PH, physiological process, programmed cell DOMAIN, death, FAMILY A, MEMBER 2 alcohol metabolism, carbohydrate metabolism, cellular carbohydrate catalytic activity, fucosyltransferase PROTEIN metabolism, cellular metabolism, cellular activity, peptide-O-fucosyltransferase glycosylation site:N- O- physiological process, cellular process, activity, transferase activity, linked (GlcNAc...), 23275 FUCOSYLT Null fucose metabolism, hexose metabolism, transferase activity, transferring signal peptide, splice RANSFERA macromolecule metabolism, metabolism, glycosyl groups, transferase activity, variant, SE 2 monosaccharide metabolism, physiological transferring hexosyl groups, process, primary metabolism, beta-galactosidase complex, cell, cytoplasm, intracellular, active site:Nucleophile, intracellular membrane-bound beta-galactosidase activity, catalytic active site:Proton GALACTO organelle, intracellular carbohydrate metabolism, macromolecule activity, galactosidase activity, donor, glycosylation 2720 SIDASE, organelle, lysosome, lytic metabolism, metabolism, physiological hydrolase activity, hydrolase activity, site:N-linked BETA 1 vacuole, membrane-bound process, primary metabolism, acting on glycosyl bonds, (GlcNAc...), signal organelle, organelle, protein peptide, complex, unlocalized protein complex, vacuole, 55611 OTU Null biopolymer metabolism, biopolymer catalytic activity, cysteine-type domain:OTU, DOMAIN, modification, cellular macromolecule peptidase activity, hydrolase activity, mutagenesis site, splice UBIQUITIN metabolism, cellular metabolism, cellular peptidase activity, variant, ALDEHYD physiological process, cellular process, E BINDING cellular protein metabolism, defense 1 response, immune response, macromolecule metabolism, metabolism, organismal physiological process, physiological process, primary metabolism, protein metabolism, protein 11
    • modification, response to biotic stimulus, response to stimulus, ubiquitin cycle, DNA metabolism, DNA packaging, biopolymer metabolism, cell organization and biogenesis, cellular metabolism, cellular physiological process, cellular process, chromatin modification, chromatin remodeling, chromatin- DNA-binding mediated maintenance of transcription, region:A.T hook 1, chromosome organization and biogenesis, DNA-binding chromosome organization and biogenesis region:A.T hook 2, (sensu Eukaryota), development, DNA-binding establishment and/or maintenance of DNA binding, binding, cation MYELOID/ region:A.T hook 3, cell, intracellular, intracellular chromatin architecture, macromolecule binding, ion binding, metal ion LYMPHOID domain:Post-SET, membrane-bound organelle, metabolism, metabolism, nucleobase, binding, nucleic acid binding, protein OR MIXED- domain:SET, splice 9757 intracellular organelle, nucleoside, nucleotide and nucleic acid binding, transcription factor activity, LINEAGE variant, zinc finger membrane-bound organelle, metabolism, organelle organization and transcription regulator activity, LEUKEMIA region:CXXC-type, nucleus, organelle, biogenesis, physiological process, positive transition metal ion binding, zinc ion 4 zinc finger regulation of biological process, positive binding, region:PHD-type 1, regulation of cellular metabolism, positive zinc finger regulation of cellular physiological region:PHD-type 2, process, positive regulation of cellular zinc finger process, positive regulation of gene region:PHD-type 3, expression, epigenetic, positive regulation of metabolism, positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, positive regulation of physiological process, positive regulation of transcrip 26133 TRANSIEN cell, cytoplasm, cytosol, antigen presentation, antigen presentation, ATP binding, ATPase activity, Null T endoplasmic reticulum, endogenous antigen, antigen presentation, ATPase activity, coupled, ATPase RECEPTOR endoplasmic reticulum lumen, endogenous peptide antigen, antigen activity, coupled to movement of POTENTIA intracellular, intracellular presentation, peptide antigen, antigen substances, ATPase activity, coupled L CATION membrane-bound organelle, processing, antigen processing, to transmembrane movement of CHANNEL, intracellular organelle, endogenous antigen via MHC class I, cell substances, MHC class I protein 12
    • binding, MHC protein binding, TAP binding, TAP1 binding, TAP2 binding, adenyl nucleotide binding, antigen binding, binding, catalytic activity, hydrolase activity, hydrolase organization and biogenesis, cellular activity, acting on acid anhydrides, localization, cellular physiological process, hydrolase activity, acting on acid cellular process, cytosol to ER transport, anhydrides, catalyzing defense response, establishment of cellular transmembrane movement of localization, establishment of localization, substances, hydrolase activity, acting SUBFAMIL establishment of protein localization, on acid anhydrides, in phosphorus- Y C, immune response, intracellular protein membrane-bound organelle, containing anhydrides, identical MEMBER 4 transport, intracellular transport, membrane-enclosed lumen, protein binding, nucleoside- ASSOCIAT localization, macromolecule metabolism, organelle, organelle lumen, triphosphatase activity, nucleotide ED metabolism, organismal physiological binding, peptide antigen binding, PROTEIN process, peptide transport, physiological peptide antigen-transporting ATPase process, primary metabolism, protein activity, peptide binding, peptide complex assembly, protein localization, transporter activity, peptide- protein metabolism, protein transport, transporting ATPase activity, response to biotic stimulus, response to phosphate binding, protein binding, stimulus, transport, protein dimerization activity, protein heterodimerization activity, protein homodimerization activity, purine nucleotide binding, pyrophosphatase activity, receptor 311 ANNEXIN cell, cytoplasm, endomembrane defense response, immune response, binding, calcium ion binding, repeat:Annexin 1, A11 system, envelope, intracellular, organismal physiological process, calcium-dependent phospholipid repeat:Annexin 2, intracellular membrane-bound physiological process, response to biotic binding, cation binding, ion binding, repeat:Annexin 3, organelle, intracellular stimulus, response to stimulus, lipid binding, metal ion binding, repeat:Annexin 4, organelle, membrane, phospholipid binding, protein membrane-bound organelle, binding, membrane-enclosed lumen, nuclear envelope, nuclear lumen, nucleoplasm, nucleus, organelle, organelle envelope, 13
    • organelle lumen, disulfide bond, domain:UPAR/Ly6, glycosylation site:N- LYMPHOC cell, integral to membrane, cell communication, cell surface receptor linked (GlcNAc...), YTE integral to plasma membrane, linked signal transduction, cellular process, lipid moiety-binding 4061 ANTIGEN 6 intrinsic to membrane, intrinsic defense response, response to biotic Null region:GPI-anchor COMPLEX, to plasma membrane, stimulus, response to stimulus, signal amidated serine, LOCUS E membrane, plasma membrane, transduction, propeptide:Removed in mature form, signal peptide, ATP binding, adenyl nucleotide biopolymer metabolism, biopolymer binding, binding, cAMP-dependent modification, cellular macromolecule protein kinase activity, catalytic metabolism, cellular metabolism, cellular activity, cyclic nucleotide-dependent physiological process, cellular process, protein kinase activity, kinase active site:Proton cellular protein metabolism, activity, nucleotide binding, acceptor, binding SERINE/TH macromolecule metabolism, metabolism, phosphotransferase activity, alcohol site:ATP, 6793 REONINE Null phosphate metabolism, phosphorus group as acceptor, protein kinase domain:Protein kinase, KINASE 10 metabolism, phosphorylation, CK2 activity, protein kinase activity, nucleotide phosphate- physiological process, primary protein serine/threonine kinase binding region:ATP, metabolism, protein amino acid activity, purine nucleotide binding, phosphorylation, protein metabolism, transferase activity, transferase protein modification, activity, transferring phosphorus- containing groups, 713 COMPLEM cell, cytoplasm, extracellular anion transport, cellular physiological Null disulfide bond, ENT region, extracellular space, process, cellular process, complement domain:C1q, COMPONE intracellular, protein complex, activation, complement activation, domain:Collagen-like, NT 1, Q classical pathway, defense response, glycosylation site:O- SUBCOMP establishment of localization, humoral linked (Gal...), signal ONENT, B defense mechanism (sensu Vertebrata), peptide, CHAIN humoral immune response, immune response, innate immune response, inorganic anion transport, ion transport, localization, organismal physiological 14
    • process, phosphate transport, physiological process, response to biotic stimulus, response to other organism, response to pest, pathogen or parasite, response to stimulus, response to stress, transport, ATP binding, ATPase activity, ATPase activity, coupled, ATPase activity, coupled to movement of domain:ABC substances, ATPase activity, coupled transmembrane type-1 to transmembrane movement of 1, domain:ABC substances, adenyl nucleotide transmembrane type-1 ATP- binding, anion transporter activity, 2, domain:ABC cell, cell fraction, integral to BINDING binding, catalytic activity, hydrolase transporter 1, membrane, integral to plasma CASSETTE, cellular physiological process, cellular activity, hydrolase activity, acting on domain:ABC membrane, intrinsic to SUB- process, establishment of localization, acid anhydrides, hydrolase activity, transporter 2, 8714 membrane, intrinsic to plasma FAMILY C localization, physiological process, acting on acid anhydrides, catalyzing glycosylation site:N- membrane, membrane, (CFTR/MRP transport, transmembrane movement of linked (GlcNAc...), membrane fraction, plasma ), MEMBER substances, hydrolase activity, acting nucleotide phosphate- membrane, 3 on acid anhydrides, in phosphorus- binding region:ATP 1, containing anhydrides, ion transporter nucleotide phosphate- activity, nucleoside-triphosphatase binding region:ATP 2, activity, nucleotide binding, organic splice variant, anion transporter activity, purine transmembrane region, nucleotide binding, pyrophosphatase activity, transporter activity, catalytic activity, glutathione GLUTATHI transferase activity, transferase ONE S- 2944 cell, cytoplasm, intracellular, metabolism, physiological process, activity, transferase activity, helix, mutagenesis site, TRANSFER transferring alkyl or aryl (other than ASE M1 methyl) groups, 3587 INTERLEU cell, integral to membrane, Null binding, cytokine binding, growth disulfide bond, KIN 10 intrinsic to membrane, factor binding, interleukin binding, glycosylation site:N- RECEPTOR membrane, plasma membrane, interleukin receptor activity, linked (GlcNAc...), , ALPHA interleukin-10 binding, interleukin-10 signal peptide, receptor activity, protein binding, transmembrane region, 15
    • receptor activity, signal transducer activity, transmembrane receptor activity, actin cytoskeleton organization and biogenesis, actin filament-based process, GTPase binding, Rho GTPase biological process unknown, cell binding, actin binding, binding, domain:FH2, FORMIN- organization and biogenesis, cellular cytoskeletal protein binding, enzyme 752 cellular component unknown, domain:FH3, splice LIKE 1 physiological process, cellular process, binding, molecular function variant, cytoskeleton organization and biogenesis, unknown, protein binding, small organelle organization and biogenesis, GTPase binding, physiological process, 162 ADAPTOR- Golgi apparatus, Golgi cell organization and biogenesis, cellular binding, protein binding, transporter splice variant, RELATED membrane, Golgi stack, Golgi- localization, cellular physiological process, activity, PROTEIN associated vesicle, Golgi- cellular process, endocytosis, COMPLEX associated vesicle membrane, establishment of cellular localization, 1, BETA 1 cell, clathrin coat, clathrin coat establishment of localization, SUBUNIT of trans-Golgi network vesicle, establishment of protein localization, clathrin coated vesicle intracellular protein transport, intracellular membrane, clathrin vesicle coat, transport, localization, macromolecule clathrin-coated vesicle, coated metabolism, metabolism, physiological membrane, coated pit, coated process, primary metabolism, protein vesicle, coated vesicle complex assembly, protein localization, membrane, cytoplasm, protein metabolism, protein transport, cytoplasmic membrane-bound transport, vesicle-mediated transport, vesicle, cytoplasmic vesicle, cytoplasmic vesicle membrane, endomembrane system, intracellular, intracellular membrane-bound organelle, intracellular organelle, membrane, membrane coat, membrane-bound organelle, membrane-bound vesicle, organelle, organelle membrane, plasma membrane, trans-Golgi 16
    • network transport vesicle, trans- Golgi network transport vesicle membrane, transport vesicle, transport vesicle membrane, vesicle, vesicle coat, vesicle membrane, cellular macromolecule metabolism, cellular metabolism, cellular physiological process, cellular process, cellular protein metabolism, complement activation, active site:Charge relay complement activation, classical pathway, system, disulfide bond, catalytic activity, classical- defense response, humoral defense domain:Peptidase S1, complement-pathway C3/C5 COMPLEM mechanism (sensu Vertebrata), humoral domain:Sushi 1, extracellular region, convertase activity, endopeptidase ENT immune response, immune response, domain:Sushi 2, 717 extracellular space, protein activity, hydrolase activity, peptidase COMPONE innate immune response, macromolecule domain:Sushi 3, complex, activity, serine-type endopeptidase NT 2 metabolism, metabolism, organismal domain:VWFA, activity, serine-type peptidase physiological process, physiological glycosylation site:N- activity, process, primary metabolism, protein linked (GlcNAc...), metabolism, proteolysis, response to biotic signal peptide, stimulus, response to other organism, response to pest, pathogen or parasite, response to stimulus, response to stress, cell communication, cell-cell signaling, cellular process, defense response, immune S100 response, inflammatory response, calcium-binding CALCIUM organismal physiological process, region:1; low affinity, BINDING binding, calcium ion binding, cation extracellular region, physiological process, response to biotic calcium-binding 6280 PROTEIN binding, ion binding, metal ion extracellular space, stimulus, response to external stimulus, region:2; high affinity, A9 binding, signal transducer activity, response to other organism, response to domain:EF-hand 1, (CALGRAN pest, pathogen or parasite, response to domain:EF-hand 2, ULIN B) stimulus, response to stress, response to wounding, 5499 PROTEIN Null biopolymer metabolism, carbohydrate CTD phosphatase activity, binding, active site:Proton PHOSPHAT metabolism, cell cycle, cell division, calcium-dependent protein donor, metal ion- ASE 1, cellular carbohydrate metabolism, cellular serine/threonine phosphatase activity, binding site:Iron, metal 17
    • catalytic activity, cation binding, hydrolase activity, hydrolase activity, acting on ester bonds, ion binding, iron ion binding, magnesium- macromolecule metabolism, cellular dependent protein serine/threonine metabolism, cellular physiological process, phosphatase activity, manganese ion CATALYTI cellular polysaccharide metabolism, binding, metal ion binding, myosin C cellular process, generation of precursor phosphatase activity, phosphoprotein ion-binding SUBUNIT, metabolites and energy, glucan phosphatase activity, phosphoric ester site:Manganese, ALPHA metabolism, glycogen metabolism, hydrolase activity, phosphoric ISOFORM macromolecule metabolism, metabolism, monoester hydrolase activity, protein physiological process, polysaccharide phosphatase type 1 activity, protein metabolism, primary metabolism, phosphatase type 2A activity, protein phosphatase type 2B activity, protein phosphatase type 2C activity, protein serine/threonine phosphatase activity, transition metal ion binding, 1116 CHITINASE extracellular matrix, N-acetylglucosamine catabolism, N- binding, carbohydrate binding, disulfide bond, 3-LIKE 1 extracellular matrix (sensu acetylglucosamine metabolism, amine catalytic activity, chitinase activity, glycosylation site:N- (CARTILA Metazoa), extracellular region, metabolism, amino sugar catabolism, extracellular matrix structural linked (GlcNAc...), GE extracellular space, amino sugar metabolism, biopolymer constituent, hydrolase activity, signal peptide, GLYCOPR catabolism, biopolymer metabolism, hydrolase activity, acting on glycosyl OTEIN-39) carbohydrate catabolism, carbohydrate bonds, structural molecule activity, metabolism, catabolism, cellular sugar binding, carbohydrate catabolism, cellular carbohydrate metabolism, cellular catabolism, cellular macromolecule catabolism, cellular macromolecule metabolism, cellular metabolism, cellular physiological process, cellular polysaccharide catabolism, cellular polysaccharide metabolism, cellular process, chitin catabolism, chitin metabolism, glucosamine catabolism, glucosamine metabolism, macromolecule 18
    • catabolism, macromolecule metabolism, metabolism, nitrogen compound metabolism, physiological process, polysaccharide catabolism, polysaccharide metabolism, primary metabolism, antigen presentation, antigen presentation, endogenous antigen, antigen processing, antigen processing, endogenous antigen FC via MHC class I, defense response, FRAGMEN MHC class I protein complex, immune response, interaction between IgG binding, MHC class I receptor disulfide bond, T OF IGG, MHC protein complex, cell, organisms, organismal physiological activity, binding, immunoglobulin glycosylation site:N- RECEPTOR immunological synapse, integral 2217 process, physiological interaction between binding, protein binding, receptor linked (GlcNAc...), , to membrane, intrinsic to organisms, physiological process, activity, signal transducer activity, signal peptide, TRANSPOR membrane, membrane, plasma pregnancy, reproduction, reproductive transmembrane receptor activity, transmembrane region, TER, membrane, protein complex, organismal physiological process, ALPHA reproductive physiological process, response to biotic stimulus, response to stimulus, 6892 TAP Golgi apparatus, Golgi Golgi vesicle transport, antigen processing, ATPase activity, ATPase activity, disulfide bond, BINDING membrane, MHC class I peptide antigen processing, endogenous antigen coupled, ATPase activity, coupled to domain:Ig-like C1- PROTEIN loading complex, cell, cell via MHC class I, cell organization and movement of substances, ATPase type, glycosylation (TAPASIN) fraction, cytoplasm, biogenesis, cellular localization, cellular activity, coupled to transmembrane site:N-linked endomembrane system, metabolism, cellular physiological process, movement of substances, MHC class (GlcNAc...), signal endoplasmic reticulum, cellular process, defense response, I protein binding, MHC protein peptide, site:May be endoplasmic reticulum establishment of cellular localization, binding, TAP binding, TAP1 binding, involved in interaction membrane, integral to establishment of localization, immune TAP2 binding, antigen binding, with TAP, splice membrane, intracellular, response, intracellular transport, binding, catalytic activity, hydrolase variant, transmembrane intracellular membrane-bound localization, macromolecule metabolism, activity, hydrolase activity, acting on region, organelle, intracellular metabolism, organismal physiological acid anhydrides, hydrolase activity, organelle, intrinsic to process, peptide antigen stabilization, acting on acid anhydrides, catalyzing membrane, membrane, peptide metabolism, peptide stabilization, transmembrane movement of membrane fraction, membrane- physiological process, primary substances, hydrolase activity, acting bound organelle, microsome, metabolism, protein complex assembly, on acid anhydrides, in phosphorus- nuclear envelope-endoplasmic protein metabolism, response to biotic containing anhydrides, nucleoside- reticulum network, organelle, stimulus, response to stimulus, retrograde triphosphatase activity, peptide 19
    • antigen binding, peptide antigen- transporting ATPase activity, peptide binding, peptide transporter activity, vesicle-mediated transport, Golgi to ER, organelle membrane, protein peptide-transporting ATPase activity, secretion, secretory pathway, transport, complex, vesicular fraction, protein binding, pyrophosphatase vesicle-mediated transport, activity, receptor binding, signal transducer activity, transporter activity, unfolded protein binding, biopolymer metabolism, biopolymer modification, cellular macromolecule metabolism, cellular metabolism, cellular physiological process, cellular process, cellular protein metabolism, macromolecule metabolism, metabolism, nucleobase, nucleoside, nucleotide and DNA binding, binding, catalytic nucleic acid metabolism, physiological activity, cation binding, ion binding, cell, intracellular, intracellular process, primary metabolism, protein ligase activity, ligase activity, membrane-bound organelle, RING metabolism, protein modification, protein forming carbon-nitrogen bonds, metal intracellular organelle, FINGER ubiquitination, regulation of biological ion binding, nucleic acid binding, 22838 membrane-bound organelle, Null PROTEIN process, regulation of cellular metabolism, protein binding, transcription factor nucleus, organelle, protein 44 regulation of cellular physiological activity, transcription regulator complex, ubiquitin ligase process, regulation of cellular process, activity, transition metal ion binding, complex, regulation of metabolism, regulation of ubiquitin-protein ligase activity, zinc nucleobase, nucleoside, nucleotide and ion binding, nucleic acid metabolism, regulation of physiological process, regulation of transcription, regulation of transcription, DNA-dependent, transcription, transcription, DNA-dependent, ubiquitin cycle, RUN AND SH3 domain:RUN, 9853 DOMAIN Null Null Null domain:SH3, CONTAINI NG 2 20
    • biopolymer metabolism, biopolymer modification, cell cycle, cellular macromolecule metabolism, cellular metabolism, cellular physiological process, ATP binding, adenyl nucleotide cellular process, cellular protein binding, binding, catalytic activity, metabolism, macromolecule metabolism, active site:Proton kinase activity, nucleotide binding, metabolism, phosphate metabolism, acceptor, binding phosphotransferase activity, alcohol POLO-LIKE phosphorus metabolism, phosphorylation, site:ATP, group as acceptor, protein binding, KINASE 3 physiological process, primary domain:POLO box 1, 1263 Null protein kinase activity, protein serine/ (DROSOPH metabolism, protein amino acid domain:POLO box 2, threonine kinase activity, purine ILA) phosphorylation, protein metabolism, domain:Protein kinase, nucleotide binding, transferase protein modification, regulation of nucleotide phosphate- activity, transferase activity, biological process, regulation of cell cycle, binding region:ATP, transferring phosphorus-containing regulation of cellular physiological groups, process, regulation of cellular process, regulation of physiological process, regulation of progression through cell cycle, amine metabolism, aminoglycan metabolism, carbohydrate metabolism, N- cellular carbohydrate metabolism, cellular ACETYLGL cell, cytoplasm, intracellular, metabolism, cellular physiological process, alpha-N-acetylglucosaminidase UCOSAMI intracellular membrane-bound cellular process, development, activity, catalytic activity, glycosylation site:N- NIDASE, organelle, intracellular 4669 glycosaminoglycan metabolism, hexosaminidase activity, hydrolase linked (GlcNAc...), ALPHA- organelle, lysosome, lytic macromolecule metabolism, metabolism, activity, hydrolase activity, acting on signal peptide, (SANFILIPP vacuole, membrane-bound nervous system development, nitrogen glycosyl bonds, O DISEASE organelle, organelle, vacuole, compound metabolism, physiological IIIB) process, primary metabolism, system development, 4320 MATRIX extracellular matrix, biopolymer catabolism, biopolymer binding, calcium ion binding, disulfide bond, METALLO extracellular matrix (sensu metabolism, catabolism, cellular catalytic activity, cation binding, domain:Hemopexin- PEPTIDASE Metazoa), extracellular region, catabolism, cellular macromolecule endopeptidase activity, hydrolase like, metal ion-binding 11 catabolism, cellular macromolecule activity, ion binding, metal ion site:Calcium, metal (STROMEL metabolism, cellular metabolism, cellular binding, metalloendopeptidase ion-binding YSIN 3) physiological process, cellular process, activity, peptidase activity, transition site:Calcium (via 21
    • cellular protein catabolism, cellular protein carbonyl oxygen), metabolism, collagen catabolism, metal ion-binding development, macromolecule catabolism, site:Zinc 1, metal ion- macromolecule metabolism, metabolism, binding site:Zinc 2 morphogenesis, physiological process, metal ion binding, zinc ion binding, (catalytic), primary metabolism, protein catabolism, propeptide:Activation protein metabolism, proteolysis, peptide, signal peptide, proteolysis during cellular protein site:Cysteine switch, catabolism, amine metabolism, aminoglycan biosynthesis, aminoglycan metabolism, biopolymer glycosylation, biopolymer metabolism, biopolymer modification, MANNOSY biosynthesis, carbohydrate biosynthesis, L Golgi apparatus, Golgi carbohydrate metabolism, cellular UDP-glycosyltransferase activity, (ALPHA-1,3 membrane, Golgi stack, cell, biosynthesis, cellular carbohydrate acetylglucosaminyltransferase -)- cytoplasm, endomembrane metabolism, cellular macromolecule activity, alpha-1,3- GLYCOPR system, integral to membrane, metabolism, cellular metabolism, cellular mannosylglycoprotein 2-beta-N- OTEIN intracellular, intracellular physiological process, cellular process, acetylglucosaminyltransferase sequence conflict, 4245 BETA-1,2- membrane-bound organelle, cellular protein metabolism, glycoprotein activity, catalytic activity, transferase transmembrane region, N- intracellular organelle, intrinsic biosynthesis, glycoprotein metabolism, activity, transferase activity, ACETYLGL to membrane, membrane, macromolecule biosynthesis, transferring glycosyl groups, UCOSAMI membrane-bound organelle, macromolecule metabolism, metabolism, transferase activity, transferring NYLTRAN organelle, organelle membrane, nitrogen compound metabolism, hexosyl groups, SFERASE physiological process, primary metabolism, protein amino acid N-linked glycosylation, protein amino acid glycosylation, protein biosynthesis, protein metabolism, protein modification, 2896 GRANULIN extracellular region, cell communication, cell proliferation, binding, cytokine activity, growth disulfide bond, extracellular space, cell-cell signaling, cellular physiological factor activity, protein binding, glycosylation site:N- process, cellular process, physiological receptor binding, signal transducer linked (GlcNAc...), process, positive regulation of biological activity, peptide:Granulin-1, process, positive regulation of cell peptide:Granulin-2, proliferation, positive regulation of cellular peptide:Granulin-3, 22
    • physiological process, positive regulation peptide:Granulin-4, of cellular process, positive regulation of peptide:Granulin-5, physiological process, regulation of peptide:Granulin-6, biological process, regulation of cell peptide:Granulin-7, proliferation, regulation of cellular peptide:Paragranulin, physiological process, regulation of signal peptide, splice cellular process, regulation of variant, physiological process, signal transduction, active site:Proton acceptor, binding biopolymer metabolism, biopolymer site:ATP, modification, cell communication, cellular domain:Protein kinase, macromolecule metabolism, cellular ATP binding, adenyl nucleotide domain:SH2, metabolism, cellular physiological process, binding, binding, catalytic activity, domain:SH3, lipid cellular process, cellular protein kinase activity, nucleotide binding, moiety-binding metabolism, development, intracellular phosphotransferase activity, alcohol region:N-myristoyl HEMOPOIE signaling cascade, macromolecule group as acceptor, protein binding, glycine, lipid moiety- 3055 TIC CELL Null metabolism, mesoderm development, protein kinase activity, protein- binding region:N- KINASE metabolism, phosphate metabolism, tyrosine kinase activity, purine myristoyl glycine (in phosphorus metabolism, phosphorylation, nucleotide binding, transferase isoform P59-HCK), physiological process, primary activity, transferase activity, lipid moiety-binding metabolism, protein amino acid transferring phosphorus-containing region:S-palmitoyl phosphorylation, protein metabolism, groups, cysteine (in isoform protein modification, signal transduction, P59-HCK), nucleotide tissue development, phosphate-binding region:ATP, 7305 TYRO cell, integral to membrane, cell communication, cellular defense signal transducer activity, sequence variant, PROTEIN integral to plasma membrane, response, cellular process, defense signal peptide, splice TYROSINE intrinsic to membrane, intrinsic response, immune response, intracellular variant, transmembrane KINASE to plasma membrane, signaling cascade, organismal region, BINDING membrane, plasma membrane, physiological process, physiological PROTEIN process, response to biotic stimulus, response to external stimulus, response to other organism, response to pest, pathogen or parasite, response to stimulus, response 23
    • to stress, response to wounding, signal transduction, cell communication, cell surface receptor disulfide bond, linked signal transduction, cellular domain:Disintegrin, macromolecule metabolism, cellular binding, catalytic activity, cation domain:Peptidase cell, integral to membrane, ADAM metabolism, cellular physiological process, binding, endopeptidase activity, M12B, glycosylation integral to plasma membrane, METALLO cellular process, cellular protein hydrolase activity, ion binding, metal site:N-linked 101 intrinsic to membrane, intrinsic PEPTIDASE metabolism, integrin-mediated signaling ion binding, metalloendopeptidase (GlcNAc...), metal ion- to plasma membrane, DOMAIN 8 pathway, macromolecule metabolism, activity, peptidase activity, transition binding site:Zinc membrane, plasma membrane, metabolism, physiological process, metal ion binding, zinc ion binding, (catalytic), signal primary metabolism, protein metabolism, peptide, proteolysis, signal transduction, transmembrane region, cell cycle, cell cycle arrest, cellular physiological process, cellular process, negative regulation of biological process, negative regulation of cellular physiological process, negative regulation of cellular process, negative regulation of physiological process, negative regulation VASOHIBI 22846 Null of progression through cell cycle, Null splice variant, N1 physiological process, regulation of biological process, regulation of cell cycle, regulation of cellular physiological process, regulation of cellular process, regulation of physiological process, regulation of progression through cell cycle, CLEFT LIP AND cell, integral to membrane, PALATE integral to plasma membrane, ASSOCIAT 1209 intrinsic to membrane, intrinsic development, Null Null ED to plasma membrane, TRANSME membrane, plasma membrane, MBRANE PROTEIN 1 24
    • DNA binding, RNA binding, binding, cation binding, enzyme inhibitor PROTEIN cellular metabolism, cellular physiological activity, enzyme regulator activity, PHOSPHAT cell, intracellular, intracellular process, cellular process, defense response, ion binding, metal ion binding, ASE 1, membrane-bound organelle, metabolism, nucleobase, nucleoside, nucleic acid binding, phosphatase domain:TFS2-N, zinc 5514 REGULAT intracellular organelle, nucleotide and nucleic acid metabolism, inhibitor activity, phosphatase finger region:C3H1- ORY membrane-bound organelle, physiological process, primary regulator activity, protein type, SUBUNIT nucleus, organelle, metabolism, response to biotic stimulus, phosphatase inhibitor activity, protein 10 response to stimulus, transcription, phosphatase regulator activity, transition metal ion binding, zinc ion binding, ATAXIN 2- cell, cellular component modified residue, 11273 biological process unknown, molecular function unknown, LIKE unknown, membrane, splice variant, biopolymer metabolism, biopolymer modification, cell cycle, cellular macromolecule metabolism, cellular metabolism, cellular physiological process, ATP binding, adenyl nucleotide cellular process, cellular protein binding, binding, catalytic activity, metabolism, macromolecule metabolism, heat shock protein binding, kinase Golgi apparatus, Golgi stack, metabolism, phosphate metabolism, activity, nucleotide binding, cell, cytoplasm, intracellular, phosphorus metabolism, phosphorylation, phosphotransferase activity, alcohol CYCLIN G intracellular membrane-bound physiological process, primary group as acceptor, protein binding, 2580 ASSOCIAT Null organelle, intracellular metabolism, protein amino acid protein kinase activity, protein serine/ ED KINASE organelle, membrane-bound phosphorylation, protein folding, protein threonine kinase activity, purine organelle, nucleus, organelle, metabolism, protein modification, nucleotide binding, transferase regulation of biological process, regulation activity, transferase activity, of cell cycle, regulation of cellular transferring phosphorus-containing physiological process, regulation of groups, unfolded protein binding, cellular process, regulation of physiological process, regulation of progression through cell cycle, 6279 S100 extracellular region, defense response, immune response, binding, calcium ion binding, cation calcium-binding CALCIUM extracellular space, inflammatory response, organismal binding, cytokine activity, ion region:1; low affinity, BINDING physiological process, physiological binding, metal ion binding, protein calcium-binding PROTEIN process, response to biotic stimulus, binding, receptor binding, signal region:2; high affinity, 25
    • response to external stimulus, response to A8 other organism, response to pest, pathogen domain:EF-hand 1, (CALGRAN transducer activity, or parasite, response to stimulus, response domain:EF-hand 2, ULIN A) to stress, response to wounding, apoptosis, axon extension, axon guidance, axonogenesis, behavior, cell communication, cell death, cell development, cell differentiation, cell migration, cell motility, cell organization and biogenesis, cell-cell signaling, cellular localization, cellular macromolecule antioxidant activity, apolipoprotein E metabolism, cellular metabolism, cellular receptor binding, beta-amyloid morphogenesis, cellular morphogenesis binding, binding, carbohydrate during differentiation, cellular binding, cytoskeletal protein binding, physiological process, cellular process, glycosaminoglycan binding, heparin glycosylation site:O- cellular protein metabolism, cholesterol binding, high-density lipoprotein, linked (GalNAc...), cell, chylomicron, cytoplasm, homeostasis, circulation, cytoskeleton lipid binding, lipid transporter repeat:1, repeat:2, APOLIPOP 348 extracellular region, organization and biogenesis, death, activity, low-density lipoprotein repeat:3, repeat:4, ROTEIN E extracellular space, intracellular, development, establishment of cellular receptor binding, obsolete molecular repeat:5, repeat:6, localization, establishment of localization, function, pattern binding, repeat:7, repeat:8, homeostasis, induction of apoptosis, phospholipid binding, polysaccharide signal peptide, induction of programmed cell death, binding, protein binding, receptor intracellular transport, learning and/or binding, signal transducer activity, memory, lipid binding, lipid transport, tau protein binding, transporter lipoprotein metabolism, localization, activity, very-low-density lipoprotein, localization of cell, locomotion, macromolecule metabolism, metabolism, morphogenesis, nerve-nerve synaptic transmission, nervous system development, neurite morphogenesis, neurogenesis, neuron development, n 9473 CHROMOS Null Null Null sequence conflict, OME 1 splice variant, OPEN READING 26
    • FRAME 38 KERATIN cell, cellular component 14 unknown, cytoskeleton, (EPIDERM intermediate filament, OLYSIS intermediate filament biological process unknown, development, structural constituent of cytoskeleton, sequence conflict, 3861 BULLOSA cytoskeleton, intracellular, ectoderm development, epidermis structural constituent of epidermis, site:Stutter, SIMPLEX, intracellular non-membrane- development, tissue development, structural molecule activity, DOWLING- bound organelle, intracellular MEARA, organelle, non-membrane- KOEBNER) bound organelle, organelle, alcohol metabolism, cellular lipid metabolism, cellular metabolism, cellular physiological process, cellular process, cholesterol metabolism, lipid metabolism, metabolism, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, DNA-binding Golgi apparatus, Golgi stack, physiological process, primary region:Basic motif, STEROL cell, cytoplasm, endoplasmic metabolism, regulation of biological domain:Helix-loop- REGULAT reticulum, integral to process, regulation of cellular metabolism, helix motif, DNA binding, RNA polymerase II ORY membrane, intracellular, regulation of cellular physiological domain:Leucine- transcription factor activity, binding, ELEMENT intracellular membrane-bound process, regulation of cellular process, zipper, mutagenesis 6721 nucleic acid binding, protein binding, BINDING organelle, intracellular regulation of metabolism, regulation of site, site:Cleavage (by transcription factor activity, TRANSCRI organelle, intrinsic to nucleobase, nucleoside, nucleotide and S1P), site:Cleavage (by transcription regulator activity, PTION membrane, membrane, nucleic acid metabolism, regulation of S2P), site:Cleavage (by FACTOR 2 membrane-bound organelle, physiological process, regulation of caspase-3 and nucleus, organelle, transcription, regulation of transcription caspase-7), from RNA polymerase II promoter, transmembrane region, regulation of transcription, DNA- dependent, steroid metabolism, sterol metabolism, transcription, transcription from RNA polymerase II promoter, transcription, DNA-dependent, 10379 INTERFER cell, cytoplasm, intracellular, cell communication, cell surface receptor DNA binding, binding, cation DNA-binding ON- intracellular membrane-bound linked signal transduction, cellular binding, ion binding, metal ion region:Tryptophan STIMULAT organelle, intracellular metabolism, cellular physiological process, binding, nucleic acid binding, protein pentad repeat, 27
    • cellular process, defense response, immune response, metabolism, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, organismal physiological process, physiological process, primary metabolism, regulation of biological domain:UBA, splice process, regulation of cellular metabolism, variant, zinc finger regulation of cellular physiological region:IBR-type 1, zinc ED process, regulation of cellular process, finger region:IBR-type TRANSCRI regulation of metabolism, regulation of binding, transcription factor activity, 2, zinc finger PTION organelle, membrane-bound nucleobase, nucleoside, nucleotide and transcription regulator activity, region:RING-type; FACTOR 3, organelle, nucleus, organelle, nucleic acid metabolism, regulation of transition metal ion binding, zinc ion degenerate, zinc finger GAMMA physiological process, regulation of binding, region:RanBP2-type 1, 48KDA transcription, regulation of transcription, zinc finger DNA-dependent, response to biotic region:RanBP2-type 2, stimulus, response to other organism, zinc finger response to pest, pathogen or parasite, region:RanBP2-type 3, response to stimulus, response to stress, response to virus, signal transduction, transcription, transcription from RNA polymerase II promoter, transcription, DNA-dependent, 55072 INTERFER cell, cytoplasm, intracellular, cell communication, cell surface receptor DNA binding, binding, cation DNA-binding ON- intracellular membrane-bound linked signal transduction, cellular binding, ion binding, metal ion region:Tryptophan STIMULAT organelle, intracellular metabolism, cellular physiological process, binding, nucleic acid binding, protein pentad repeat, ED organelle, membrane-bound cellular process, defense response, immune binding, transcription factor activity, domain:UBA, splice TRANSCRI organelle, nucleus, organelle, response, metabolism, nucleobase, transcription regulator activity, variant, zinc finger PTION nucleoside, nucleotide and nucleic acid transition metal ion binding, zinc ion region:IBR-type 1, zinc FACTOR 3, metabolism, organismal physiological binding, finger region:IBR-type GAMMA process, physiological process, primary 2, zinc finger 48KDA metabolism, regulation of biological region:RING-type; process, regulation of cellular metabolism, degenerate, zinc finger regulation of cellular physiological region:RanBP2-type 1, process, regulation of cellular process, zinc finger regulation of metabolism, regulation of region:RanBP2-type 2, 28
    • nucleobase, nucleoside, nucleotide and nucleic acid metabolism, regulation of physiological process, regulation of transcription, regulation of transcription, DNA-dependent, response to biotic stimulus, response to other organism, zinc finger response to pest, pathogen or parasite, region:RanBP2-type 3, response to stimulus, response to stress, response to virus, signal transduction, transcription, transcription from RNA polymerase II promoter, transcription, DNA-dependent, carboxylic ester hydrolase activity, catalytic activity, hydrolase activity, hydrolase activity, acting on ester PHOSPHOL bonds, lipase activity, phospholipase IPASE D 23646 cell, membrane, metabolism, physiological process, D activity, phospholipase activity, Null FAMILY, phosphoric diester hydrolase activity, MEMBER 3 phosphoric ester hydrolase activity, phosphoric monoester hydrolase activity, LIPOMA HMGIC 10184 FUSION Null Null Null Null PARTNER- LIKE 2 Down-regulated 1645 ALDO- cell, cytoplasm, intracellular, cellular metabolism, cellular physiological 20-alpha-hydroxysteroid active site:Proton KETO process, cellular process, metabolism, dehydrogenase activity, aldo-keto donor, binding REDUCTAS physiological process, response to abiotic reductase activity, bile acid site:Progesterone, E FAMILY stimulus, response to chemical stimulus, transporter activity, binding, binding site:Substrate, 1, response to stimulus, response to carboxylic acid transporter activity, mutagenesis site, MEMBER xenobiotic stimulus, xenobiotic catalytic activity, electron transporter nucleotide phosphate- C1 metabolism, activity, monocarboxylic acid binding region:NADP, (DIHYDRO transporter activity, organic acid site:Important for 29
    • transporter activity, oxidoreductase activity, oxidoreductase activity, acting on CH-OH group of donors, DIOL substrate specificity, oxidoreductase activity, acting on the DEHYDRO site:Lowers pKa of CH-CH group of donors, GENASE 1; active site Tyr, oxidoreductase activity, acting on the 20-ALPHA site:May be involved in CH-CH group of donors, NAD or (3-ALPHA)- the mediating step NADP as acceptor, oxidoreductase HYDROXY between the activity, acting on the CH-OH group STEROID transformation of of donors, NAD or NADP as DEHYDRO progesterone and the acceptor, trans-1,2- GENASE) release of the cofactor, dihydrobenzene-1,2-diol dehydrogenase activity, transporter activity, O-acyltransferase activity, O- carboxylic acid metabolism, cellular lipid octanoyltransferase activity, metabolism, cellular metabolism, cellular cell, cytoplasm, intracellular, acyltransferase activity, carnitine O- CARNITIN physiological process, cellular process, intracellular membrane-bound acyltransferase activity, carnitine O- active site:Proton E O- establishment of localization, fatty acid organelle, intracellular octanoyltransferase activity, catalytic acceptor, binding 54677 OCTANOY metabolism, generation of precursor organelle, membrane-bound activity, octanoyltransferase activity, site:Carnitine, binding LTRANSFE metabolites and energy, lipid metabolism, organelle, microbody, organelle, transferase activity, transferase site:Coenzyme A, RASE localization, metabolism, organic acid peroxisome, activity, transferring acyl groups, metabolism, physiological process, transferase activity, transferring primary metabolism, transport, groups other than amino-acyl groups, 5728 PHOSPHAT cell, cytoplasm, intracellular, alcohol metabolism, apoptosis, biopolymer PDZ domain binding, binding, active ASE AND metabolism, biopolymer modification, catalytic activity, hydrolase activity, site:Phosphocysteine TENSIN carbohydrate metabolism, cell adhesion, hydrolase activity, acting on ester intermediate, HOMOLOG cell communication, cell cycle, cell death, bonds, inositol or domain:C2 tensin-type, (MUTATED cell migration, cell motility, cell phosphatidylinositol phosphatase domain:Tyrosine- IN proliferation, cell-matrix adhesion, cell- activity, inositol-1,3,4,5- protein phosphatase, MULTIPLE substrate adhesion, cellular carbohydrate tetrakisphosphate 3-phosphatase ADVANCE metabolism, cellular lipid metabolism, activity, lipid phosphatase activity, D cellular macromolecule metabolism, phosphatidylinositol-3,4,5- CANCERS cellular metabolism, cellular physiological trisphosphate 3-phosphatase activity, 1) process, cellular process, cellular protein phosphatidylinositol-3,4- 30
    • metabolism, central nervous system development, death, dephosphorylation, development, establishment of localization, focal adhesion formation, bisphosphate 3-phosphatase activity, heart development, hexose metabolism, phosphatidylinositol-3-phosphatase induction of apoptosis, induction of activity, phosphoprotein phosphatase programmed cell death, inositol phosphate activity, phosphoric ester hydrolase dephosphorylation, intracellular signaling activity, phosphoric monoester cascade, lipid metabolism, lipid hydrolase activity, protein binding, modification, localization, localization of protein domain specific binding, cell, locomotion, macromolecule protein serine/threonine phosphatase metabolism, metabolism, monosaccharide activity, protein tyrosine phosphatase metabolism, morphogenesis, myo-inositol activity, metabolism, negative regulation of biological process, negative regulation of cell migr active biopolymer metabolism, biopolymer site:Phosphocysteine modification, cell cycle, cellular intermediate, active macromolecule metabolism, cellular cell, cytoplasm, endoplasmic catalytic activity, hydrolase activity, site:Proton donor, PROTEIN metabolism, cellular physiological process, reticulum, intracellular, hydrolase activity, acting on ester binding site:Substrate; TYROSINE cellular process, cellular protein intracellular membrane-bound bonds, phosphoprotein phosphatase phosphate group, PHOSPHAT metabolism, dephosphorylation, 7803 organelle, intracellular activity, phosphoric ester hydrolase disulfide bond, ASE TYPE development, macromolecule metabolism, organelle, membrane, activity, phosphoric monoester domain:Tyrosine- IVA, metabolism, phosphate metabolism, membrane-bound organelle, hydrolase activity, protein tyrosine protein phosphatase, MEMBER 1 phosphorus metabolism, physiological organelle, phosphatase activity, lipid moiety-binding process, primary metabolism, protein region:S-farnesyl amino acid dephosphorylation, protein cysteine, mutagenesis metabolism, protein modification, site, 7341 SMT3 cell, intracellular, intracellular biopolymer metabolism, biopolymer binding, protein binding, cross-link:Glycyl SUPPRESS membrane-bound organelle, modification, cellular macromolecule lysine isopeptide (Gly- OR OF MIF intracellular organelle, metabolism, cellular metabolism, cellular Lys) (interchain with TWO 3 membrane-bound organelle, physiological process, cellular process, K-? in acceptor HOMOLOG nucleus, organelle, cellular protein metabolism, proteins), 1 (YEAST) macromolecule metabolism, metabolism, domain:Ubiquitin-like, 31
    • negative regulation of biological process, negative regulation of cellular metabolism, negative regulation of cellular physiological process, negative regulation of cellular process, negative regulation of metabolism, negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, negative regulation of physiological process, negative regulation of transcription, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, physiological process, primary metabolism, protein metabolism, protein modification, protein sumoylation, regulation of biological process, regulation of cellular metabolism, regulation of cellular physiological process, regulation of cellular process, regulation of metabolism, regulation of nucleobase, nucleoside, nucleotide and nucleic acid metab actin cytoskeleton, cell, cell cycle, cell division, cellular cytoskeleton, intracellular, physiological process, cellular process, GTP binding, binding, guanyl intracellular non-membrane- macromolecule metabolism, metabolism, modified residue, nucleotide binding, nucleotide 55752 SEPTIN 11 bound organelle, intracellular physiological process, primary nucleotide phosphate- binding, protein binding, purine organelle, non-membrane- metabolism, protein complex assembly, binding region:GTP, nucleotide binding, bound organelle, organelle, protein heterooligomerization, protein stress fiber, metabolism, protein oligomerization, 5586 PROTEIN cell, intracellular, biopolymer metabolism, biopolymer ATP binding, adenyl nucleotide active site:Proton KINASE N2 modification, cell communication, cellular binding, binding, catalytic activity, acceptor, binding macromolecule metabolism, cellular kinase activity, nucleotide binding, site:ATP, domain:C2, metabolism, cellular physiological process, phosphotransferase activity, alcohol domain:Protein kinase, cellular process, cellular protein group as acceptor, protein kinase nucleotide phosphate- metabolism, macromolecule metabolism, activity, protein serine/threonine binding region:ATP, metabolism, phosphate metabolism, kinase activity, purine nucleotide repeat:REM 1, 32
    • phosphorus metabolism, phosphorylation, physiological process, primary binding, transferase activity, repeat:REM 2, metabolism, protein amino acid transferase activity, transferring repeat:REM 3, phosphorylation, protein metabolism, phosphorus-containing groups, protein modification, signal transduction, cell motility, cell proliferation, cellular cell, integral to membrane, physiological process, cellular process, glycosylation site:N- TETRASPA 10099 intrinsic to membrane, establishment of localization, localization, Null linked (GlcNAc...), NIN 3 membrane, localization of cell, locomotion, transmembrane region, physiological process, domain:Fibronectin type-III 1, domain:Fibronectin type-III 2, domain:Fibronectin type-III 3, domain:Fibronectin anion transport, cell adhesion, cellular type-III 4, FACIT collagen, anchoring physiological process, cellular process, domain:Fibronectin COLLAGE collagen, cell, collagen, collagen fibril organization, establishment type-III 5, N, TYPE collagen type XIV, cytoplasm, of localization, extracellular matrix binding, extracellular matrix domain:Fibronectin 7373 XIV, extracellular matrix, organization and biogenesis, extracellular structural constituent, protein type-III 6, ALPHA 1 extracellular matrix (sensu structure organization and biogenesis, binding, structural molecule activity, domain:Fibronectin (UNDULIN) Metazoa), extracellular region, inorganic anion transport, ion transport, type-III 7, intracellular, localization, phosphate transport, domain:Fibronectin physiological process, transport, type-III 8, domain:TSP N-terminal, domain:VWFA 1, domain:VWFA 2, glycosylation site:N- linked (GlcNAc...), signal peptide, splice variant, PROMETHI 57146 Null Null Null Null N 33
    • biopolymer metabolism, biopolymer modification, cellular macromolecule binding, catalytic activity, cation MEMBRAN metabolism, cellular metabolism, cellular binding, ion binding, ligase activity, E- physiological process, cellular process, cell, intracellular, protein ligase activity, forming carbon- ASSOCIAT cellular protein metabolism, 10299 complex, ubiquitin ligase nitrogen bonds, metal ion binding, Null ED RING macromolecule metabolism, metabolism, complex, protein binding, transition metal ion FINGER physiological process, primary binding, ubiquitin-protein ligase (C3HC4) 6 metabolism, protein metabolism, protein activity, zinc ion binding, modification, protein ubiquitination, ubiquitin cycle, biosynthesis, cellular biosynthesis, cellular macromolecule metabolism, cellular metabolism, cellular physiological process, cellular process, cellular protein metabolism, macromolecule biosynthesis, EUKARYO macromolecule metabolism, metabolism, TIC physiological process, primary TRANSLAT metabolism, protein biosynthesis, protein cell, cytoplasm, eukaryotic 43S binding, nucleic acid binding, ION metabolism, regulation of biological preinitiation complex, translation factor activity, nucleic INITIATIO process, regulation of biosynthesis, 8667 eukaryotic translation initiation acid binding, translation initiation Null N FACTOR regulation of cellular biosynthesis, factor 3 complex, intracellular, factor activity, translation regulator 3, regulation of cellular metabolism, protein complex, activity, SUBUNIT 3 regulation of cellular physiological GAMMA, process, regulation of cellular process, 40KDA regulation of metabolism, regulation of physiological process, regulation of protein biosynthesis, regulation of protein metabolism, regulation of translation, regulation of translational initiation, translation, translational initiation, 8073 PROTEIN cell, membrane, biopolymer metabolism, biopolymer catalytic activity, hydrolase activity, active TYROSINE modification, cellular macromolecule hydrolase activity, acting on ester site:Phosphocysteine PHOSPHAT metabolism, cellular metabolism, cellular bonds, phosphoprotein phosphatase intermediate, active ASE TYPE physiological process, cellular process, activity, phosphoric ester hydrolase site:Proton donor, IVA, cellular protein metabolism, activity, phosphoric monoester binding site:Substrate; 34
    • phosphate group, dephosphorylation, macromolecule disulfide bond, metabolism, metabolism, phosphate domain:Tyrosine- metabolism, phosphorus metabolism, hydrolase activity, prenylated protein protein phosphatase, MEMBER 2 physiological process, primary tyrosine phosphatase activity, protein lipid moiety-binding metabolism, protein amino acid tyrosine phosphatase activity, region:S-farnesyl dephosphorylation, protein metabolism, cysteine, mutagenesis protein modification, site, splice variant, biopolymer metabolism, biopolymer modification, cell adhesion, cell communication, cell surface receptor ATP binding, adenyl nucleotide active site:Proton linked signal transduction, cellular binding, binding, catalytic activity, acceptor, binding macromolecule metabolism, cellular kinase activity, nucleotide binding, site:ATP, disulfide metabolism, cellular physiological process, phosphotransferase activity, alcohol bond, domain:F5/8 DISCOIDIN cell, integral to membrane, cellular process, cellular protein group as acceptor, protein kinase type C, domain:Protein DOMAIN integral to plasma membrane, metabolism, enzyme linked receptor activity, protein-tyrosine kinase kinase, glycosylation 4921 RECEPTOR intrinsic to membrane, intrinsic protein signaling pathway, macromolecule activity, purine nucleotide binding, site:N-linked FAMILY, to plasma membrane, metabolism, metabolism, phosphate receptor activity, signal transducer (GlcNAc...), nucleotide MEMBER 2 membrane, plasma membrane, metabolism, phosphorus metabolism, activity, transferase activity, phosphate-binding phosphorylation, physiological process, transferase activity, transferring region:ATP, signal primary metabolism, protein amino acid phosphorus-containing groups, peptide, phosphorylation, protein metabolism, transmembrane receptor activity, transmembrane region, protein modification, signal transduction, transmembrane receptor protein tyrosine kinase signaling pathway, 2079 ENHANCE Null cell cycle, cellular metabolism, cellular molecular function unknown, Null R OF physiological process, cellular process, RUDIMENT metabolism, nucleobase, nucleoside, ARY nucleotide and nucleic acid metabolism, HOMOLOG nucleoside metabolism, physiological (DROSOPH process, primary metabolism, pyrimidine ILA) nucleoside metabolism, regulation of biological process, regulation of cell cycle, regulation of cellular physiological process, regulation of cellular process, 35
    • regulation of physiological process, regulation of progression through cell cycle, domain:VWFC 1, domain:VWFC 2, CHORDIN- domain:VWFC 3, 91851 Null development, Null LIKE 1 glycosylation site:N- linked (GlcNAc...), signal peptide, cell organization and biogenesis, cellular cell, cytoplasm, endomembrane localization, cellular physiological process, system, envelope, integral to cellular process, establishment of cellular domain:Importin N- membrane, intracellular, localization, establishment of localization, terminal, repeat:HEAT intracellular membrane-bound establishment of protein localization, binding, nuclear localization 1, repeat:HEAT 2, organelle, intracellular intracellular protein transport, intracellular sequence binding, peptide binding, repeat:HEAT 3, TRANSPOR organelle, intrinsic to 3842 transport, localization, nuclear import, protein transporter activity, signal repeat:HEAT 4, TIN 1 membrane, membrane, nuclear transport, nucleocytoplasmic sequence binding, transporter repeat:HEAT 5, membrane-bound organelle, transport, physiological process, protein activity, repeat:HEAT 6, nuclear envelope, nuclear pore, import, protein import into nucleus, repeat:HEAT 7, nucleus, organelle, organelle protein import into nucleus, translocation, repeat:HEAT 8, envelope, pore complex, protein protein localization, protein targeting, complex, protein transport, transport, 8476 CDC42 cell, cell junction, intercellular actin cytoskeleton organization and ATP binding, GTPase regulator active site:Proton BINDING junction, leading edge, biogenesis, actin cytoskeleton activity, adenyl nucleotide binding, acceptor, binding PROTEIN membrane, plasma membrane, reorganization, actin filament-based binding, catalytic activity, cation site:ATP, KINASE process, biopolymer metabolism, binding, diacylglycerol binding, domain:CNH, ALPHA biopolymer modification, cell enzyme regulator activity, identical domain:CRIB, (DMPK- communication, cell organization and protein binding, ion binding, kinase domain:PH, LIKE) biogenesis, cellular macromolecule activity, lipid binding, magnesium domain:Protein kinase, metabolism, cellular metabolism, cellular ion binding, metal ion binding, mutagenesis site, physiological process, cellular process, nucleotide binding, nucleotide phosphate- cellular protein metabolism, cytoskeleton phosphotransferase activity, alcohol binding region:ATP, organization and biogenesis, intracellular group as acceptor, protein binding, splice variant, zinc signaling cascade, macromolecule protein kinase activity, protein serine/ finger region:Phorbol- metabolism, metabolism, organelle threonine kinase activity, purine ester/DAG-type, 36
    • organization and biogenesis, phosphate metabolism, phosphorus metabolism, phosphorylation, physiological process, primary metabolism, protein amino acid nucleotide binding, small GTPase phosphorylation, protein metabolism, regulator activity, transferase activity, protein modification, regulation of transferase activity, transferring biological process, regulation of cellular phosphorus-containing groups, process, regulation of signal transduction, transition metal ion binding, zinc ion regulation of small GTPase mediated binding, signal transduction, signal transduction, small GTPase mediated signal transduction, 7707 ZINC DNA-directed RNA polymerase cellular defense response, cellular DNA binding, RNA polymerase II modified residue, zinc FINGER II, core complex, DNA-directed metabolism, cellular physiological process, transcription factor activity, binding, finger region:C2H2- PROTEIN RNA polymerase II, cellular process, defense response, immune cation binding, ion binding, metal ion type 1, zinc finger 148 holoenzyme, RNA polymerase response, metabolism, negative regulation binding, nucleic acid binding, region:C2H2-type 2, (PHZ-52) complex, cell, intracellular, of biological process, negative regulation specific RNA polymerase II zinc finger intracellular membrane-bound of cellular metabolism, negative regulation transcription factor activity, region:C2H2-type 3, organelle, intracellular of cellular physiological process, negative transcription regulator activity, zinc finger organelle, membrane-bound regulation of cellular process, negative transcriptional activator activity, region:C2H2-type 4, organelle, membrane-enclosed regulation of metabolism, negative transition metal ion binding, zinc ion lumen, nuclear lumen, regulation of nucleobase, nucleoside, binding, nucleoplasm, nucleus, organelle, nucleotide and nucleic acid metabolism, organelle lumen, protein negative regulation of physiological complex, process, negative regulation of transcription, negative regulation of transcription from RNA polymerase II promoter, negative regulation of transcription, DNA-dependent, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, organismal physiological process, physiological process, primary metabolism, regulation of biological process, regulation of cellular metabolism, regulation of cellular 37
    • physiological process, regulation of cellular process, regulation of metabolism, regulation of nucleobase, nucleoside, nucleotide and CMP-sialic acid transport, biopolymer Golgi apparatus, Golgi metabolism, biopolymer modification, membrane, Golgi stack, cell, SOLUTE carbohydrate metabolism, carbohydrate cytoplasm, endomembrane CMP-sialic acid transporter activity, CARRIER transport, cellular macromolecule system, integral to membrane, carbohydrate transporter activity, FAMILY 35 metabolism, cellular metabolism, cellular integral to plasma membrane, carrier activity, electrochemical (CMP- physiological process, cellular process, intracellular, intracellular potential-driven transporter activity, SIALIC cellular protein metabolism, establishment 10559 membrane-bound organelle, nucleotide-sugar transporter activity, transmembrane region, ACID of localization, localization, intracellular organelle, intrinsic porter activity, pyrimidine nucleotide TRANSPOR macromolecule metabolism, metabolism, to membrane, intrinsic to sugar transporter activity, sugar TER), nucleotide-sugar transport, physiological plasma membrane, membrane, porter activity, sugar transporter MEMBER process, primary metabolism, protein membrane-bound organelle, activity, transporter activity, A1 metabolism, protein modification, organelle, organelle membrane, pyrimidine nucleotide-sugar transport, plasma membrane, transport, biosynthesis, cellular biosynthesis, cellular cell, cytoplasm, intracellular, macromolecule metabolism, cellular intracellular non-membrane- metabolism, cellular physiological process, bound organelle, intracellular cellular process, cellular protein binding, structural constituent of organelle, non-membrane- 9652 KIAA0372 metabolism, macromolecule biosynthesis, ribosome, structural molecule Null bound organelle, organelle, macromolecule metabolism, metabolism, activity, protein complex, physiological process, primary ribonucleoprotein complex, metabolism, protein biosynthesis, protein ribosome, metabolism, 8337 HISTONE 2, cell, chromatin, chromosome, DNA metabolism, DNA packaging, DNA binding, binding, nucleic acid Null H2AA intracellular, intracellular biopolymer metabolism, cell organization binding, membrane-bound organelle, and biogenesis, cellular metabolism, intracellular non-membrane- cellular physiological process, cellular bound organelle, intracellular process, chromatin assembly, chromatin organelle, membrane-bound assembly or disassembly, chromosome organelle, non-membrane- organization and biogenesis, chromosome bound organelle, nucleosome, organization and biogenesis (sensu 38
    • Eukaryota), establishment and/or maintenance of chromatin architecture, macromolecule metabolism, metabolism, nucleobase, nucleoside, nucleotide and nucleus, organelle, protein nucleic acid metabolism, nucleosome complex, assembly, organelle organization and biogenesis, physiological process, primary metabolism, protein complex assembly, protein metabolism, actin binding, actinin binding, binding, cation binding, cytoskeletal protein binding, enzyme binding, ion domain:LIM zinc- binding, kinase binding, metal ion binding 1, domain:LIM PDZ AND cell, cell fraction, cytoplasm, development, heart development, binding, protein binding, protein zinc-binding 2, 10611 LIM cytosol, intracellular, membrane morphogenesis, organ development, organ kinase C binding, protein kinase domain:LIM zinc- DOMAIN 5 fraction, morphogenesis, binding, receptor signaling complex binding 3, scaffold activity, signal transducer domain:PDZ, activity, transition metal ion binding, zinc ion binding, 596 B-CELL cell, cytoplasm, endoplasmic anti-apoptosis, apoptosis, apoptotic binding, identical protein binding, helix, mutagenesis site, CLL/LYMP reticulum, envelope, integral to mitochondrial changes, apoptotic program, protein binding, site:Cleavage (by HOMA 2 membrane, intracellular, cell cycle, cell death, cell proliferation, caspase-3), splice intracellular membrane-bound cellular physiological process, cellular variant, transmembrane organelle, intracellular process, death, defense response, humoral region, organelle, intrinsic to immune response, immune response, membrane, membrane, negative regulation of apoptosis, negative membrane-bound organelle, regulation of biological process, negative mitochondrial envelope, regulation of cell proliferation, negative mitochondrial membrane, regulation of cellular physiological mitochondrial outer membrane, process, negative regulation of cellular mitochondrion, nucleus, process, negative regulation of organelle, organelle envelope, physiological process, negative regulation organelle membrane, organelle of programmed cell death, organismal outer membrane, outer physiological process, physiological membrane, process, programmed cell death, regulation 39
    • of apoptosis, regulation of biological process, regulation of cell cycle, regulation of cell proliferation, regulation of cellular physiological process, regulation of cellular process, regulation of physiological process, regulation of programmed cell death, regulation of progression through cell cycle, release of cytochrome c from mitochondria, response to biotic stimulus, respons cell, intracellular, intracellular membrane-bound organelle, RNA metabolism, RNA processing, RNA SMALL intracellular organelle, major splicing, biopolymer metabolism, cellular NUCLEAR (U2-dependent) spliceosome, metabolism, cellular physiological process, RIBONUCL membrane-bound organelle, helix, repeat:LRR 1, cellular process, macromolecule RNA binding, binding, nucleic acid 6627 EOPROTEI nucleus, organelle, protein repeat:LRR 2, metabolism, metabolism, nucleobase, binding, N complex, ribonucleoprotein repeat:LRR 3, nucleoside, nucleotide and nucleic acid POLYPEPTI complex, small nuclear metabolism, physiological process, DE A' ribonucleoprotein complex, primary metabolism, snRNP U2, spliceosome complex, caveola, caveolar membrane, cell, cytoplasm, integral to membrane, integral to plasma binding, identical protein binding, CAVEOLIN membrane, intracellular, protein binding, protein dimerization modified residue, 858 Null 2 intrinsic to membrane, intrinsic activity, protein homodimerization transmembrane region, to plasma membrane, lipid raft, activity, membrane, perinuclear region, plasma membrane, 4692 NECDIN cell, intracellular, intracellular cell cycle, cell growth, cell organization DNA binding, binding, nucleic acid domain:MAGE, HOMOLOG membrane-bound organelle, and biogenesis, cell proliferation, cellular binding, (MOUSE) intracellular organelle, metabolism, cellular morphogenesis, membrane-bound organelle, cellular physiological process, cellular nucleus, organelle, process, development, growth, metabolism, morphogenesis, negative 40
    • regulation of biological process, negative regulation of cell proliferation, negative regulation of cellular physiological process, negative regulation of cellular process, negative regulation of physiological process, nervous system development, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, physiological process, primary metabolism, regulation of biological process, regulation of cell cycle, regulation of cell growth, regulation of cell proliferation, regulation of cell size, regulation of cellular metabolism, regulation of cellular physiological process, regulation of cellular process, regulation of growth, regulation of metabolism, regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, regulation of physiological process, regulation of pro 9643 MORTALIT cell, intracellular, intracellular DNA metabolism, DNA packaging, molecular function unknown, mutagenesis site, Y FACTOR membrane-bound organelle, biopolymer metabolism, cell growth, cell 4 LIKE 2 intracellular non-membrane- organization and biogenesis, cellular bound organelle, intracellular metabolism, cellular morphogenesis, organelle, membrane-bound cellular physiological process, cellular organelle, membrane-enclosed process, chromatin modification, lumen, non-membrane-bound chromosome organization and biogenesis, organelle, nuclear lumen, chromosome organization and biogenesis nucleolus, nucleus, organelle, (sensu Eukaryota), development, organelle lumen, establishment and/or maintenance of chromatin architecture, growth, macromolecule metabolism, metabolism, morphogenesis, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, 41
    • organelle organization and biogenesis, physiological process, primary metabolism, regulation of biological process, regulation of cell growth, regulation of cell size, regulation of cellular metabolism, regulation of cellular physiological process, regulation of cellular process, regulation of growth, regulation of metabolism, regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, regulation of physiological process, regulation of transcription, regulation of transcription, DNA-de actin cytoskeleton, cell, cell actin cytoskeleton organization and cortex, cortical actin biogenesis, actin filament-based process, cytoskeleton, cortical ERYTHRO cell organization and biogenesis, cellular cytoskeleton, cytoplasm, CYTE physiological process, cellular process, actin binding, binding, cytoskeletal cytoskeleton, intracellular, MEMBRAN cortical actin cytoskeleton organization protein binding, protein binding, 2037 intracellular non-membrane- domain:FERM, E PROTEIN and biogenesis, cortical cytoskeleton structural constituent of cytoskeleton, bound organelle, intracellular BAND 4.1- organization and biogenesis, cytoskeleton structural molecule activity, organelle, membrane, non- LIKE 2 organization and biogenesis, organelle membrane-bound organelle, organization and biogenesis, physiological organelle, plasma membrane, process, spectrin, actin binding, binding, cytoskeletal protein binding, enzyme inhibitor PHOSPHAT repeat:RPEL 1, activity, enzyme regulator activity, ASE AND repeat:RPEL 2, phosphatase inhibitor activity, 9749 ACTIN Null Null repeat:RPEL 3, phosphatase regulator activity, REGULAT repeat:RPEL 4, splice protein binding, protein phosphatase OR 2 variant, inhibitor activity, protein phosphatase regulator activity, 5502 PROTEIN Null biopolymer metabolism, carbohydrate enzyme inhibitor activity, enzyme modified residue, PHOSPHAT metabolism, cell communication, cellular regulator activity, phosphatase mutagenesis site, 42
    • carbohydrate metabolism, cellular macromolecule metabolism, cellular ASE 1, metabolism, cellular physiological process, REGULAT cellular polysaccharide metabolism, inhibitor activity, phosphatase ORY cellular process, generation of precursor regulator activity, protein (INHIBITO metabolites and energy, glucan phosphatase inhibitor activity, protein R) metabolism, glycogen metabolism, phosphatase regulator activity, SUBUNIT macromolecule metabolism, metabolism, 1A physiological process, polysaccharide metabolism, primary metabolism, signal transduction, RNA metabolism, RNA processing, RNA splicing, RNA splicing, via transesterification reactions, RNA splicing, via transesterification reactions with bulged adenosine as nucleophile, domain:RRM, repeat:1, SPLICING cell, intracellular, intracellular biopolymer metabolism, cellular repeat:10, repeat:2, FACTOR, membrane-bound organelle, metabolism, cellular physiological process, RNA binding, binding, nucleic acid repeat:3, repeat:4, 9295 ARGININE/ intracellular organelle, cellular process, mRNA metabolism, binding, nucleotide binding, repeat:5, repeat:6, SERINE- membrane-bound organelle, mRNA processing, macromolecule repeat:7, repeat:8, RICH 11 nucleus, organelle, metabolism, metabolism, nuclear mRNA repeat:9, splicing, via spliceosome, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, physiological process, primary metabolism, 5178 PATERNAL cell, intracellular, intracellular cellular metabolism, cellular physiological DNA binding, binding, cation Null LY membrane-bound organelle, process, cellular process, metabolism, binding, ion binding, metal ion EXPRESSE intracellular organelle, nucleobase, nucleoside, nucleotide and binding, nucleic acid binding, D3 membrane-bound organelle, nucleic acid metabolism, physiological transcription factor activity, nucleus, organelle, process, primary metabolism, regulation of transcription regulator activity, biological process, regulation of cellular transition metal ion binding, zinc ion metabolism, regulation of cellular binding, physiological process, regulation of cellular process, regulation of metabolism, regulation of nucleobase, nucleoside, 43
    • nucleotide and nucleic acid metabolism, regulation of physiological process, regulation of transcription, regulation of transcription, DNA-dependent, transcription, transcription, DNA- dependent, basal lamina, basement membrane, cell, cytoplasm, cytoskeleton, dystrophin- associated glycoprotein complex, extracellular matrix, extracellular matrix (sensu SARCOSPA Metazoa), extracellular region, N (KRAS integral to membrane, integral cell adhesion, cellular process, muscle sequence conflict, ONCOGEN 8082 to plasma membrane, contraction, organismal physiological Null splice variant, E- intracellular, intracellular non- process, physiological process, transmembrane region, ASSOCIAT membrane-bound organelle, ED GENE) intracellular organelle, intrinsic to membrane, intrinsic to plasma membrane, membrane, non-membrane-bound organelle, organelle, plasma membrane, protein complex, 56987 BOBBY Null cellular metabolism, cellular physiological DNA binding, binding, nucleic acid Null SOX process, cellular process, metabolism, binding, HOMOLOG nucleobase, nucleoside, nucleotide and (DROSOPH nucleic acid metabolism, physiological ILA) process, primary metabolism, regulation of biological process, regulation of cellular metabolism, regulation of cellular physiological process, regulation of cellular process, regulation of metabolism, regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, regulation of physiological process, 44
    • regulation of transcription, regulation of transcription, DNA-dependent, transcription, transcription, DNA- dependent, 351 AMYLOID cell, cell surface, coated pit, Notch signaling pathway, apoptosis, cation amyloid protein, binding, disulfide bond, BETA (A4) extracellular region, integral to homeostasis, cell adhesion, cell carbohydrate binding, cation binding, domain:BPTI/Kunitz PRECURSO membrane, integral to plasma communication, cell death, cell copper ion binding, endopeptidase inhibitor, glycosylation R PROTEIN membrane, intrinsic to homeostasis, cell ion homeostasis, cell inhibitor activity, enzyme inhibitor site:N-linked (PEPTIDAS membrane, intrinsic to plasma surface receptor linked signal transduction, activity, enzyme regulator activity, (GlcNAc...), E NEXIN-II, membrane, membrane, plasma cellular metabolism, cellular physiological glycosaminoglycan binding, heme glycosylation site:O- ALZHEIME membrane, process, cellular process, copper ion binding, heparin binding, ion binding, linked (Xyl...) R homeostasis, death, di-, tri-valent iron ion binding, metal ion binding, (chondroitin sulfate); in DISEASE) inorganic cation homeostasis, electron obsolete molecular function, pattern L-APP isoforms, metal transport, endocytosis, establishment of binding, polysaccharide binding, ion-binding localization, generation of precursor protease inhibitor activity, protein site:Copper, metal ion- metabolites and energy, homeostasis, ion binding, serine-type endopeptidase binding site:Copper or homeostasis, localization, metabolism, inhibitor activity, tetrapyrrole zinc, mutagenesis site, metal ion homeostasis, neuromuscular binding, transition metal ion binding, peptide:P3(40), physiological process, neurophysiological zinc ion binding, peptide:P3(42), signal process, organismal movement, peptide, site:Cleavage organismal physiological process, (by alpha-secretase), physiological process, programmed cell site:Cleavage (by beta- death, signal transduction, transition metal secretase), ion homeostasis, transport, vesicle- site:Cleavage (by mediated transport, caspase-6; in the AD variant with 670-N- L-671), site:Cleavage (by caspases-6, -8 or -9), site:Cleavage (by gamma-secretase; site 1), site:Cleavage (by gamma-secretase; site 2), site:Cleavage (by gamma-secretase; site 3), site:Implicated in 45
    • free radical propagation, site:Reactive bond, site:Required for Cu(2+) reduction, site:Susceptible to oxidation, splice variant, transmembrane region, antimicrobial humoral response, antimicrobial humoral response (sensu Vertebrata), cell communication, cellular metabolism, cellular physiological process, cellular process, defense response, humoral defense mechanism (sensu Vertebrata), humoral immune response, immune response, metabolism, DNA binding, binding, cation nucleobase, nucleoside, nucleotide and binding, ion binding, ligand- nucleic acid metabolism, organismal dependent nuclear receptor activity, NUCLEAR physiological process, physiological cell, intracellular, intracellular metal ion binding, nucleic acid RECEPTOR process, primary metabolism, regulation of DNA-binding membrane-bound organelle, binding, receptor activity, sequence- SUBFAMIL biological process, regulation of cellular region:Nuclear 4929 intracellular organelle, specific DNA binding, signal Y 4, metabolism, regulation of cellular receptor, zinc finger membrane-bound organelle, transducer activity, steroid hormone GROUP A, physiological process, regulation of region:NR C4-type, nucleus, organelle, receptor activity, transcription factor MEMBER 2 cellular process, regulation of metabolism, activity, transcription regulator regulation of nucleobase, nucleoside, activity, transition metal ion binding, nucleotide and nucleic acid metabolism, zinc ion binding, regulation of physiological process, regulation of transcription, regulation of transcription, DNA-dependent, response to biotic stimulus, response to other organism, response to pest, pathogen or parasite, response to stimulus, response to stress, signal transduction, transcription, transcription, DNA-dependent, 46
    • domain:LIM zinc- LIM binding 1, domain:LIM DOMAIN zinc-binding 2, CONTAINI cell, cellular component domain:LIM zinc- NG unknown, intracellular, binding, cation binding, ion binding, binding 3, mutagenesis PREFERRE intracellular membrane-bound biological process unknown, cell adhesion, metal ion binding, molecular function site, site:Breakpoint for 4026 D organelle, intracellular cellular process, unknown, protein binding, transition translocation to form TRANSLOC organelle, membrane-bound metal ion binding, zinc ion binding, HMGA2-LPP, ATION organelle, nucleus, organelle, site:Breakpoint for PARTNER translocation to form IN LIPOMA HMGA2-LPP and MLL-LPP, cell communication, cell growth, cell organization and biogenesis, cellular morphogenesis, cellular physiological NEUROEPI cell, cellular component process, cellular process, development, THELIAL unknown, intracellular, GTPase regulator activity, enzyme growth, morphogenesis, physiological domain:DH, CELL intracellular membrane-bound regulator activity, guanyl-nucleotide 10276 process, regulation of biological process, domain:PH, splice TRANSFOR organelle, intracellular exchange factor activity, small regulation of cell growth, regulation of cell variant, MING organelle, membrane-bound GTPase regulator activity, size, regulation of cellular physiological GENE 1 organelle, nucleus, organelle, process, regulation of cellular process, regulation of growth, regulation of physiological process, signal transduction, alkali metal ion binding, alpha-type POTASSIU channel activity, auxiliary transport M protein activity, binding, catalytic VOLTAGE- cation transport, cellular physiological activity, cation binding, cation GATED cell, cytoplasm, integral to process, cellular process, establishment of transporter activity, channel or pore CHANNEL, membrane, intracellular, localization, ion transport, localization, sequence conflict, 7881 class transporter activity, ion binding, SHAKER- intrinsic to membrane, metal ion transport, monovalent inorganic splice variant, ion channel activity, ion transporter RELATED membrane, cation transport, physiological process, activity, metal ion binding, SUBFAMIL potassium ion transport, transport, oxidoreductase activity, potassium Y, BETA ion binding, transporter activity, MEMBER 1 voltage-gated ion channel activity, 22878 KIAA1012 Golgi apparatus, Golgi cis-face, ER to Golgi vesicle-mediated transport, binding, intracellular transporter sequence conflict, 47
    • Golgi vesicle transport, cell organization and biogenesis, cellular localization, Golgi stack, cell, cytoplasm, cellular physiological process, cellular intracellular, intracellular process, establishment of cellular membrane-bound organelle, localization, establishment of localization, activity, transporter activity, splice variant, intracellular organelle, intracellular transport, localization, membrane-bound organelle, physiological process, secretion, secretory organelle, pathway, transport, vesicle-mediated transport, cell communication, cellular metabolism, cellular physiological process, cellular process, defense response, development, immune response, inflammatory response, metabolism, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, organismal physiological process, DNA binding, binding, cation physiological process, primary binding, glucocorticoid receptor NUCLEAR metabolism, regulation of biological activity, ion binding, ligand- DNA-binding cell, cytoplasm, intracellular, RECEPTOR process, regulation of cellular metabolism, dependent nuclear receptor activity, region:Nuclear intracellular membrane-bound SUBFAMIL regulation of cellular physiological lipid binding, metal ion binding, receptor, cross- organelle, intracellular Y 3, process, regulation of cellular process, nucleic acid binding, protein binding, link:Glycyl lysine organelle, membrane-bound GROUP C, regulation of metabolism, regulation of receptor activity, sequence-specific isopeptide (Lys-Gly) 2908 organelle, membrane-enclosed MEMBER 1 nucleobase, nucleoside, nucleotide and DNA binding, signal transducer (interchain with G-Cter lumen, mitochondrial lumen, (GLUCOCO nucleic acid metabolism, regulation of activity, steroid binding, steroid in SUMO), mitochondrial matrix, RTICOID physiological process, regulation of hormone receptor activity, mutagenesis site, splice mitochondrion, nucleus, RECEPTOR transcription, regulation of transcription, transcription factor activity, variant, zinc finger organelle, organelle lumen, ) DNA-dependent, response to biotic transcription regulator activity, region:NR C4-type, stimulus, response to external stimulus, transition metal ion binding, zinc ion response to other organism, response to binding, pest, pathogen or parasite, response to stimulus, response to stress, response to wounding, sex determination, signal transduction, transcription, transcription from RNA polymerase II promoter, transcription, DNA-dependent, 48
    • DNA metabolism, DNA repair, DNA replication, biopolymer metabolism, cell cycle, cell proliferation, cellular metabolism, cellular physiological process, cellular process, macromolecule metabolism, metabolism, negative regulation of biological process, negative regulation of cell proliferation, negative regulation of cellular physiological process, negative regulation of cellular process, negative regulation of modified residue, cell, intracellular, intracellular physiological process, nucleobase, repeat:WD 1, RETINOBL membrane-bound organelle, nucleoside, nucleotide and nucleic acid repeat:WD 2, ASTOMA 5928 intracellular organelle, metabolism, physiological process, binding, protein binding, repeat:WD 3, BINDING membrane-bound organelle, primary metabolism, regulation of repeat:WD 4, PROTEIN 4 nucleus, organelle, biological process, regulation of cell repeat:WD 5, proliferation, regulation of cellular repeat:WD 6, metabolism, regulation of cellular physiological process, regulation of cellular process, regulation of metabolism, regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, regulation of physiological process, regulation of transcription, regulation of transcription, DNA-dependent, response to DNA damage stimulus, response to endogenous stimulus, response to stimulu 285190 RAN cell, endomembrane system, cell organization and biogenesis, cellular GTPase binding, Ran GTPase domain:PPIase BINDING envelope, integral to membrane, localization, cellular macromolecule binding, binding, catalytic activity, cyclophilin-type, PROTEIN 2 intracellular, intracellular metabolism, cellular metabolism, cellular cation binding, cis-trans isomerase domain:RanBD1 1, membrane-bound organelle, physiological process, cellular process, activity, enzyme binding, ion domain:RanBD1 2, intracellular organelle, intrinsic cellular protein metabolism, establishment binding, isomerase activity, metal ion domain:RanBD1 3, to membrane, membrane, of cellular localization, establishment of binding, peptidyl-prolyl cis-trans domain:RanBD1 4, membrane-bound organelle, localization, establishment of protein isomerase activity, protein binding, repeat:TPR, zinc finger nuclear envelope, nuclear pore, localization, intracellular protein transport, small GTPase binding, transition region:RanBP2-type 1, 49
    • zinc finger region:RanBP2-type 2, zinc finger intracellular transport, localization, region:RanBP2-type 3, macromolecule metabolism, metabolism, zinc finger nuclear import, nuclear transport, region:RanBP2-type 4, nucleus, organelle, organelle nucleocytoplasmic transport, physiological zinc finger envelope, pore complex, protein process, primary metabolism, protein metal ion binding, zinc ion binding, region:RanBP2-type 5, complex, folding, protein import, protein import into zinc finger nucleus, protein localization, protein region:RanBP2-type 6, metabolism, protein targeting, protein zinc finger transport, transport, region:RanBP2-type 7, zinc finger region:RanBP2-type 8, 5903 RAN cell, endomembrane system, cell organization and biogenesis, cellular GTPase binding, Ran GTPase domain:PPIase BINDING envelope, integral to membrane, localization, cellular macromolecule binding, binding, catalytic activity, cyclophilin-type, PROTEIN 2 intracellular, intracellular metabolism, cellular metabolism, cellular cation binding, cis-trans isomerase domain:RanBD1 1, membrane-bound organelle, physiological process, cellular process, activity, enzyme binding, ion domain:RanBD1 2, intracellular organelle, intrinsic cellular protein metabolism, establishment binding, isomerase activity, metal ion domain:RanBD1 3, to membrane, membrane, of cellular localization, establishment of binding, peptidyl-prolyl cis-trans domain:RanBD1 4, membrane-bound organelle, localization, establishment of protein isomerase activity, protein binding, repeat:TPR, zinc finger nuclear envelope, nuclear pore, localization, intracellular protein transport, small GTPase binding, transition region:RanBP2-type 1, nucleus, organelle, organelle intracellular transport, localization, metal ion binding, zinc ion binding, zinc finger envelope, pore complex, protein macromolecule metabolism, metabolism, region:RanBP2-type 2, complex, nuclear import, nuclear transport, zinc finger nucleocytoplasmic transport, physiological region:RanBP2-type 3, process, primary metabolism, protein zinc finger folding, protein import, protein import into region:RanBP2-type 4, nucleus, protein localization, protein zinc finger metabolism, protein targeting, protein region:RanBP2-type 5, transport, transport, zinc finger region:RanBP2-type 6, zinc finger region:RanBP2-type 7, zinc finger 50
    • region:RanBP2-type 8, RNA metabolism, RNA processing, RNA splicing, RNA splicing, via transesterification reactions, RNA splicing, via transesterification reactions with bulged adenosine as nucleophile, biological process unknown, biopolymer metabolism, cellular metabolism, cellular physiological process, cellular process, cell, cytoplasm, intracellular, mRNA metabolism, mRNA processing, intracellular membrane-bound RNA binding, RNA polymerase II macromolecule metabolism, metabolism, organelle, intracellular non- transcription factor activity, binding, nuclear mRNA splicing, via spliceosome, membrane-bound organelle, cation binding, ion binding, metal ion nucleobase, nucleoside, nucleotide and intracellular organelle, binding, nucleic acid binding, protein domain:KH, nucleic acid metabolism, physiological SPLICING membrane-bound organelle, binding, transcription cofactor mutagenesis site, splice 7536 process, primary metabolism, protein FACTOR 1 non-membrane-bound activity, transcription corepressor variant, zinc finger complex assembly, protein metabolism, organelle, nucleus, organelle, activity, transcription factor binding, region:CCHC-type, regulation of biological process, regulation protein complex, transcription regulator activity, of cellular metabolism, regulation of ribonucleoprotein complex, transition metal ion binding, zinc ion cellular physiological process, regulation ribosome, spliceosome binding, of cellular process, regulation of complex, metabolism, regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, regulation of physiological process, regulation of transcription, regulation of transcription, DNA- dependent, spliceosome assembly, transcription, transcription, DNA- dependent, 4781 NUCLEAR cell, intracellular, intracellular DNA metabolism, DNA replication, DNA binding, binding, nucleic acid DNA-binding FACTOR I/ membrane-bound organelle, biopolymer metabolism, cellular binding, transcription factor activity, region:CTF/NF-I, B intracellular organelle, metabolism, cellular physiological process, transcription regulator activity, splice variant, membrane-bound organelle, cellular process, macromolecule nucleus, organelle, metabolism, metabolism, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, physiological process, 51
    • primary metabolism, regulation of biological process, regulation of cellular metabolism, regulation of cellular physiological process, regulation of cellular process, regulation of metabolism, regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, regulation of physiological process, regulation of transcription, regulation of transcription, DNA-dependent, transcription, transcription, DNA- dependent, 477 ATPASE, cell, integral to membrane, cation homeostasis, cation transport, cell ATP binding, ATPase activity, active site:4- NA+/K+ integral to plasma membrane, homeostasis, cell ion homeostasis, cell ATPase activity, coupled, ATPase aspartylphosphate TRANSPOR intrinsic to membrane, intrinsic motility, cellular physiological process, activity, coupled to movement of intermediate, metal TING, to plasma membrane, cellular process, establishment of substances, ATPase activity, coupled ion-binding ALPHA 2 membrane, plasma membrane, localization, homeostasis, hydrogen ion to transmembrane movement of ions, site:Magnesium, (+) protein complex, homeostasis, hydrogen transport, ion ATPase activity, coupled to transmembrane region, POLYPEPTI sodium:potassium-exchanging homeostasis, ion transport, localization, transmembrane movement of ions, DE ATPase complex, localization of cell, locomotion, phosphorylative mechanism, ATPase metabolism, metal ion transport, activity, coupled to transmembrane monovalent inorganic cation homeostasis, movement of substances, P-P-bond- monovalent inorganic cation transport, hydrolysis-driven transporter activity, physiological process, potassium ion adenyl nucleotide binding, alkali transport, proton transport, sodium ion metal ion binding, binding, carrier transport, sperm motility, transport, activity, catalytic activity, cation binding, cation transporter activity, hydrolase activity, hydrolase activity, acting on acid anhydrides, hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances, hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides, ion binding, ion transporter activity, 52
    • magnesium ion binding, metal ion binding, monovalent inorganic cation transporter activity, nucleoside- triphosphatase activity, nucleotide binding, potassium ion binding, primary active transporter activity, purine nucleoti SEMA cell communication, cell surface receptor DOMAIN, linked signal transduction, cellular process, IMMUNOG defense response, development, enzyme LOBULIN linked receptor protein signaling pathway, disulfide bond, DOMAIN immune response, organismal domain:Ig-like C2- (IG), physiological process, physiological type, domain:Sema, 10512 SHORT Null Null process, response to abiotic stimulus, glycosylation site:N- BASIC response to biotic stimulus, response to linked (GlcNAc...), DOMAIN, chemical stimulus, response to drug, signal peptide, SECRETED response to stimulus, signal transduction, , transmembrane receptor protein tyrosine (SEMAPHO kinase signaling pathway, RIN) 3C 3400 INHIBITOR cell, intracellular, intracellular cellular metabolism, cellular physiological binding, protein binding, domain:Helix-loop- OF DNA membrane-bound organelle, process, cellular process, metabolism, transcription cofactor activity, helix motif, BINDING 4, intracellular organelle, nucleobase, nucleoside, nucleotide and transcription corepressor activity, DOMINAN membrane-bound organelle, nucleic acid metabolism, physiological transcription factor binding, T nucleus, organelle, process, primary metabolism, regulation of transcription regulator activity, NEGATIVE biological process, regulation of cellular HELIX- metabolism, regulation of cellular LOOP- physiological process, regulation of HELIX cellular process, regulation of metabolism, PROTEIN regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, regulation of physiological process, regulation of transcription, regulation of transcription from RNA polymerase II promoter, regulation of transcription, 53
    • DNA-dependent, transcription, transcription from RNA polymerase II promoter, transcription, DNA-dependent, cell communication, cellular metabolism, cellular physiological process, cellular process, intracellular signaling cascade, metabolism, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, physiological process, primary metabolism, regulation of biological RAB, process, regulation of cellular metabolism, ATP binding, DNA binding, GTP MEMBER regulation of cellular physiological binding, adenyl nucleotide binding, OF RAS 285282 Null process, regulation of cellular process, binding, guanyl nucleotide binding, Null ONCOGEN regulation of metabolism, regulation of nucleic acid binding, nucleotide E FAMILY- nucleobase, nucleoside, nucleotide and binding, purine nucleotide binding, LIKE 3 nucleic acid metabolism, regulation of physiological process, regulation of transcription, regulation of transcription, DNA-dependent, signal transduction, small GTPase mediated signal transduction, transcription, transcription, DNA-dependent, YTH DOMAIN 253943 Null Null Null Null FAMILY, MEMBER 3 BAT2 DOMAIN 23215 Null Null Null Null CONTAINI NG 1 3991 LIPASE, Null alcohol metabolism, biopolymer carboxylic ester hydrolase activity, modified residue, HORMONE metabolism, biopolymer modification, catalytic activity, hydrolase activity, splice variant, - carboxylic acid metabolism, catabolism, hydrolase activity, acting on ester SENSITIVE cellular lipid metabolism, cellular bonds, lipase activity, macromolecule metabolism, cellular 54
    • metabolism, cellular physiological process, cellular process, cellular protein metabolism, cholesterol metabolism, fatty acid metabolism, generation of precursor metabolites and energy, lipid catabolism, lipid metabolism, macromolecule metabolism, metabolism, organic acid metabolism, phosphate metabolism, phosphorus metabolism, phosphorylation, physiological process, primary metabolism, protein amino acid phosphorylation, protein metabolism, protein modification, steroid metabolism, sterol metabolism, G-protein coupled receptor protein signaling pathway, cell communication, cell cycle, cell surface receptor linked signal transduction, cellular physiological process, cellular process, enzyme linked REGULAT receptor protein signaling pathway, GTPase activator activity, GTPase OR OF G- negative regulation of biological process, regulator activity, binding, PROTEIN negative regulation of cellular process, calmodulin binding, enzyme activator 5997 Null domain:RGS, SIGNALLI negative regulation of signal transduction, activity, enzyme regulator activity, NG 2, physiological process, regulation of G- protein binding, signal transducer 24KDA protein coupled receptor protein signaling activity, pathway, regulation of biological process, regulation of cellular process, regulation of signal transduction, signal transduction, transmembrane receptor protein tyrosine kinase signaling pathway, 10079 ATPASE, cell, integral to membrane, cation transport, cellular physiological ATP binding, ATPase activity, active site:4- CLASS II, intrinsic to membrane, process, cellular process, establishment of ATPase activity, coupled, ATPase aspartylphosphate TYPE 9A membrane, localization, ion transport, localization, activity, coupled to movement of intermediate, metal metabolism, physiological process, substances, ATPase activity, coupled ion-binding transport, to transmembrane movement of ions, site:Magnesium, splice 55
    • ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATPase activity, coupled to transmembrane movement of substances, P-P-bond- hydrolysis-driven transporter activity, adenyl nucleotide binding, aminophospholipid transporter activity, binding, carrier activity, catalytic activity, cation transporter activity, hydrolase activity, hydrolase activity, acting on acid anhydrides, hydrolase activity, acting on acid variant, transmembrane anhydrides, catalyzing region, transmembrane movement of substances, hydrolase activity, acting on acid anhydrides, in phosphorus- containing anhydrides, ion binding, ion transporter activity, lipid transporter activity, magnesium ion binding, metal ion binding, nucleoside-triphosphatase activity, nucleotide binding, phospholipid transporter activity, phospholipid- translocating ATPase activity, primary active trans 5955 RETICULO cell, cytoplasm, endoplasmic Null binding, calcium ion binding, cation calcium-binding CALBIN 2, reticulum, intracellular, binding, ion binding, metal ion region:1, calcium- EF-HAND intracellular membrane-bound binding, protein binding, binding region:2, CALCIUM organelle, intracellular calcium-binding BINDING organelle, membrane-bound region:3; possibly DOMAIN organelle, organelle, ancestral, calcium- binding region:4, calcium-binding region:5, calcium- 56
    • binding region:6, domain:EF-hand 1, domain:EF-hand 2, domain:EF-hand 3, domain:EF-hand 4, domain:EF-hand 5, domain:EF-hand 6, signal peptide, PROTEIN TYROSINE PHOSPHAT ASE-LIKE (PROLINE INSTEAD 201562 Null Null binding, protein binding, Null OF CATALYTI C ARGININE) , MEMBER B RNA metabolism, RNA processing, RNA splicing, RNA splicing, via transesterification reactions, RNA splicing, via transesterification reactions with bulged adenosine as nucleophile, cell, intracellular, intracellular YTH biopolymer metabolism, cellular membrane-bound organelle, DOMAIN metabolism, cellular physiological process, domain:YTH, splice 91746 intracellular organelle, Null CONTAINI cellular process, mRNA metabolism, variant, membrane-bound organelle, NG 1 mRNA processing, macromolecule nucleus, organelle, metabolism, metabolism, nuclear mRNA splicing, via spliceosome, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, physiological process, primary metabolism, 8019 BROMODO cell, intracellular, intracellular biological process unknown, molecular function unknown, domain:Bromo 1, 57
    • membrane-bound organelle, MAIN intracellular organelle, domain:Bromo 2, CONTAINI membrane-bound organelle, splice variant, NG 3 nucleus, organelle, DNA metabolism, DNA packaging, biopolymer metabolism, cell organization and biogenesis, cellular metabolism, cellular physiological process, cellular cell, chromatin, chromosome, process, chromatin assembly, chromatin intracellular, intracellular assembly or disassembly, chromosome membrane-bound organelle, H2A organization and biogenesis, chromosome intracellular non-membrane- HISTONE organization and biogenesis (sensu bound organelle, intracellular DNA binding, binding, nucleic acid 94239 FAMILY, Eukaryota), establishment and/or Null organelle, membrane-bound binding, MEMBER maintenance of chromatin architecture, organelle, non-membrane- V macromolecule metabolism, metabolism, bound organelle, nucleosome, nucleobase, nucleoside, nucleotide and nucleus, organelle, protein nucleic acid metabolism, nucleosome complex, assembly, organelle organization and biogenesis, physiological process, primary metabolism, protein complex assembly, protein metabolism, alcohol metabolism, cellular lipid metabolism, cellular metabolism, cellular OXYSTER physiological process, cellular process, zinc finger OL- cholesterol metabolism, establishment of region:C2H2-type 1, BINDING localization, lipid metabolism, lipid binding, lipid binding, phospholipid zinc finger 114876 cell, intracellular, PROTEIN- transport, localization, metabolism, binding, region:C2H2-type 2, RELATED physiological process, primary zinc finger PROTEIN 1 metabolism, steroid metabolism, sterol region:C2H2-type 3, metabolism, transport, vesicle-mediated transport, 5649 REELIN extracellular matrix, cell adhesion, cellular process, binding, catalytic activity, disulfide bond, extracellular matrix (sensu development, endopeptidase activity, hydrolase domain:EGF-like 1, Metazoa), extracellular region, activity, peptidase activity, protein domain:EGF-like 2, extracellular space, binding, serine-type endopeptidase domain:EGF-like 3, 58
    • domain:EGF-like 4, domain:EGF-like 5, domain:EGF-like 6, domain:EGF-like 7, domain:EGF-like 8, domain:Reelin, glycosylation site:N- linked (GlcNAc...), repeat:BNR 1, repeat:BNR 10, repeat:BNR 11, activity, serine-type peptidase repeat:BNR 12, activity, repeat:BNR 13, repeat:BNR 14, repeat:BNR 15, repeat:BNR 2, repeat:BNR 3, repeat:BNR 4, repeat:BNR 5, repeat:BNR 6, repeat:BNR 7, repeat:BNR 8, repeat:BNR 9, signal peptide, splice variant, 6638 SMALL cell, cellular component RNA metabolism, RNA processing, RNA binding, binding, molecular Null NUCLEAR unknown, intracellular, biological process unknown, biopolymer function unknown, nucleic acid RIBONUCL intracellular membrane-bound metabolism, cellular metabolism, cellular binding, EOPROTEI organelle, intracellular non- physiological process, cellular process, N membrane-bound organelle, mRNA metabolism, mRNA processing, POLYPEPTI intracellular organelle, macromolecule metabolism, metabolism, DE N membrane-bound organelle, nucleobase, nucleoside, nucleotide and membrane-enclosed lumen, nucleic acid metabolism, physiological non-membrane-bound process, primary metabolism, organelle, nuclear lumen, nucleolus, nucleus, organelle, 59
    • organelle lumen, protein complex, ribonucleoprotein complex, small nucleolar ribonucleoprotein complex, cell, cellular component unknown, intracellular, intracellular membrane-bound organelle, intracellular non- RNA metabolism, RNA processing, SMALL membrane-bound organelle, biological process unknown, biopolymer NUCLEAR intracellular organelle, metabolism, cellular metabolism, cellular RIBONUCL membrane-bound organelle, physiological process, cellular process, RNA binding, binding, molecular 8926 EOPROTEI membrane-enclosed lumen, mRNA metabolism, mRNA processing, function unknown, nucleic acid Null N non-membrane-bound macromolecule metabolism, metabolism, binding, POLYPEPTI organelle, nuclear lumen, nucleobase, nucleoside, nucleotide and DE N nucleolus, nucleus, organelle, nucleic acid metabolism, physiological organelle lumen, protein process, primary metabolism, complex, ribonucleoprotein complex, small nucleolar ribonucleoprotein complex, EUKARYO biosynthesis, cellular biosynthesis, cellular TIC macromolecule metabolism, cellular TRANSLAT metabolism, cellular physiological process, binding, nucleic acid binding, protein ION cellular process, cellular protein binding, translation factor activity, 3646 INITIATIO Null metabolism, macromolecule biosynthesis, nucleic acid binding, translation domain:PCI, N FACTOR macromolecule metabolism, metabolism, initiation factor activity, translation 3, physiological process, primary regulator activity, SUBUNIT 6 metabolism, protein biosynthesis, protein 48KDA metabolism, 129642 O- Null Null Null Null ACYLTRA NSFERASE (MEMBRA NE BOUND) DOMAIN 60
    • CONTAINI NG 2 cell differentiation, cell growth, cell organization and biogenesis, cell CYSTEINE cell, intracellular, intracellular proliferation, cellular morphogenesis, binding, cation binding, ion binding, AND membrane-bound organelle, cellular physiological process, cellular domain:LIM zinc- metal ion binding, molecular function 1466 GLYCINE- intracellular organelle, process, development, growth, binding 1, domain:LIM unknown, transition metal ion RICH membrane-bound organelle, morphogenesis, muscle development, zinc-binding 2, binding, zinc ion binding, PROTEIN 2 nucleus, organelle, organ development, organ morphogenesis, physiological process, regulation of cell size, ATP binding, adenyl nucleotide binding, binding, cAMP-dependent biopolymer metabolism, biopolymer protein kinase activity, catalytic modification, cell communication, cell activity, cation binding, cyclic surface receptor linked signal transduction, nucleotide-dependent protein kinase cellular macromolecule metabolism, activity, ion binding, kinase activity, cellular metabolism, cellular physiological magnesium ion binding, manganese active site:Proton BONE process, cellular process, cellular protein ion binding, metal ion binding, acceptor, binding MORPHOG metabolism, development, enzyme linked nucleotide binding, site:ATP, ENETIC cell, integral to membrane, receptor protein signaling pathway, phosphotransferase activity, alcohol domain:Protein kinase, PROTEIN integral to plasma membrane, macromolecule metabolism, metabolism, group as acceptor, protein binding, glycosylation site:N- 659 RECEPTOR intrinsic to membrane, intrinsic organ development, phosphate protein kinase CK2 activity, protein linked (GlcNAc...), , TYPE II to plasma membrane, metabolism, phosphorus metabolism, kinase activity, protein nucleotide phosphate- (SERINE/T membrane, plasma membrane, phosphorylation, physiological process, serine/threonine kinase activity, binding region:ATP, HREONINE primary metabolism, protein amino acid purine nucleotide binding, receptor signal peptide, KINASE) phosphorylation, protein metabolism, activity, signal transducer activity, transmembrane region, protein modification, signal transduction, transferase activity, transferase skeletal development, transmembrane activity, transferring phosphorus- receptor protein serine/threonine kinase containing groups, transforming signaling pathway, growth factor beta receptor activity, transition metal ion binding, transmembrane receptor activity, 2982 GUANYLA guanylate cyclase complex, biosynthesis, cGMP biosynthesis, cGMP catalytic activity, cyclase activity, domain:Guanylate TE soluble, protein complex, metabolism, cell communication, cellular guanylate cyclase activity, lyase cyclase, 61
    • biosynthesis, cellular metabolism, cellular physiological process, cellular process, circulation, cyclic nucleotide biosynthesis, cyclic nucleotide metabolism, intracellular CYCLASE signaling cascade, metabolism, nitric oxide activity, obsolete molecular function, 1, mediated signal transduction, nucleobase, receptor activity, receptor guanylate unlocalized protein complex, SOLUBLE, nucleoside, nucleotide and nucleic acid cyclase activity, signal transducer ALPHA 3 metabolism, nucleotide biosynthesis, activity, nucleotide metabolism, organismal physiological process, physiological process, primary metabolism, signal transduction, 4548 5- cell, intracellular, amine biosynthesis, amine metabolism, 5-methyltetrahydrofolate-dependent domain:AdoMet METHYLT amino acid and derivative metabolism, methyltransferase activity, S- activation, ETRAHYD amino acid biosynthesis, amino acid adenosylmethionine-dependent domain:B12-binding, ROFOLATE metabolism, aromatic compound methyltransferase activity, S- domain:Hcy-binding, - metabolism, aspartate family amino acid methyltransferase activity, binding, domain:Pterin-binding, HOMOCYS biosynthesis, aspartate family amino acid catalytic activity, cation binding, metal ion-binding TEINE metabolism, biosynthesis, carboxylic acid cobalamin binding, cobalt ion site:Cobalt (cobalamin METHYLT metabolism, cellular biosynthesis, cellular binding, dihydropteroate synthase axial ligand), RANSFERA metabolism, cellular physiological process, activity, homocysteine S- SE cellular process, central nervous system methyltransferase activity, ion development, coenzyme biosynthesis, binding, metal ion binding, coenzyme metabolism, cofactor methionine synthase activity, biosynthesis, cofactor metabolism, methyltransferase activity, transferase development, folic acid and derivative activity, transferase activity, biosynthesis, folic acid and derivative transferring alkyl or aryl (other than metabolism, heterocycle metabolism, methyl) groups, transferase activity, metabolism, methionine biosynthesis, transferring one-carbon groups, methionine metabolism, nervous system transition metal ion binding, vitamin development, nitrogen compound binding, biosynthesis, nitrogen compound metabolism, organic acid metabolism, physiological process, primary metabolism, sulfur amino acid 62
    • biosynthesis, sulfur amino acid metabolism, sulfur compound biosynthesis, sulfur metabolism, system development, 5789 PROTEIN cell, integral to membrane, biopolymer metabolism, biopolymer binding, catalytic activity, hydrolase active TYROSINE integral to plasma membrane, modification, cell adhesion, cell activity, hydrolase activity, acting on site:Phosphocysteine PHOSPHAT intrinsic to membrane, intrinsic communication, cell surface receptor ester bonds, phosphoprotein intermediate, disulfide ASE, to plasma membrane, linked signal transduction, cellular phosphatase activity, phosphoric ester bond, RECEPTOR membrane, plasma membrane, macromolecule metabolism, cellular hydrolase activity, phosphoric domain:Fibronectin TYPE, D metabolism, cellular physiological process, monoester hydrolase activity, type-III 1, cellular process, cellular protein prenylated protein tyrosine domain:Fibronectin metabolism, dephosphorylation, enzyme phosphatase activity, protein binding, type-III 2, linked receptor protein signaling pathway, protein tyrosine phosphatase activity, domain:Fibronectin macromolecule metabolism, metabolism, receptor activity, signal transducer type-III 3, phosphate metabolism, phosphorus activity, transmembrane receptor domain:Fibronectin metabolism, physiological process, activity, transmembrane receptor type-III 4, primary metabolism, protein amino acid protein phosphatase activity, domain:Fibronectin dephosphorylation, protein metabolism, type-III 5, protein modification, signal transduction, domain:Fibronectin transmembrane receptor protein tyrosine type-III 6, phosphatase signaling pathway, domain:Fibronectin type-III 7, domain:Fibronectin type-III 8, domain:Ig- like C2-type 1, domain:Ig-like C2-type 2, domain:Ig-like C2- type 3, domain:Tyrosine- protein phosphatase 1, domain:Tyrosine- protein phosphatase 2, glycosylation site:N- linked (GlcNAc...), mutagenesis site, signal 63
    • peptide, site:Cleavage, splice variant, transmembrane region, 5802 PROTEIN cell, integral to membrane, biopolymer metabolism, biopolymer binding, catalytic activity, hydrolase active TYROSINE integral to plasma membrane, modification, cell adhesion, cell activity, hydrolase activity, acting on site:Phosphocysteine PHOSPHAT intrinsic to membrane, intrinsic communication, cell surface receptor ester bonds, phosphoprotein intermediate, disulfide ASE, to plasma membrane, linked signal transduction, cellular phosphatase activity, phosphoric ester bond, RECEPTOR membrane, plasma membrane, macromolecule metabolism, cellular hydrolase activity, phosphoric domain:Fibronectin TYPE, D metabolism, cellular physiological process, monoester hydrolase activity, type-III 1, cellular process, cellular protein prenylated protein tyrosine domain:Fibronectin metabolism, dephosphorylation, enzyme phosphatase activity, protein binding, type-III 2, linked receptor protein signaling pathway, protein tyrosine phosphatase activity, domain:Fibronectin macromolecule metabolism, metabolism, receptor activity, signal transducer type-III 3, phosphate metabolism, phosphorus activity, transmembrane receptor domain:Fibronectin metabolism, physiological process, activity, transmembrane receptor type-III 4, primary metabolism, protein amino acid protein phosphatase activity, domain:Fibronectin dephosphorylation, protein metabolism, type-III 5, protein modification, signal transduction, domain:Fibronectin transmembrane receptor protein tyrosine type-III 6, phosphatase signaling pathway, domain:Fibronectin type-III 7, domain:Fibronectin type-III 8, domain:Ig- like C2-type 1, domain:Ig-like C2-type 2, domain:Ig-like C2- type 3, domain:Tyrosine- protein phosphatase 1, domain:Tyrosine- protein phosphatase 2, glycosylation site:N- linked (GlcNAc...), mutagenesis site, signal peptide, site:Cleavage, 64
    • splice variant, transmembrane region, cell cycle, cell proliferation, cellular metabolism, cellular physiological process, cellular process, metabolism, negative regulation of biological process, negative regulation of cellular metabolism, negative regulation of cellular physiological process, negative regulation of cellular process, negative regulation of metabolism, negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, negative ZINC cell, intracellular, intracellular regulation of physiological process, DNA binding, binding, cation domain:Bromo, FINGER, membrane-bound organelle, negative regulation of progression through binding, ion binding, metal ion domain:PWWP, zinc MYND 10771 intracellular organelle, cell cycle, negative regulation of binding, nucleic acid binding, protein finger region:MYND- DOMAIN membrane-bound organelle, transcription, negative regulation of binding, transition metal ion binding, type, zinc finger CONTAINI nucleus, organelle, transcription from RNA polymerase II zinc ion binding, region:PHD-type, NG 11 promoter, negative regulation of transcription, DNA-dependent, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, physiological process, primary metabolism, regulation of biological process, regulation of cell cycle, regulation of cellular metabolism, regulation of cellular physiological process, regulation of cellular process, regulation of metabolism, regulation of nucleobase, nucleoside 667 DYSTONIN basal part of cell, basal plasma actin cytoskeleton organization and actin binding, actin filament binding, calcium-binding membrane, basement biogenesis, actin filament-based process, binding, calcium ion binding, cation region:1, calcium- membrane, basolateral plasma cell adhesion, cell communication, cell binding, cytoskeletal protein binding, binding region:2, membrane, cell, cell junction, cycle, cell cycle arrest, cell organization integrin binding, ion binding, metal domain:Actin-binding, cell-matrix junction, cytoplasm, and biogenesis, cell surface receptor linked ion binding, protein C-terminus domain:CH 1, cytoplasmic membrane-bound signal transduction, cellular physiological binding, protein binding, receptor domain:CH 2, 65
    • vesicle, cytoplasmic vesicle, process, cellular process, cytoskeleton binding, signal transducer activity, domain:EF-hand 1, cytoskeleton, extracellular organization and biogenesis, integrin- structural constituent of cytoskeleton, domain:EF-hand 2, matrix, extracellular matrix mediated signaling pathway, intermediate structural molecule activity, domain:SH3, (sensu Metazoa), extracellular filament cytoskeleton organization and glycosylation site:N- region, extracellular space, biogenesis, intermediate filament-based linked (GlcNAc...), hemidesmosome, intercellular process, negative regulation of biological repeat:Plectin 1, junction, intracellular, process, negative regulation of cellular repeat:Plectin 10, intracellular membrane-bound physiological process, negative regulation repeat:Plectin 11, organelle, intracellular non- of cellular process, negative regulation of repeat:Plectin 2, membrane-bound organelle, physiological process, negative regulation repeat:Plectin 3, intracellular organelle, of progression through cell cycle, repeat:Plectin 4, membrane, membrane-bound organelle organization and biogenesis, repeat:Plectin 5, organelle, membrane-bound physiological process, regulation of repeat:Plectin 6, vesicle, non-membrane-bound biological process, regulation of cell cycle, repeat:Plectin 7, organelle, organelle, plasma regulation of cellular physiological repeat:Plectin 8, membrane, vesicle, process, regulation of cellular process, repeat:Plectin 9, regulation of physiological process, repeat:Spectrin 1, regulation of progression through cell repeat:Spectrin 10, cycle, signal transduction, repeat:Spectrin 11, repeat:Spectrin 12, repeat:Spectrin 13, repeat:Spectrin 14, repeat:Spectrin 15, repeat:Spectrin 16, repeat:Spectrin 17, repeat:Spectrin 18, repeat:Spectrin 19, repeat:Spectrin 2, repeat:Spectrin 20, repeat:Spectrin 21, repeat:Spectrin 22, repeat:Spectrin 23, repeat:Spectrin 24, repeat:Spectrin 25, repeat:Spectrin 26, 66
    • repeat:Spectrin 27, repeat:Spectrin 28, repeat:Spectrin 29, repeat:Spectrin 3, repeat:Spectrin 4, repeat:Spectrin 5, repeat:Spectrin 6, repeat:Spectrin 7, repeat:Spectrin 8, repeat:Spectrin 9, splice variant, cell, cytoplasm, endoplasmic reticulum, intracellular, repeat:TPR 1, intracellular membrane-bound 9694 KIAA0103 Null binding, repeat:TPR 2, organelle, intracellular repeat:TPR 3, organelle, membrane-bound organelle, nucleus, organelle, biopolymer metabolism, biopolymer ATP binding, adenyl nucleotide modification, cellular macromolecule binding, binding, catalytic activity, metabolism, cellular metabolism, cellular kinase activity, molecular function physiological process, cellular process, unknown, nucleotide binding, cellular protein metabolism, chromosome active site:Proton RIO phosphotransferase activity, alcohol segregation, macromolecule metabolism, acceptor, binding 8780 KINASE 3 Null group as acceptor, protein kinase metabolism, phosphate metabolism, site:ATP, splice (YEAST) activity, protein serine/threonine phosphorus metabolism, phosphorylation, variant, kinase activity, purine nucleotide physiological process, primary binding, transferase activity, metabolism, protein amino acid transferase activity, transferring phosphorylation, protein metabolism, phosphorus-containing groups, protein modification, 5434 POLYMER DNA-directed RNA polymerase cellular metabolism, cellular physiological DNA binding, DNA-directed RNA Null ASE (RNA) II, core complex, DNA-directed process, cellular process, metabolism, polymerase I activity, DNA-directed II (DNA RNA polymerase II, nucleobase, nucleoside, nucleotide and RNA polymerase II activity, DNA- DIRECTED) holoenzyme, RNA polymerase nucleic acid metabolism, physiological directed RNA polymerase III activity, POLYPEPTI complex, cell, intracellular, process, primary metabolism, DNA-directed RNA polymerase DE E, intracellular membrane-bound transcription, transcription from RNA activity, binding, catalytic activity, 67
    • organelle, intracellular nucleic acid binding, organelle, membrane-bound nucleotidyltransferase activity, organelle, membrane-enclosed polymerase II promoter, transcription, obsolete molecular function, protein 25KDA lumen, nuclear lumen, DNA-dependent, binding, transferase activity, nucleoplasm, nucleus, organelle, transferase activity, transferring organelle lumen, protein phosphorus-containing groups, complex, cellular metabolism, cellular physiological process, cellular process, development, metabolism, negative regulation of biological process, negative regulation of cellular metabolism, negative regulation of cellular physiological process, negative regulation of cellular process, negative regulation of metabolism, negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, negative regulation of physiological binding, cation binding, ion binding, cell, cytoplasm, intracellular, process, negative regulation of FETAL metal ion binding, protein binding, intracellular membrane-bound transcription, negative regulation of domain:DDT, zinc ALZHEIME transcription factor binding, 2186 organelle, intracellular transcription from RNA polymerase II finger region:PHD- R transcription regulator activity, organelle, membrane-bound promoter, negative regulation of type, ANTIGEN transition metal ion binding, zinc ion organelle, nucleus, organelle, transcription, DNA-dependent, nervous binding, system development, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, physiological process, primary metabolism, regulation of biological process, regulation of cellular metabolism, regulation of cellular physiological process, regulation of cellular process, regulation of metabolism, regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolism, regulation of physiological pr 56969 SPECTRIN, actin cytoskeleton, cell, cell actin cytoskeleton organization and actin binding, binding, calmodulin domain:Actin-binding, 68
    • biogenesis, actin filament capping, actin filament depolymerization, actin filament- based process, actin polymerization and/or domain:CH 1, depolymerization, barbed-end actin domain:CH 2, filament capping, cell organization and domain:PH, biogenesis, cellular macromolecule repeat:Spectrin 1, metabolism, cellular metabolism, cellular repeat:Spectrin 10, physiological process, cellular process, repeat:Spectrin 11, cellular protein metabolism, cytoskeleton cortex, cortical actin repeat:Spectrin 12, organization and biogenesis, cytoskeleton, cortical repeat:Spectrin 13, macromolecule metabolism, metabolism, cytoskeleton, cytoplasm, repeat:Spectrin 14, BETA, negative regulation of actin filament binding, cytoskeletal protein binding, cytoskeleton, intracellular, repeat:Spectrin 15, NON- depolymerization, negative regulation of protein binding, structural constituent intracellular non-membrane- repeat:Spectrin 16, ERYTHRO biological process, negative regulation of of cytoskeleton, structural molecule bound organelle, intracellular repeat:Spectrin 17, CYTIC 1 cell organization and biogenesis, negative activity, organelle, membrane, non- repeat:Spectrin 2, regulation of cellular physiological membrane-bound organelle, repeat:Spectrin 3, process, negative regulation of cellular organelle, spectrin, repeat:Spectrin 4, process, negative regulation of repeat:Spectrin 5, metabolism, negative regulation of repeat:Spectrin 6, physiological process, negative regulation repeat:Spectrin 7, of protein metabolism, organelle repeat:Spectrin 8, organization and biogenesis, physiological repeat:Spectrin 9, process, primary metabolism, protein splice variant, depolymerization, protein metabolism, regulation of actin filament depolymerization, regulati 6711 SPECTRIN, actin cytoskeleton, cell, cell actin cytoskeleton organization and actin binding, binding, calmodulin domain:Actin-binding, BETA, cortex, cortical actin biogenesis, actin filament capping, actin binding, cytoskeletal protein binding, domain:CH 1, NON- cytoskeleton, cortical filament depolymerization, actin filament- protein binding, structural constituent domain:CH 2, ERYTHRO cytoskeleton, cytoplasm, based process, actin polymerization and/or of cytoskeleton, structural molecule domain:PH, CYTIC 1 cytoskeleton, intracellular, depolymerization, barbed-end actin activity, repeat:Spectrin 1, intracellular non-membrane- filament capping, cell organization and repeat:Spectrin 10, bound organelle, intracellular biogenesis, cellular macromolecule repeat:Spectrin 11, organelle, membrane, non- metabolism, cellular metabolism, cellular repeat:Spectrin 12, membrane-bound organelle, physiological process, cellular process, repeat:Spectrin 13, 69
    • cellular protein metabolism, cytoskeleton organization and biogenesis, macromolecule metabolism, metabolism, repeat:Spectrin 14, negative regulation of actin filament repeat:Spectrin 15, depolymerization, negative regulation of repeat:Spectrin 16, biological process, negative regulation of repeat:Spectrin 17, cell organization and biogenesis, negative repeat:Spectrin 2, regulation of cellular physiological repeat:Spectrin 3, process, negative regulation of cellular organelle, spectrin, repeat:Spectrin 4, process, negative regulation of repeat:Spectrin 5, metabolism, negative regulation of repeat:Spectrin 6, physiological process, negative regulation repeat:Spectrin 7, of protein metabolism, organelle repeat:Spectrin 8, organization and biogenesis, physiological repeat:Spectrin 9, process, primary metabolism, protein splice variant, depolymerization, protein metabolism, regulation of actin filament depolymerization, regulati calcium-binding ER-Golgi intermediate DNA binding, binding, calcium ion region:1, calcium- compartment, cell, cytoplasm, NUCLEOBI binding, cation binding, ion binding, binding region:2, 4925 cytosol, extracellular region, Null NDIN 2 metal ion binding, nucleic acid domain:EF-hand 1, extracellular space, intracellular, binding, domain:EF-hand 2, membrane, plasma membrane, signal peptide, KIAA0265 23008 Null Null Null Null PROTEIN PROTEIN modified residue, PHOSPHAT muscle contraction, organismal actin cytoskeleton, cell, repeat:ANK 1, ASE 1, physiological process, physiological cytoskeleton, intracellular, repeat:ANK 2, REGULAT process, regulation of biological process, intracellular non-membrane- repeat:ANK 3, 4659 ORY regulation of muscle contraction, signal transducer activity, bound organelle, intracellular repeat:ANK 4, (INHIBITO regulation of organismal physiological organelle, non-membrane- repeat:ANK 5, R) process, regulation of physiological bound organelle, organelle, repeat:ANK 6, splice SUBUNIT process, variant, 12A 70
    • apoptosis, astrocyte activation, axonogenesis, behavior, biosynthesis, calcium ion homeostasis, cation homeostasis, cell activation, cell communication, cell death, cell development, cell differentiation, cell homeostasis, cell ion homeostasis, cell organization and biogenesis, cell S100 alpha binding, S100 beta proliferation, cell-cell signaling, cellular binding, binding, calcium ion biosynthesis, cellular macromolecule binding, cation binding, cytoskeletal metabolism, cellular metabolism, cellular protein binding, enzyme inhibitor S100 cell, cytoplasm, extracellular morphogenesis, cellular morphogenesis calcium-binding activity, enzyme regulator activity, CALCIUM region, intracellular, during differentiation, cellular region:1; low affinity, identical protein binding, ion binding, BINDING intracellular membrane-bound physiological process, cellular process, calcium-binding 6285 kinase inhibitor activity, kinase PROTEIN, organelle, intracellular cellular protein metabolism, central region:2; high affinity, regulator activity, metal ion binding, BETA organelle, membrane-bound nervous system development, complement domain:EF-hand 1, protein binding, protein dimerization (NEURAL) organelle, nucleus, organelle, activation, cytokine biosynthesis, cytokine domain:EF-hand 2, activity, protein homodimerization metabolism, cytokine production, death, activity, tau protein binding, defense response, development, di-, tri- transition metal ion binding, zinc ion valent inorganic cation homeostasis, binding, generation of precursor metabolites and energy, homeostasis, humoral immune response, hyperphosphorylation, immune cell activation, immune response, induction of apoptosis, induction of programmed cell death, ion homeostasis, learning and/or memory, macromolecule bio 7103 TETRASPA cell, cytoplasm, integral to biopolymer glycosylation, biopolymer signal transducer activity, glycosylation site:N- NIN 8 membrane, integral to plasma metabolism, biopolymer modification, linked (GlcNAc...), membrane, intracellular, biosynthesis, cellular biosynthesis, cellular transmembrane region, intracellular membrane-bound macromolecule metabolism, cellular organelle, intracellular metabolism, cellular physiological process, organelle, intrinsic to cellular process, cellular protein membrane, intrinsic to plasma metabolism, glycoprotein biosynthesis, 71
    • glycoprotein metabolism, macromolecule membrane, lysosome, lytic biosynthesis, macromolecule metabolism, vacuole, membrane, membrane- metabolism, physiological process, bound organelle, organelle, primary metabolism, protein amino acid plasma membrane, vacuole, glycosylation, protein biosynthesis, protein metabolism, protein modification, RNA metabolism, RNA processing, biopolymer metabolism, cellular metabolism, cellular physiological process, cellular process, circulation, CUG macromolecule metabolism, metabolism, TRIPLET nucleobase, nucleoside, nucleotide and REPEAT, RNA binding, binding, nucleic acid 10659 Null nucleic acid metabolism, organismal Null RNA binding, nucleotide binding, physiological process, physiological BINDING process, primary metabolism, regulation of PROTEIN 2 biological process, regulation of heart contraction, regulation of organismal physiological process, regulation of physiological process, actin cytoskeleton, actin ATP binding, adenyl nucleotide ACTIN, filament, cell, cytoskeleton, binding, binding, nucleotide binding, ALPHA 2, intracellular, intracellular non- muscle contraction, organismal modified residue, protein binding, purine nucleotide 59 SMOOTH membrane-bound organelle, physiological process, physiological propeptide:Removed in binding, structural constituent of MUSCLE, intracellular organelle, non- process, mature form, cytoskeleton, structural molecule AORTA membrane-bound organelle, activity, organelle, actin cytoskeleton, actin ATP binding, adenyl nucleotide ACTIN, filament, cell, cytoskeleton, binding, binding, nucleotide binding, ALPHA 2, intracellular, intracellular non- muscle contraction, organismal modified residue, protein binding, purine nucleotide 72 SMOOTH membrane-bound organelle, physiological process, physiological propeptide:Removed in binding, structural constituent of MUSCLE, intracellular organelle, non- process, mature form, cytoskeleton, structural molecule AORTA membrane-bound organelle, activity, organelle, 1805 DERMATO extracellular matrix, cell adhesion, cellular process, binding, protein binding, disulfide bond, PONTIN extracellular matrix (sensu repeat:1-1, repeat:1-2, 72
    • repeat:2-1, repeat:2-2, Metazoa), extracellular region, repeat:3-3, signal peptide, FATTY ACID cellular physiological process, cellular BINDING cell, cell fraction, cytoplasm, process, establishment of localization, lipid binding, fatty acid binding, lipid 2167 Null PROTEIN 4, intracellular, soluble fraction, binding, localization, obsolete biological binding, ADIPOCYT process, physiological process, transport, E biopolymer metabolism, biopolymer modification, cellular macromolecule ATP binding, adenyl nucleotide metabolism, cellular metabolism, cellular binding, binding, catalytic activity, cell, cytoskeleton, intermediate physiological process, cellular process, kinase activity, nucleotide binding, filament, intermediate filament cellular protein metabolism, phosphotransferase activity, alcohol cytoskeleton, intracellular, KIAA0847 macromolecule metabolism, metabolism, group as acceptor, protein kinase 146057 intracellular non-membrane- Null PROTEIN phosphate metabolism, phosphorus activity, purine nucleotide binding, bound organelle, intracellular metabolism, phosphorylation, structural molecule activity, organelle, non-membrane- physiological process, primary transferase activity, transferase bound organelle, organelle, metabolism, protein amino acid activity, transferring phosphorus- phosphorylation, protein metabolism, containing groups, protein modification, catalytic activity, ceramidase activity, carboxylic acid metabolism, cellular lipid hydrolase activity, hydrolase activity, N- metabolism, cellular metabolism, cellular acting on carbon-nitrogen (but not ACYLSPHI cell, cytoplasm, intracellular, physiological process, cellular process, peptide) bonds, hydrolase activity, NGOSINE intracellular membrane-bound ceramide metabolism, fatty acid acting on carbon-nitrogen (but not glycosylation site:N- AMIDOHY organelle, intracellular 427 metabolism, lipid metabolism, membrane peptide) bonds, in linear amides, linked (GlcNAc...), DROLASE organelle, lysosome, lytic lipid metabolism, metabolism, organic acid transferase activity, transferase signal peptide, (ACID vacuole, membrane-bound metabolism, physiological process, activity, transferring acyl groups, CERAMID organelle, organelle, vacuole, primary metabolism, sphingoid transferase activity, transferring acyl ASE) 1 metabolism, sphingolipid metabolism, groups, acyl groups converted into alkyl on transfer, 29896 TRANSFOR cell, intracellular, intracellular RNA metabolism, RNA processing, RNA RNA binding, binding, nucleic acid domain:RRM, splice MER-2 membrane-bound organelle, splicing, RNA splicing, via binding, nucleotide binding, variant, ALPHA intracellular organelle, transesterification reactions, RNA splicing, 73
    • via transesterification reactions with bulged adenosine as nucleophile, biopolymer metabolism, cellular metabolism, cellular physiological process, cellular process, mRNA metabolism, membrane-bound organelle, mRNA processing, macromolecule nucleus, organelle, metabolism, metabolism, nuclear mRNA splicing, via spliceosome, nucleobase, nucleoside, nucleotide and nucleic acid metabolism, physiological process, primary metabolism, CTD phosphatase activity, binding, calcium-dependent protein serine/threonine phosphatase activity, catalytic activity, cation binding, biopolymer metabolism, biopolymer hydrolase activity, hydrolase activity, PROTEIN modification, cellular macromolecule acting on ester bonds, ion binding, PHOSPHAT metabolism, cellular metabolism, cellular magnesium ion binding, magnesium- metal ion-binding ASE 1B physiological process, cellular process, dependent protein serine/threonine site:Manganese 1, (FORMERL protein complex, protein cellular protein metabolism, phosphatase activity, manganese ion metal ion-binding Y 2C), serine/threonine phosphatase dephosphorylation, macromolecule binding, metal ion binding, myosin site:Manganese 1 (via 5495 MAGNESIU complex, unlocalized protein metabolism, metabolism, phosphate phosphatase activity, phosphoprotein carbonyl oxygen), M- complex, metabolism, phosphorus metabolism, phosphatase activity, phosphoric ester metal ion-binding DEPENDEN physiological process, primary hydrolase activity, phosphoric site:Manganese 2, T, BETA metabolism, protein amino acid monoester hydrolase activity, protein splice variant, ISOFORM dephosphorylation, protein metabolism, phosphatase type 1 activity, protein protein modification, phosphatase type 2A activity, protein phosphatase type 2B activity, protein phosphatase type 2C activity, protein serine/threonine phosphatase activity, transition metal ion binding, 9852 EPM2A cell, cytoplasm, endoplasmic Null Null splice variant, (LAFORIN) reticulum, intracellular, INTERACTI intracellular membrane-bound NG organelle, intracellular 74
    • organelle, membrane-bound PROTEIN 1 organelle, organelle, biopolymer metabolism, biopolymer active site:Proton modification, cell communication, cell acceptor, binding differentiation, cell surface receptor linked ATP binding, adenyl nucleotide site:ATP, disulfide signal transduction, cellular binding, binding, catalytic activity, bond, domain:Ig-like macromolecule metabolism, cellular growth factor binding, kinase C2-type 1, domain:Ig- metabolism, cellular physiological process, activity, neurotrophin binding, like C2-type 2, cellular process, cellular protein nucleotide binding, NEUROTR domain:Protein kinase, cell, integral to membrane, metabolism, development, enzyme linked phosphotransferase activity, alcohol OPHIC glycosylation site:N- integral to plasma membrane, receptor protein signaling pathway, group as acceptor, protein binding, TYROSINE linked (GlcNAc...), 4915 intrinsic to membrane, intrinsic macromolecule metabolism, metabolism, protein kinase activity, protein- KINASE, nucleotide phosphate- to plasma membrane, nervous system development, phosphate tyrosine kinase activity, purine RECEPTOR binding region:ATP, membrane, plasma membrane, metabolism, phosphorus metabolism, nucleotide binding, receptor activity, , TYPE 2 repeat:LRR 1, phosphorylation, physiological process, signal transducer activity, transferase repeat:LRR 2, signal primary metabolism, protein amino acid activity, transferase activity, peptide, site:Interaction phosphorylation, protein metabolism, transferring phosphorus-containing with PLC-gamma-1, protein modification, signal transduction, groups, transmembrane receptor site:Interaction with system development, transmembrane activity, SHC1, splice variant, receptor protein tyrosine kinase signaling transmembrane region, pathway, 75
    • Additional Table S3 Table S3. List of interacting elements for the visualization of the network in Figure 4a. Interactions were retrieved from the Biomolecular Interaction Network Database (BIND), the Biological General Repository for Interaction Datasets (BioGRID) and literature. Gene A is the first element of the interaction and Gene B the second one while interactions type are divided in protein-protein interactions (pp), interactions with ions (interactsWith), interaction between proteins and DNA (pd), literature inferred (DefaultEdge) and DirectedEdge sustain a direct interaction. Gene A Interaction Gene B type LIPE (DefaultEdge) AR AR (pp) GSN S100A11 (pp) S100A11 HNF4-alpha (pd) RAB1B TLE1 (pp) TLE1 SHC1 (pp) PPP2R5A S100A9 (pp) S100A8 PPP1CB (pp) PPP1R12A DCN (pp) COL14A1 EIF3S10 (pp) EIF3S3 Ca2+ (interactsWith) S100A9 SRC (pp) SRC BNIP3 (DefaultEdge) BNIP3 BCL2 (pp) NR4A1 (DirectedEdge TNF ) ICOSLG Histone_2a_Peptide (pp) HLA-G TSG101 (pp) NR3C1 SRC (pp) MPZL1 PTP4A2 (pp) PTP4A1 Smad8 (pp) GRN PPP3CA (pp) FKBP8 SF1 (pp) RBPMS SAP18 (pp) EIF3S6 HNF4-alpha (pd) PPP1R15B HCK (pp) HCK (DirectedEdge CTF1 ) SHC1 CHI3L1 (pp) CHI3L1 NDN (pp) RPS11 HNF6 (pd) ACVR1 HSF1 (pp) STAT1 76
    • AHNAK (pp) S100B BCL2 (pp) PPP3CA HNF4-alpha (pd) STAT1 PTEN (pp) ESR1 STAT1 (pp) PLAUR NDN (pp) NUCB2 vinculin (pp) B2M HNF1-alpha (pd) LY6E paxillin (pp) MVP PBX1 (pp) NR3C1 ZBTB16 (pp) ESR1 Smad4 (pp) HYPA (DirectedEdge BSG ) APP Source (interaction) Target TRG20 (pp) TRG20 NR3C1 (pp) TSG101 CCL5 (pp) SDC4 HEM (interactsWith) HMOX1 NR3C1 (pp) TXN HSF1 (pp) TAF7 NFIB (pp) NFIC HYPA (pp) ZAP3 Tat (pp) B2M vinculin (pp) SERPINH1 S100A11 (pp) S100B (DirectedEdge IL5 ) SHC1 talin (pp) FMNL1 S100A8 (pp) S100A8 PIAS1 (pp) STAT1 SARA (pp) Smad2 TGF-beta-RI (pp) STAT1 Smad2 (pp) SMURF1 ANXA6 (pp) S100B PLAUR (pp) PLAUR Vif (pp) HCK APP (pp) APP CDK6 (pp) PPM1B MOAP1 (pp) BCL2 CCL3 (pp) CCL4 SMAD3 (pp) NR3C1 DNAJB1 (pp) HSPA1A FYN (pp) NTRK2 p621 (pp) HEY-L (DirectedEdge DNAJB1 ) HMOX1 SF1 (pp) BCL2 BAG1 (pp) AR CDK6 (pp) CDK6 VEGF (pp) VEGF Smad8 (pp) MGAT1 NR2F6 (pp) NR3C1 APP (pp) FBLN1 77
    • AR (pp) NCOA3 TP53 (pp) TP53 Tat (pp) APOE RARA (pp) RARA NR3C1 (pp) NR3C1 PGM1 (pp) S100B RGS2 (pp) COPB NR3C1 (pp) SELENBP1 COPB (pp) RGS2 ESR1 (pp) NCOA3 VAV1 (pp) S100B ZBTB16 (pp) ZBTB16 HDAC9 (pp) ZBTB16 (DirectedEdge STAT1 ) KLF2 Smad4 (pp) p621 IL10 (pp) IL10 BCL2 (pp) ITPR1 ZBTB16 (pp) NR3C1 paxillin (pp) SERPINH1 NCOA3 (pp) AR HNF6 (pd) HLA-G RGPD5 (pp) TNPO1 APP (pp) CAV1 HNRPU (pp) NR3C1 NAG-(1-4)NAG-(1-4)NAG-(1-4)NAG (interactsWith) CHI3L1 CD36 (DefaultEdge) CAV1 HSF1 (pp) HSPA1A TP53BP2 (pp) TP53 Tat (pp) IL10 HNF4-alpha (pd) S100A9 TNF (pp) TNFRSF1A ESR1 (pp) BAG1 HNF4-alpha (pd) NAG NCOA3 (pp) NR4A1 RUSC2 (pp) GOLGA2 S100B (pp) S100B VEGF (pp) GPC1 Unknown (interactsWith) SERPINH1 Unknown (interactsWith) TP53BP2 PTPRS (pp) PTPRD HYPA (pp) HYPA NR3C1 (pp) BAG1 Tat (pp) HLA-G AR (pp) TGFB1I1 FTL (pp) FTL AKR1C1 (pp) AKR1C1 MX1 (pp) MX1 ACVR1 (pp) STAT1 LRP1 (pp) SERPINE1 AR (pp) CAV1 Smad4 (pp) Smad2 Tat (pp) GRN 78
    • SMAD4 (pp) STAT1 (DirectedEdge DNAJA1 ) DNAJB1 RNPS1 (pp) SRRM2 NAG-(1-4)NAG-(1-4)NAG (interactsWith) CHI3L1 CAV1 (pp) AR SFRS1 (pp) SFRS11 Unknown (interactsWith) vinculin Annexin_I (pp) S100A11 SMURF1 (pp) STAT1 FYN (pp) FYN 1LYB_I (pp) CTSD SRC (pp) STAT5A FCGRT (pp) FCGRT Quercetin (interactsWith) HCK IL5 (pp) IL5 (DirectedEdge TNF ) FTL (DirectedEdge ANXA11 ) Annexin_I Unknown (interactsWith) KRT14 BMPR2 (DefaultEdge) CAV2 BCL6 (pp) JUND DNAJB1 (pp) HSF1 CSNK2A2 (pp) FGF2 ERBB2IP (pp) SMAD3 SNRPN (pp) FBL BNIP3 (pp) BCL2 1BF5_C (pd) STAT1 HNF4-alpha (pd) AF15Q14 APP (pp) APOE STAT1 (pp) STAT2 RIOK3 (pp) FBL (DirectedEdge IL7 ) SHC1 BNIP3L (pp) BNIP3L Unknown (interactsWith) Vif DES (pp) S100B NAG-(4-1)NAG-(4-1)MAN-(6-1)MAN (interactsWith) CTSD PTEN (pp) AR EXT2 (pp) EXT2 POU2F1 (pp) NR3C1 MORF4L2 (pp) HDAC9 (DirectedEdge IFNG ) MX1 IL10RA (pp) IL10 B2M (pp) FCGRT HNF4-alpha (pd) ATM Unknown (interactsWith) GSTM1 Tat (pp) PPP1R8 JUND (pp) FOSL2 Interleukin-10-Like_Protein (pp) IL10RA TNF (pp) TNF NR2F6 (pp) ESR1 79
    • HNF4-alpha (pd) PPP1R10 EIF3S10 (pp) EIF3S4 NSD1 (pp) RARA ERBB2IP (pp) DST IL8 (pp) CCL4 TNFRSF1A (pp) TRAF1 TNFRSF1A (pp) TNF TSG101 (pp) TSG101 AR (pp) NR3C1 Unknown (interactsWith) talin BNIP3 (pp) BNIP3L CCL4 (pp) CCL4 HNF4-alpha (pd) ABCC3 TNPO1 (pp) HIST2H2BE AR (pp) TSG101 HSF1 (pp) DNAJB1 PPM1B (pp) GSN APP (pp) GSN PTEN (pp) CAV1 HIST2H2AA (pp) UBE2H EIF3S10 (pp) EIF3S6 HNF1-alpha (pd) C2 FKBP8 (pp) PPP3CA HSPA1A (pp) DNAJB1 Smad2 (pp) AP1B1 S100B (pp) PGM1 CCL3 (pp) CCL3 NAG-(1-4)NAG-(1-4)NAG-(1-4)NAG-(1-4)NAG- (1-4)NAG (interactsWith) CHI3L1 STAT1 (pp) TNFRSF1A S100A9 (pp) S100A9 LIPE (pp) FABP4 PDGFB (pp) PDGFB CREB1 (pp) NR3C1 NAG-(1-4)NAG-(1-4)NAG-(1-4)NAG-(1-4)NAG (interactsWith) CHI3L1 SMAD3 (pp) SMAD3 SMARCD1 (pp) NR3C1 SHC1 (pp) ITGB4 Unknown (interactsWith) ER CAV1 (pp) CAV2 TNPO1 (pp) RANBP2 KCNAB1 (pp) DLG1 (DirectedEdge SRC ) PTPNS1 STAT1 (pp) K-alpha POU2F1 (pp) POU2F1 S100B (pp) ANXA6 SPEN (pp) RARA HNF4-alpha (pd) CHI3L1 NR3C1 (pp) TGFB1I1 heme (interactsWith) HMOX1 ELMO1 (pp) HCK NAG-(4-1)NAG (interactsWith) PLAUR Tat (pp) APP 80
    • 5-Residue_Peptide (pp) STAT1 CTSD (pp) IGF2R SELENBP1 (pp) AR SMAD3 (pp) ZBTB16 NR3C1 (pp) SMARCD1 (DirectedEdge APOE ) RARA 1LYB_J (pp) CTSD BCL2L11 (pp) BCL2 ATM (pp) AP1B1 AR (pp) BAG1 Smad8 (pp) Smad2 (DirectedEdge IL6 ) SHC1 FBLN1 (pp) FBLN1 HNF4-alpha (pd) PPP1R3B AR (pp) AR SHBG (pp) SHBG APP (pp) HADH2 IL10 (pp) IL10RA BNIP3L (pp) BCL2 RNPS1 (pp) CSNK2A2 XPOT (pp) RANBP2 IL8 (pp) IL8 NR4A1 (pp) BCL2 (DirectedEdge S100A8 ) S100A11 VEGFB (pp) VEGFB N-Acetyl-D-Glucosamine (interactsWith) CTSD SHBG (pp) AP1B1 IL2 (pp) SHC1 XPOT (DefaultEdge) XPOT STAT1 (pp) PIAS1 AP1B1 (pp) ARF6 NAG (interactsWith) CHI3L1 BNIP3 (pp) BNIP3 GDB (interactsWith) GSTM1 HNF6 (pd) C2 CSNK1D (pp) PER1 ERBB2IP (pp) ERBB2IP FGF2 (pp) SDC4 SRC (pp) STAT1 Smad4 (pp) GPNMB APP (pp) APPBP2 AR (pp) SMAD3 TSC22D1 (pp) MTR (DirectedEdge TNF ) CCL5 LRP1 (pp) PDGFB SREBF2 (pp) SREBF2 TLE1 (pp) MORF4L2 RELN (pp) RELN HNF4-alpha (pd) GOLGA2 STAT5A (pp) SRC 81
    • 1BF5_B (pd) STAT1 HYPA (pp) MMP11 APPBP2 (pp) APPBP2 AMP-PNP (interactsWith) HCK PPM1B (pp) CDK6 HNF4-alpha (pd) CLPTM1 TYK2 (pp) STAT1 SMAD5 (DefaultEdge) ID4 TGF-beta-RI (pp) CSNK1D CSF1 (pp) TNF HMOX1 (pp) HMOX1 Viral_Interleukin-10_Homol IL10RA (pp) og LRP1 (pp) APOE (DirectedEdge GPC1 ) CHI3L1 Unknown (interactsWith) AF15Q14 AR (pp) ESR1 NDN (pp) NDN SHC1 (pp) SRC POU2F1 (pp) ESR1 (DirectedEdge IFNG ) SHC1 NR3C1 (pp) ZBTB16 TRG20 (pp) POLR2E RARA (pp) NR1H3 HYPA (pp) PIAS1 FKBP8 (pp) BCL2 BMPR2 (DefaultEdge) CAV1 S100B (pp) AGER SNURF (pp) AR DST (pp) COL17A1 Tat (pp) TP53 Smad4 (pp) PIAS1 Unknown (interactsWith) FMNL1 HNF4-alpha (pd) STAM (DirectedEdge IL4 ) SHC1 BAG1 (pp) BCL2 S100A8 (pp) S100A9 SERPINE1 (pp) SERPINE1 CTSD (pp) CTSD RUSC2 (pp) RAB1B NAG (interactsWith) PLAUR CCL5 (pp) CCL5 SMAD3 (DefaultEdge) SPTBN1 (DirectedEdge DSCR1 ) APP SHBG (pp) CTSD ISGF3G (pp) STAT1 IL10RA (pp) Interleukin-10 HNF4-alpha (pd) ACVR1 HNRPU (pp) NDN EIF3S3 (pp) EIF3S4 82
    • Smad2 (pp) Smad4 BAG1 (pp) NR3C1 ER (pd) AP1B1 COL17A1 (pp) COL17A1 NDN (pp) TMEM33 HNF4-alpha (pd) C2 SMAD3 (pp) AR ATM (pp) ATM MOAP1 (pp) MOAP1 NAG-(1-4)NAG (interactsWith) CHI3L1 TNFRSF1A (pp) TRPC4AP GSN (pp) AR APOE (pp) PLTP EIF3S4 (pp) EIF3S10 Tat (pp) STAT1 TGF-beta-RI (pp) RGS19 NR3C1 (pp) CREB1 SMARCD1 (pp) ESR1 PPP1CB (pp) TMEM33 HLA-G (pp) HLA-G OC1 (interactsWith) S100A8 VEGFB (pp) VEGF FYN (pp) VAV1 TNFRSF1A (pp) TNFRSF1A NR3C1 (pp) SMAD3 RBPMS (pp) RBPMS IFNG (pp) IFNG HSPA1A (pp) HSF1 SHC1 (pp) LRP1 UBE2H (pp) HIST2H2AA TGFB1I1 (pp) NR3C1 LRP1 (pp) SHC1 PITPNA (pp) MORF4L2 PER1 (pp) PER2 EIF3S4 (pp) EIF3S3 DAPK1 (pp) TNFRSF1A GSH (interactsWith) GSTM1 NAG-(4-1)NAG (interactsWith) CHI3L1 SNURF (pp) ESR1 FABP4 (pp) EXT2 NCOA3 (pp) ESR1 Trehalose (interactsWith) HMOX1 RGS2 (pp) EIF3S6 GSTM1 (pp) GSTM1 B2M (pp) HLA-G ESR1 (pp) CAV1 Ca2+ (interactsWith) HCK (DirectedEdge JUND ) IL6 STAT1 (pp) STAT1 JARID1A (pp) NR3C1 TYK2 (pp) TYK2 Tat (pp) SMAD4 83
    • (DirectedEdge SPRY1 ) SHC1 NR3C1 (pp) NCOA3 (DirectedEdge JUND ) IL8 p621 (pp) AP1B1 TNFRSF1A (pp) STAT1 HNF6 (pd) AF15Q14 AR (pp) POU2F1 HNF4-alpha (pd) SREBF2 NR2F6 (pp) NR2F6 84