• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
A R T I C L E S
 

A R T I C L E S

on

  • 535 views

 

Statistics

Views

Total Views
535
Views on SlideShare
535
Embed Views
0

Actions

Likes
0
Downloads
2
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    A R T I C L E S A R T I C L E S Document Transcript

    • ARTICLES Basophils enhance immunological memory responses © 2008 Nature Publishing Group http://www.nature.com/natureimmunology Andrea Denzel1, Ulrich A Maus2, Manuel Rodriguez Gomez1, Cordula Moll1,5, Marianne Niedermeier1, Christine Winter2, Regina Maus2, Susan Hollingshead3, David E Briles3, Leoni A Kunz-Schughart4,5, Yvonne Talke1 & Matthias Mack1 The cellular basis of immunological memory remains a controversial issue. Here we show that basophils bound large amounts of intact antigens on their surface and were the main source of interleukins 6 and 4 in the spleen and bone marrow after restimulation with a soluble antigen. Depletion of basophils resulted in a much lower humoral memory response and greater susceptibility of immunized mice to sepsis induced by Streptococcus pneumoniae. Adoptive transfer of antigen-reactive basophils significantly increased specific antibody production, and activated basophils, together with CD4+ T cells, profoundly enhanced B cell proliferation and immunoglobulin production. These basophil-dependent effects on B cells required interleukins 6 and 4 and increased the capacity of CD4+ T cells to provide B cell help. Thus, basophils are important contributors to humoral memory immune responses. Immunological memory is thought to be maintained by continuous mice23. Basophils are an important source of interleukin 4 (IL-4) in the low exposure or persistence of antigen and the population expansion spleen and bone marrow after stimulation with IL-3 and crosslinking of and long-term survival of antigen-specific memory T cells and IgE receptors24,25, and they are mainly responsible for IL-4 production B cells1,2. In addition, long-lived antibody-secreting plasma cells in models of parasite infection26 and allergic airway inflammation27. may also contribute to immunological memory3. Memory responses Furthermore, basophils have been shown to induce a T helper type 2 are usually more rapid than, larger than and qualitatively different phenotype in CD4+ T cells in vitro28,29 and in vivo21; they are the main from the primary immune response to antigen. Memory B cells source of the early IL-4 release detectable during the first 26 h after express membrane immunoglobulins of the IgG, IgE and IgA classes restimulation of mice with an antigen. The more prolonged IL-4 release on their surface, which allows them to recognize and react to free (up to 98 h) seems to originate from CD4+ T cells30. The ability of antigen4. Depending on the nature of the antigen, the differentiation basophils to recognize and to react to antigen suggests that they may be of B cells into plasma cells usually requires help from antigen-specific involved in the development of memory immune responses. CD4+ T cells5,6. It has been shown that after immunization, basophils Here we show that basophils bound intact antigens on their surface and antigen-specific B cells are the only leukocyte populations that can and were the main source of IL-6 and IL-4 in the spleen and bone bind substantial amounts of intact antigen on their surface7; the ability marrow after restimulation with a soluble antigen. Depletion of of basophils to capture antigen8,9 has clarified a previous confusion basophils resulted in a much lower humoral memory response and that this was due to antigen capture by memory B cells10,11. Basophils greater susceptibility of immunized mice to Streptococcus pneumoniae– capture antigen-specific IgE antibodies, present in the plasma after induced sepsis, whereas adoptive transfer of antigen-reactive basophils immunization, through expression of the high-affinity IgE receptor7. significantly increased specific antibody production. Moreover, acti- Even several months after immunization, basophils ‘recognize’ the vated basophils profoundly enhanced B cell proliferation and immu- appropriate antigen (specific to the bound IgE antibodies), which noglobulin production in a CD4+ T cell–dependent way. We conclude indicates long-term persistence of an antigen-specific IgE response. that basophils are important contributors to humoral memory So far, basophils have been linked mainly to allergic reactions12,13 immune responses. and parasite infections14. In addition to being activated by crosslinkage of surface IgE, basophils can be activated by a variety of other stimuli, RESULTS including cytokines, chemokines and protease allergens such as Basophils ‘sense’ free antigen during memory responses papain15–21. In a T cell–independent pathway, basophils induce an The B cell memory response requires the presence of free antigen isotype switch toward IgE in human tonsillar B cells22 and are critical (antigen not neutralized by pre-existing antibodies). In contrast, for the development of IgE-mediated chronic allergic inflammation in IgG antibody complexes are thought to block B cell activation by 1Department of Internal Medicine II, University Hospital Regensburg, 93042 Regensburg, Germany and 2Department of Pulmonary Medicine, Laboratory for Experimental Lung Research, Hannover School of Medicine, 30625 Hannover, Germany. 3Department of Microbiology, University of Alabama at Birmingham, Birmingham, Alabama 35294, USA. 4Institute of Pathology, University Hospital Regensburg, 93042 Regensburg, Germany. 5Present addresses: Center for Plant Molecular Biology, University of ¨ ¨ Tubingen, 72076 Tubingen, Germany (C.M.), and OncoRay, Dresden University of Technology, 01307 Dresden, Germany (L.A.K.-S.). Correspondence should be addressed to M.M. (matthias.mack@klinik.uni-regensburg.de). Received 12 March; accepted 8 May; published online 30 May 2008; doi:10.1038/ni.1621 NATURE IMMUNOLOGY VOLUME 9 NUMBER 7 JULY 2008 733
    • ARTICLES a b IL-4 APC APC APC 1.6 (0 µg/ml) (1 µg/ml) (1 ng/ml) IL-6 104 Cytokine (ng/ml) 3 1.2 10 102 0.8 101 IgE 100 0.4 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 APC APC APC 0 – 10 1 0.1 10 1 0.1 IL-3 α-IgE α-FcεRlα © 2008 Nature Publishing Group http://www.nature.com/natureimmunology PBS APC (µg/ml) APC (ng/ml) c 10 4 d Control e Spleen 103 Basophil ** IL-4 102 depletion 0.2 0.6 ** IL-6 Cytokine (ng/ml) 101 Cytokine (ng/ml) 100 0.4 APC (100 µg) 104 0.1 103 0.2 102 101 * ** * * APC 0 0 100 IL-4 IL-6 IL-4 IL-6 – + – + – + – + – + – + – 0 1 2 10 10 10 10 10 3 4 Total Baso Total Baso– Total Baso– Spleen BM IgE WT (4 h) FcRγ-KO (4 h) WT (72 h) Bone marrow Figure 1 Antigen binding and activation of basophils. Analysis of cells from C57BL/6 mice and treated C57BL/6 wild-type mice (d,e) and 0.6 ** Cytokine (ng/ml) FcRg-KO mice backcrossed with C57BL/6 mice (e) at 4–6 weeks after primary immunization with APC. (a) Flow cytometry of splenocytes 0.4 stained in vitro with anti-IgE and various concentrations of APC. (b) ELISA of IL-4 and IL-6 on isolated basophils (4,000 cells per 0.2 200 ml) after culture for 20 h with medium (–) or various stimuli. a-, anti. P o 0.01, stimulus versus medium for all conditions (one-sided Students t-test). (c) Flow cytometry of splenocytes at 16 h after 0 – + – + – + – + – + – + – restimulation by intraperitoneal injection of PBS or 100 mg APC, for Total Baso Total Baso– Total Baso– cells stained in vitro with anti-IgE alone. (d) ELISA of splenocytes WT (4 h) FcRγ-KO (4 h) WT (72 h) (Spleen) and bone marrow cells (BM) from mice depleted of basophils (Basophil depletion; n ¼ 5) or not (Control; n ¼ 5) by intraperitoneal injection of anti-FceRIa, allowed to ‘rest’ for 2 d and then restimulated by intraperitoneal injection of 100 mg APC; cells obtained 2 h after restimulation were cultured for 4 h in medium (2 Â 106 cells in 200 ml). (e) ELISA of IL-4 and IL-6 in splenocytes and bone marrow cells from wild-type mice (WT) and FcRg-knockout mice (FcRg-KO) at 4 h or 72 h after restimulation by intraperitoneal injection of 100 mg APC (+) or PBS (–); total cells (Total) or cells depleted in vitro of basophils (Baso–) were cultured for 4 h in medium alone (2 Â 106 cells in 200 ml). Cell cultures were done in triplicate. *, P o 0.05; **, P o 0.01 (one-sided Student’s t-test). Data are representative of five (a), three (b,c) or two (d) independent experiments (error bars, s.e.m.) or are the mean and s.e.m. of three independent experiments (e). crosslinkage of the B cell receptor and the Fc receptor FcgRIIB31. activated in vitro by antigen, most likely by FcgRIII, as FcgRI is not Depending on the amount of pre-existing antibodies and the amount detectable on basophils7 (Supplementary Fig. 2). In vitro, we were of antigen, only traces of free antigen might be present in vivo. As a easily able to deplete splenocytes and bone marrow cells of basophils model antigen, we used the fluorescent protein allophycocyanin using antibody to IgE (anti-IgE) and magnetic beads, as the only IgE+ (APC) and measured the binding of APC to basophils 6 weeks after cells in the spleen and bone marrow were CD45loCD49bhic-Kit– immunizing mice with APC mixed with heat-killed Bordetella pertussis basophils (Supplementary Fig. 3 online). as adjuvant. Binding of APC to basophils from immunized Binding of APC to basophils was also readily detectable in vivo after mice occurred efficiently in vitro at very low concentrations of APC restimulation of mice with a second injection of APC. After intraper- (1 ng/ml; Fig. 1a), which was also sufficient to induce the release of itoneal injection of 100 mg APC, we measured APC on splenocytes and IL-4 and IL-6 (Fig. 1b). In mice with defective IgE production (such bone marrow cells by flow cytometry. At 4 h after injection, APC was as IL-4-deficient mice32) and in mice with a defect in either the high- detectable on basophils in the spleen and the bone marrow; after 16 h, affinity IgE receptor (FceRI) or the common Fc receptor g-chain APC was detectable almost exclusively on basophils, and basophils in (FcRg; A000543), no antigen binding on basophils was detectable the spleen retained three to four times more APC on their surface than (Supplementary Fig. 1 online). Moreover, when total splenocytes or did basophils in the bone marrow (Fig. 1c and Supplementary bone marrow cells from immunized wild-type mice were stimulated Fig. 2). Also, consistent with other reports, basophils were the main in vitro with antigen for short (4 h) or longer (up to 3 d) periods of source of IL-4 and IL-6 in the spleen and the bone marrow after time, basophils were the main source of IL-6 and IL-4, as formally in vivo restimulation of mice with APC. We demonstrated this in two demonstrated by in vitro depletion of basophils (Supplementary different experimental settings. First, we left mice undepleted or Fig. 2 online and data not shown). In vitro, the activation of basophils depleted them of basophils in vivo with antibody to the high-affinity with antigen was completely dependent on immunoglobulin Fc IgE receptor (details below) and restimulated them 2 d later by receptors, as mice deficient in FcRg and thus lacking expression of intraperitoneal injection of 100 mg APC. Then, at 2 h after the FcgRI/III and FceRI failed to release IL-4 and IL-6 after antigen restimulation, we analyzed the secretion of IL-4 and IL-6 by spleno- stimulation. Basophils from mice lacking only FceRI could still be cytes and bone marrow cells (Fig. 1d). Second, we restimulated 734 VOLUME 9 NUMBER 7 JULY 2008 NATURE IMMUNOLOGY
    • ARTICLES a Control Spleen Basophil depletion Spleen Control Blood Basophil depletion Blood b Control Basophil depletion 104 104 APC-specific IgG2a (A450) APC APC * APC-specific IgG1 (A450) 103 103 0.20 ** 0.10 IgE 2 2 IgE 10 10 0.15 101 101 100 100 0.1 ** 4 Spleen Spleen 4 BM BM 0.05 10 10 103 103 0.05 CD45 102 102 IgE 0 0 101 101 3 5 7 10 3 5 7 10 0 0 Time after restimulation (d) Time after restimulation (d) 10 10 © 2008 Nature Publishing Group http://www.nature.com/natureimmunology 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 α-IgG1 α-IgG2a APC-specific IgG2a (A450) CD49b APC-specific IgG1 (A450) CD49b * ** 0.08 0.6 Figure 2 Lower humoral memory response after depletion of basophils. 0.06 (a) Flow cytometry of splenocytes, peripheral blood cells (Blood) and 0.4 ** 0.04 bone marrow cells from mice injected twice daily for 3 d with PBS (Control) or 5 mg anti-FceRIa (Basophil depletion); at 2 d after the final 0.2 0.02 injection, cells were stained with anti-IgE, anti-CD45 and anti-CD49b. 0 0 (b) ELISA of antibodies in the plasma of C57BL/6 mice given primary 3 5 7 10 3 5 7 10 immunization with APC plus heat-killed B. pertussis, then 4 weeks Time after restimulation (d) Time after restimulation (d) later, depleted of basophils as described above (n ¼ 10) or not (n ¼ 10), and, 2 d after the final injection of anti-FceRIa, restimulated by intraperitoneal injection of 100 mg APC. APC-specific IgG1 and IgG2a were quantified on plates coated with APC (top row; plasma dilution. 1:36,000 and 1:200, respectively) or anti-IgG1 and anti-IgG2a, respectively (bottom row; plasma dilution, 1:2,000 and 1:10, respectively), *, P o 0.05; **, P o 0.01 (one-sided Student’s t-test). Data are representative of more than ten (a) or two (b) independent experiments (error bars, s.e.m.). immunized mice by intraperitoneal injection of antigen or PBS (as a completely depleted of basophils within 4 h, but the basophils control) and analyzed the secretion of IL-4 and IL-6 by total returned within 24 h (data not shown). However, when we injected splenocytes and bone marrow cells, or such cells depleted in vitro of anti-FceRIa (5 mg) twice daily for 3 d, we achieved prolonged and basophils, at several time points after injection (2, 4, 24 and 72 h; complete depletion of basophils from the peripheral blood, spleen, Fig. 1e and Supplementary Fig. 2). Up to 72 h after restimulation of bone marrow and liver. Even at 12 d after the final antibody injection, wild-type mice, basophil-dependent release of IL-4 and IL-6 was no basophils were detectable in the spleen or bone marrow in nine of detectable in the spleen; however, in the bone marrow, release of ten mice. We used antibodies to two different combinations of surface IL-4 and IL-6 was detectable only during the first 4 h after restimula- markers (IgEhiCD49bhi and CD45loCD49bhi) to demonstrate the tion. The release of IL-4 and IL-6 in the spleen and the bone marrow absence of basophils from the blood, spleen, bone marrow and liver was completely dependent on immunoglobulin Fc receptors, as no (Fig. 2a and Supplementary Fig. 4 online); we excluded the possibi- release of IL-4 and IL-6 was detectable in FcRg-deficient mice. These lity that preincubation of basophils with anti-FceRIa interfered with data indicate that basophils can bind and react to free antigen in vitro the detection of surface IgE on basophils by anti-IgE. In humans, and in vivo in an Fc-receptor dependent way and are the main source expression of the high-affinity IgE receptor has been described on of IL-4 and IL-6 in the spleen and bone marrow after restimulation monocytes and dendritic cells33–35. However, in naive or APC- with an antigen. Other factors known to activate basophils (such as immunized mice, surface IgE molecules or the high-affinity IgE IL-3) are not sufficient in this setting for stimulation of basophils receptor (stained with anti-FceRIa) were detectable only on basophils during a memory immune response. and not on monocytes or dendritic cells in the peripheral blood, spleen and bone marrow (Supplementary Fig. 5 online). In addition, Lower B cell memory in the absence of basophils there was no depletion of monocytes, dendritic cells, CD4+ T cells or B To deplete mice of basophils, we used an antibody to FceRIa (MAR-1) cells after injection of anti-FceRIa (Supplementary Fig. 6 online). that recognizes the a-chain of the high-affinity IgE receptor. After a single intraperitoneal injection of anti-FceRIa (5 mg), mice were a 10 4 Spleen 104 Spleen 104 BM Figure 3 Fewer antigen-specific B cells and plasma cells after restimulation 10 3 103 103 4 1 1 CD138 of mice in the absence of basophils. (a) Flow cytometry of splenocytes and CD19 CD19 102 3 102 102 bone marrow cells 10 d after restimulation of mice with APC without 101 3 2 101 2 101 depletion of basophils (as described in Fig. 2b), for analysis of APC-specific 100 100 100 B cells (population 1 (outlined)) and basophils (population 2) by 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 extracellular staining with anti-CD19 and APC (10 mg/ml) and detection of APC extracellular APC intracellular APC intracellular APC-specific plasma cells (population 3) and plasma cells not specific for APC (population 4) by extracellular staining with anti-CD19 and anti-CD138 b ** ** 8 Percent of B cells 0.2 ** and intracellular staining with APC (0.1 mg/ml). (b) Flow cytometry of APC- ** 0.2 6 specific plasma cells (APC+ plasma), plasma cells not specific for APC 1 (APC– plasma), APC-specific B cells (APC+ B cells) and basophils (Baso) as 0.1 4 0.1 percentage of B cells at 10 d after restimulation with APC in the experiment * 2 described in Figure 2b (control mice (n ¼ 10), black bars; basophil-depleted 0 0 0 mice (n ¼ 10), gray bars). *, P o 0.05; **, P o 0.01 (one-sided Student’s 0 Baso APC+ APC APC + + APC – APC – Baso t-test). Data are representative of more than ten (a) or two (b) independent plasma plasma B cells plasma plasma BM Spleen experiments (error bars, s.e.m.). BM Spleen Spleen BM Spleen NATURE IMMUNOLOGY VOLUME 9 NUMBER 7 JULY 2008 735
    • ARTICLES a b APC-specific IgG1 (A 450) * * APC-specific IgG2a (A 450) 2 * Control α-IgG1 PE 1.2 PE-specific IgG1 (A 450) PE-specific IgG1 (A 450) Basophil * Control 1.5 * * 1.2 depletion 0.8 * * * 0.8 Basophil 0.8 depletion 1 0.4 0.4 0.4 0.5 0 0 0 0 3 5 7 10 12 3 5 7 10 12 0 5 7 10 13 0 5 7 10 13 © 2008 Nature Publishing Group http://www.nature.com/natureimmunology Time after restimulation (d) Time after restimulation (d) Time after restimulation (d) Time after restimulation (d) c d PspA-specific IgG2a (A 450) PspA-specific IgG1 (A 450) * Control 100 100 PspA-imm 0.4 0.2 * Control Basophil 80 80 Septic mice (%) Survival (%) depletion PspA-imm Basophil 60 60 depletion * * * * * * NS Naive 0.2 0.1 40 40 Control 20 20 Naive Basophil depletion 0 0 0 0 5 7 10 5 7 10 0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7 Time after restimulation (d) Time after restimulation (d) Time after infection (d) Time after infection (d) Figure 4 Influence of basophils on humoral memory responses during immunization, vaccination and infection. (a) ELISA of phycoerythrin-specific (PE-specific) IgG1 in plasma of C57BL/6 mice given primary immunization with 100 mg phycoerythrin in the absence of adjuvant, then, 5 weeks later, depleted of basophils (n ¼ 12 mice) or not (n ¼ 13 mice) and, 2 d after the final injection of anti-FceRIa, restimulated with 100 mg phycoerythrin; IgG1 was quantified on plates coated with anti-IgG1 (plasma dilution, 1:2,000) or phycoerythrin (plasma dilution, 1:250). (b) ELISA of APC-specific IgG1 and IgG2a in plasma of mast cell–deficient mice given primary immunization with 100 mg APC plus heat-killed B. pertussis and, 4 weeks later, depleted of basophils (n ¼ 8 mice) or not (n ¼ 10 mice), then, 2 d after the final injection of anti-FceRIa, restimulated with 100 mg APC; IgG1 and IgG2a were quantified on plates coated with APC (plasma dilution, 1:10,000 and 1:200, respectively). (c) ELISA of PspA-specific IgG1 and IgG2a in plasma of C57BL/6 mice (n ¼ 9 per group) restimulated with PspA in the presence or absence of basophils; plasma dilution, 1:9,000 (IgG1) and 1:100 (IgG2a). (d) Sepsis and survival of PspA-immunized mice (PspA-imm) or nonimmunized mice (Naive) depleted of basophils (Baso depletion) or not (Control), allowed to ‘rest’ for 2 d, then restimulated with PspA (PspA-immunized) or not (nonimmunized) and, 5 d later, infected intratracheally with S. pneumoniae. Basophil-depleted mice: n ¼ 14 (PspA-immunized) or n ¼ 15 (nonimmunized); control mice: n ¼ 15 (PspA-immunized) or n ¼ 15 (nonimmunized). NS (not significant), P ¼ 0.05 or more; *, P o 0.05; **, P o 0.01 (one-sided Student’s t-test (a–c) or Kaplan-Meier analysis (d)). Data are representative of two independent experiments (a–c; error bars, s.e.m.) or one experiment (d). Mature mast cells (IgE+c-Kit+) were not detectable in the blood, the frequency of APC-specific B cells in the spleen and of APC-specific spleen or bone marrow of these mice (data not shown). In the plasma cells in the spleen and bone marrow was significantly peritoneal cavity, mast cells were detectable at low numbers and lower, by more than 50%, in the basophil-depleted group (Fig. 3 were decreased by about 50% after injection of anti-FceRIa (Supple- and Supplementary Fig. 8 online). Also, the proportion of APC- mentary Fig. 6). At 2 d after depletion of basophils by treatment with specific plasma cells to total plasma cells was significantly lower, anti-FceRIa for 3 d, we did not detect more IL-4 or IL-6 in the plasma by about 50%, in the spleen (P o 0.018) and bone marrow (P o (data not shown) or more production of IL-4 or IL-6 in the spleen and 0.005) of basophil-depleted mice (data not shown). The frequency of bone marrow relative to that of control mice (Supplementary Fig. 7 APC– plasma cells in the spleen or bone marrow was not different for online). This indicates that depletion of basophils with anti-FceRIa the groups (Fig. 3). does not result in prolonged secretion of cytokines. To exclude the possibility that the influence of basophils was To determine the influence of basophils on the humoral memory restricted to a single antigen or a specific adjuvant, we repeated the immune response, we immunized mice with APC mixed with heat- experiments described above with a different antigen (phycoerythrin) killed B. pertussis as adjuvant. After 4 weeks, we either depleted and did not use an adjuvant for primary immunizations. Phyco- mice of basophils by injecting anti-FceRIa or left the mice undepleted. erythrin-binding basophils were detectable after a single immuniza- After allowing the mice to ‘rest’ for 2 d, we restimulated them by tion with phycoerythrin in the absence of an adjuvant, which indicated intraperitoneal injection of 100 mg APC. We measured the plasma that phycoerythrin-specific IgE was present (data not shown). At concentrations of APC-specific IgG1 and IgG2a at several time 5 weeks after primary immunization, we depleted one group of points after restimulation using two different types of enzyme-linked basophils and left the control group undepleted. After 2 d, we immunosorbent assay (ELISA): we either coated the plates with restimulated mice with 100 mg phycoerythrin intraperitoneally APC and detected APC-specific immunoglobulins with isotype- and then quantified phycoerythrin-specific IgG1 in the plasma specific secondary antibodies, or we coated the plates with isotype- at several time points after restimulation; it was significantly specific antibodies and detected APC-specific immunoglobulins lower, by 85–95%, in basophil-depleted mice (Fig. 4a). Total phyco- with biotinylated APC (Fig. 2b). At day 10 after restimulation, erythrin-specific immunoglobulins were significantly lower, by more APC-specific IgG1 plasma concentrations were significantly lower than 80% (P o 0.033), at day 7 after restimulation, and the frequency in the basophil-depleted group, at about 50% that of the control of phycoerythrin-specific plasma cells relative to total plasma cells group. APC-specific IgG2a concentrations were significantly lower, was significantly lower, by more than 50% (P o 0.032), in the spleen by 60–80%, depending on the type of ELISA used. In addition, on day 12 (data not shown). 736 VOLUME 9 NUMBER 7 JULY 2008 NATURE IMMUNOLOGY
    • ARTICLES 4 4 4 a 10 10 10 b APC APC-specific IgG1 3 3 3 ** 10 10 10 * 1.5 APC PBS IgE BM 2 2 2 (A450) 10 10 10 1 1 1 1 10 10 10 10 0 10 0 10 0 0.5 4 * 4 4 10 10 10 0 10 3 3 10 3 3 5 7 10 13 10 Time after immunization (d) APC PBS IgE Spleen 102 102 102 α-IgG1 APC-specific IgG1 1 1 1 10 10 10 * 1.2 0 0 0 * (A450) 10 10 10 © 2008 Nature Publishing Group http://www.nature.com/natureimmunology 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 0.8 CFSE CFSE CFSE 0.4 ** Figure 5 Enhancement of humoral immune responses by transfer of APC-reactive basophils. (a) Flow 0 3 5 7 10 13 cytometry of adoptively transferred CFSE-labeled cells from APC-immunized mice, obtained from the Time after immunization (d) spleen and bone marrow of naive acceptor mice at 24 h after transfer and stained with anti-IgE, APC APC-specific IgG2a APC (10 mg/ml) and PBS. Boxed areas (left), IgE+ basophils analyzed in middle and right plots. (b) ELISA of 0.2 NS plasma concentrations of APC-specific IgG1 and IgG2a in naive mice (n ¼ 10 per group) injected with (A450) PBS, with splenocytes and bone marrow cells from APC-immunized mice depleted in vitro of plasma 0.1 cells (CD138–), or with splenocytes and bone marrow cells from APC-immunized mice depleted in vitro of plasma cells and basophils (CD138–IgE–), then, 12 and 36 h later, immunized intraperitoneally with 0 10 mg APC; IgG1 and IgG2a were measured on plates coated with APC (plasma dilution, 1:1,000 and 3 5 7 10 13 1:30, respectively) and, for APC-specific IgG1, also on plates coated with anti-IgG1 (plasma dilution, Time after immunization (d) 1:250). NS (not significant), P ¼ 0.05 or more; *, P o 0.05; **, P o 0.01 (one-sided Student’s t-test). PBS CD138 – CD138– IgE – Data are representative of four (a) or three (b) independent experiments (error bars, s.e.m.). To exclude the possibility that mast cells contributed to the lower significantly lower APC-specific IgG1 and IgG2a concentrations after humoral memory response, we analyzed whether depletion of baso- restimulation in mast cell–deficient mice (Fig. 4b). phils in mast cell–deficient (WBB6F1-KitW/KitW-v) mice also resulted To demonstrate that basophils also had a considerable influence on in a lower humoral immune response after restimulation with APC. the humoral memory immune response to a pathologically relevant We first immunized mast cell–deficient mice with 100 mg APC mixed antigen and on the outcome of disease, we analyzed the effects of with heat-killed B. pertussis, and then, after 4 weeks, depleted the mice basophils in a vaccination-infection model. We immunized C57BL/6 of basophils with anti-FceRIa or left them undepleted. We restimu- mice with highly purified pneumococcal surface protein A (PspA) and lated the mice with 100 mg APC without adjuvant as described above. restimulated them with PspA in the presence or absence of basophils. Depletion of basophils was more difficult in these mice, as a complete PspA-specific IgG1 and IgG2a antibodies were significantly lower in and prolonged depletion of basophils was possible in only about half the basophil-depleted group at day 7 after restimulation (Fig. 4c). In a of the mice. We therefore used a higher dose of anti-FceRIa (10 mg second experiment, we infected mice intratracheally with S. pneumo- injected twice daily for 3 d) and included only mice with successful niae at 5 d after restimulation. It is well established that the humoral depletion of basophils to below 0.1% of total leukocytes in the immune response to PspA protects mice from invasive peripheral blood. Successful depletion of basophils also resulted in S. pneumoniae–induced infection and sepsis36–38. The rate of sepsis a b PBS IL-3 α-FcεRlα 300 300 Without With CFSE (B cells) CFSE (B cells) 15 basophils basophils 200 200 B cells 10 100 100 5 0 0 0 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 104 0 0.08 0.4 2 10 N0 – α-IL-4 α-IL-6 α-IL-4 3 Basophils (× 10 ) baso α-IL-6 CFSE CFSE Figure 6 Activated basophils support B cell function. (a) Proliferation of c IL-4 IL-6 d IgM IgG1 CFSE-labeled B cells cultured for 3 d with CD4+ T cells and anti-CD3 Cytokine (ng/ml) 0.6 and with or without activated basophils (lower CFSE content indicates Ig (A 450) 2 proliferation). (b) Proliferation of CFSE-labeled B cells in a 3-day 0.4 coculture with CD4+ T cells, anti-CD3 and various numbers of 1 0.2 nonactivated basophils (left horizontal axis), as well as PBS, IL-3 and anti-FceRIa, and blocking anti-IL-4 and/or anti-IL-6 (right horizontal 0 0 axis); right, basophils absent (No baso) or present at a density of 1 Â Basophils – + – + – + Basophils – + – + – + 4 cells per well. (c) ELISA of IL-4 and IL-6 in some of the Stimulation – α-FcεRlα IL-3 Time (d) 3 5 7 10 culture conditions described in b (below graph) without (–) or with (+) 1 Â 104 basophils. (d) ELISA of the production of IgM and IgG1 by 3- to 7-day coculture of B cells and CD4+ T cells (15 Â 104 of each) with anti-CD3 and with (+) or without (–) 3 Â 104 activated basophils (24-well plate; culture volume, 1 ml). Cell culture experiments were done in duplicate (b,c) or triplicate (d). Data are representative of more than ten (a) or three (b–d) independent experiments (error bars, s.e.m.). NATURE IMMUNOLOGY VOLUME 9 NUMBER 7 JULY 2008 737
    • ARTICLES Figure 7 Basophil-derived IL–6 is required for B cell stimulation. Proliferation and immunoglobulin production of CFSE-labeled B cells CD4 (WT), CD19 (WT) (CD19) in 3-day and 7-day cultures, respectively, with CD4+ T cells (CD4), CFSE (B cells) 800 Baso (WT) –/– CD4 (Il6 ), CD19 (Il6 –/– ) anti-CD3 and various numbers (horizontal axes) of activated basophils Baso (WT) (Baso); cells were from wild-type mice (WT) or IL-6-deficient mice (Il6–/–). 400 CD4 (WT), CD19 (WT) Cell culture experiments were done in duplicate. Data are representative of –/– Baso (Il6 ) two independent experiments (error bars, s.e.m.). CD4 (Il6 –/– ), CD19 (Il6 –/– ) 0 –/– Baso (Il6 ) 0 4 20 100 injected a third group of mice with PBS alone. We then immunized all Activated basophils (×102) mice intraperitoneally with 10 mg APC at 12 h and 36 h after cell transfer or PBS injection. On days 7, 10 and 13 after immunization, © 2008 Nature Publishing Group http://www.nature.com/natureimmunology 0.3 2 APC-specific IgG1 antibodies were significantly higher, by about 100%, in the group that received APC-reactive basophils. APC-specific IgG1 (µg/ml) IgM (A450) 0.2 IgG2a antibodies were nonsignificantly higher in the group with APC- 1 reactive basophils. The group of mice that received only PBS devel- 0.1 oped only very low APC-specific antibody titers after stimulation with APC and was included to demonstrate that a memory-type immune 0 0 0 8 40 200 0 8 40 200 response occurred after adoptive transfer of cells in the other two Activated basophils (× 10) Activated basophils (× 10) groups (Fig. 5b and Supplementary Fig. 10 online). Because all the groups of mice had endogenous basophils that did not react to APC, (as determined by the presence of live S. pneumoniae in the peripheral the ability of transferred APC-reactive basophils to bind and react to a blood) was significantly higher when the second vaccination with PspA specific antigen was important for the enhancement of a humoral was done in the absence of basophils (Fig. 4d). There were five and ten memory immune response. Adoptive transfer of splenocytes and bone septic mice on days 1 and 3, respectively, in the basophil-depleted marrow cells depleted only of plasma cells resulted in significantly group but only one and four on days 1 and 3, respectively, in higher APC-specific IgG1 antibodies than did adoptive transfer of the control group. As further control, we infected nonimmunized splenocytes and bone marrow cells depleted of both plasma cells C57BL/6 mice in the presence or absence of basophils. As expected, and basophils. naive mice had a much higher rate of sepsis and much lower survival after infection with S. pneumoniae than did immunized mice. However, Influence of basophils on B cells and T cells in vitro the presence or absence of basophils did not significantly influence the In vivo, activated basophils support the humoral immune response, as rate of sepsis or survival of nonimmunized mice (Fig. 4d). assessed by the appearance of antigen-specific plasma cells, B cells and immunoglobulins. Proliferation of B cells is considered a prerequisite Memory enhancement by antigen-reactive basophils for differentiation into antibody-secreting plasma cells39. We therefore We immunized donor mice twice at a 4-week interval with 100 mg investigated the influence of activated and nonactivated basophils on APC mixed with heat-killed B. pertussis and, at 4 weeks after the the proliferation of B cells and the production of immunoglobulins second immunization, adoptively transferred splenocytes and bone marrow cells from immunized C57BL/6 donor mice into naive 10 CFSE (× 102; B cells) C57BL/6 acceptor mice. Using donor cells labeled with the cytosolic + + 8 CD4 , CD19 , α-CD3 dye CFSE, we first analyzed if donor-derived antigen-reactive baso- CD4 , CD19+ + phils were detectable in the spleen and bone marrow of acceptor mice. 6 + CD19 At 24 h after cell transfer, CFSE+ basophils constituted about 6% of 4 the endogenous basophils in the spleen and 2% of the endogenous 2 basophils in the bone marrow; about 50% of the transferred basophils 0 retained the ability to bind APC on their surface, whereas endogenous 0 5 10 30 3 basophils were unable to bind APC (Fig. 5a). Activated basophils (× 10 ) To study the contribution of basophils to the generation of the 1.6 humoral memory response, we gave one group of naive mice 0.3 IL-10 (ng/ml) IL-4 (ng/ml) 1.2 splenocytes and bone marrow cells depleted of CD138+ plasma cells 0.2 and IgE+ basophils, and gave a second group splenocytes and bone 0.8 marrow cells depleted only of CD138+ plasma cells. We achieved 0.1 0.4 depletion of plasma cells and basophils in vitro with magnetic beads and confirmed that it was nearly complete (Supplementary Fig. 9 0 0 0 5 10 30 0 5 10 30 online). We depleted the cells of plasma cells to decrease ‘background’ 3 Activated basophils (× 10 ) Activated basophils (× 103) antibody production due to adoptively transferred plasma cells. We 3 IL-13 (ng/ml) 0.2 IL-6 (ng/ml) Figure 8 Influence of CD4+ T cell activation on basophil-induced B cell 2 proliferation and cytokine production. Proliferation of CSFE-labeled B cells 0.1 (top) and cytokine production (middle and bottom) in 3-day cultures of 1 various combinations of CFSE-labeled B cells (CD19+), CD4+ T cells (CD4+) and anti-CD3, plus various numbers of activated basophils. Cell culture 0 0 0 5 10 30 0 5 10 30 experiments were done in duplicate. Data are representative of two 3 independent experiments (error bars, s.e.m.). Activated basophils (× 10 ) Activated basophils (× 103) 738 VOLUME 9 NUMBER 7 JULY 2008 NATURE IMMUNOLOGY
    • ARTICLES a b 1.2 c 8 CFSE (× 102; B cells) Target/housekeeper 16 0.4 1.0 30 Cytokine (ng/ml) 0.8 6 0.3 Ig (A450) 12 20 0.6 0.2 4 8 0.4 10 4 0.1 2 0.2 0 0 0 0 0 Resorted CD4+ 0 1 5 10 10 10 10 10 IgM IgG1 IL-4 IL-5 IL-6 IL-10 IL-13 GATA-3 IL-2 IL-4 IL-6 IL-10 IL-13 T cells (× 103) α-IL-4 α-IL-6 α-IL-4 α-CD40L α-IL-6 © 2008 Nature Publishing Group http://www.nature.com/natureimmunology 4 d 10 103 No baso 102 Figure 9 Basophils induce a ‘B helper’ phenotype in CD4+ 1 41 % 89 % 0.7 % 0.5 % 0.8 % 10 T cells. (a–c) CD4+ T cells were prestimulated for 3 d with 100 anti-CD3 plus B cells without basophils (gray bars) or with 104 1 Â 104 activated basophils (black bars) and resorted by With baso 3 10 flow cytometry. (a) Proliferation (left) and immunoglobulin 10 2 (Ig) production (right) of CFSE-labeled B cells cultured for 10 1 7% 25 % 9.1 % 2.3 % 5.8 % 3 d and 7 d, respectively, with various numbers of resorted 0 10 0 1 1 10 10 102 103 104 100 10 102 103 104 100 101 102 103 104 100 101 102 103 104100 101 102 103 104 CD4+ T cells (1 Â 104 cells for immunoglobulin production) IFN-γ IL-2 IL-4 IL-6 IL-10 and with 4 Â 104 freshly isolated CD4+ T cells, anti-CD3 and IL-2, plus various combinations of anti-IL-4, anti-IL-6 and anti-CD40L (below left graph). (b) Quantification of cytokines in a 3-day culture of 1 Â 104 resorted CD4+ T cells, 4 Â 104 freshly isolated T cells, 5 Â 104 B cells, anti-CD3 and IL-2. (c) Real-time RT-PCR quantification of the expression of GATA-3 and various cytokines (‘Target’) by resorted CD4+ T cells, presented relative to the expression of Hprt1 (‘housekeeper’). (d) Intracellular cytokine staining of CD4+ T cells stimulated for 2 d with B cells and anti-CD3 in the presence (With baso) or absence (No baso) of 1 Â 104 activated basophils. Cell culture experiments were done in duplicate. Data are representative of three (a,d) or two (b,c) independent experiments (error bars, s.e.m.). (IgM and IgG1) in vitro. We avoided surface staining of IgE or its Basophils also profoundly altered the phenotype of CD4+ T cells receptor in the isolation of basophils, as such staining strongly in vitro. CD4+ T cells preactivated with anti-CD3 in the presence of activated basophils in subsequent cultures (data not shown). activated basophils efficiently supported B cell proliferation and When activated basophils were present in the coculture of CD4+ immunoglobulin production (IgM and IgG1) in a second culture T cells activated with anti-CD3 and B cells, there was considerable with freshly isolated B cells (Fig. 9a and Supplementary Fig. 13 proliferation of B cells, as assessed by the lower CFSE content of B cells online). In this case, B cell support was almost completely dependent (Fig. 6a). As few as 80–400 basophils activated with IL-3 or anti- on IL-4, IL-6 and CD40L (Fig. 9a). We used ELISA, intracellular FceRIa enhanced B cell proliferation (Fig. 6b); nonactivated basophils cytokine staining and real-time RT-PCR to characterize the phenotype had little effect on B cell proliferation. Basophil-induced B cell of CD4+ T cells after activation in the presence or absence of activated proliferation could be partially blocked with monoclonal anti-IL-6 basophils. T cell activation in the presence of basophils resulted in and could be completely blocked with a combination of anti-IL-6 and considerable upregulation of IL-4, IL-5, IL-10, IL-13 and the tran- anti-IL-4 (Fig. 6b and Supplementary Fig. 10); blocking IL-4 alone scription factor GATA-3, minor upregulation of IL-6, and considerable had little effect. Consistent with those data, much higher concentra- downregulation of interferon-g and IL-2 (Fig. 9b–d). We also deter- tions of IL-4 and IL-6 were detectable in the coculture of activated mined that in a coculture of CD4+ T cells and activated basophils, the basophils plus activated T and B cells (Fig. 6c). IL-4 and IL-6 were overall release of IL-6 was mostly independent of T cells, the overall necessary but not sufficient for the induction of B cell proliferation, as release of IL-4 was three- to fourfold higher, and IL-10 or IL-13 were the addition of IL-4 and IL-6 was less effective than the presence of only released in the presence of activated T cells (Fig. 8, bottom). We activated basophils (data not shown). Soluble as well as contact- did not detect release of IL-13 by activated basophils in the absence of dependent factors from basophils were necessary for full support of activated T cells (Fig. 8). Release of IL-10 and IL-13 was completely B cell proliferation, as shown by the transfer of cell culture super- dependent on the presence of IL-4 and IL-6 (Supplementary Fig. 14 natants from activated basophils and by Transwell filter experiments online). Collectively, our in vitro results showed that activated baso- (Supplementary Fig. 11 online). Blockade of CD40L, known to be phils provided considerable support for B cell proliferation and expressed on basophils23, partially decreased B cell proliferation immunoglobulin production by a mechanism dependent on CD4+ (Supplementary Fig. 11). Activated basophils not only supported T cells as well as a mechanism dependent on IL-4, IL-6 and contact. B cell proliferation but also induced the production of IgM and IgG1 Activated basophils substantially altered the phenotype of CD4+ in the presence of activated CD4+ T cells (Fig. 6d). Basophil-derived T cells toward a B helper–like and T helper type 2–like phenotype IL-6, but not IL-6 produced or induced in B cells or activated T cells, (Supplementary Fig. 15 online). was required for the enhancement of B cell proliferation and immu- noglobulin production, as shown with IL-6-deficient mice (Fig. 7). DISCUSSION Activated CD4+ T cells were absolutely required for the B cell– In this study, we have shown that basophils are important in the supportive effects of basophils, as incubation of B cells together development of a humoral memory response and suggest the follow- with activated basophils or with activated basophils and nonactivated ing model. Antigen-specific IgE produced for prolonged periods of CD4+ T cells did not result in B cell proliferation (Fig. 8). Activated time after primary immunization is captured by high-affinity IgE CD8+ T cells did not support B cell proliferation in the presence of receptors on basophils. After rechallenge with antigen, basophils activated basophils but decreased B cell proliferation occurring in the efficiently bind free antigen and become activated to release IL-4 presence of activated CD4+ T cells (Supplementary Fig. 12 online). and IL-6. Soluble factors (such as IL-6 and IL-4), as well as cell NATURE IMMUNOLOGY VOLUME 9 NUMBER 7 JULY 2008 739
    • ARTICLES contact–dependent factors from activated basophils, are required for most mice but also fewer mast cells in the peritoneal lavage. Moreover, full B cell support (proliferation, immunoglobulin production and we found that anti-FceRIa induced the release of IL-4 and IL-6 from plasma cell development). Basophils act together with activated CD4+ basophils in vitro; however, in vivo it failed to induce the release of T cells to support B cells and to induce a profound ‘B helper’ IL-4 and IL-6 from in the spleen or bone marrow, as measured 2 d phenotype in CD4+ T cells. Although the effects of IL-4, IL-6 and after the final injection of the antibody. The most likely explanation CD40L on T cell and B cell function are well characterized40–44, it has for this difference is that the depletion of basophils induced by anti- not been appreciated so far that basophils provide considerable FceRIa occurs very rapidly (in less than 4 h). support for the humoral memory response in vivo and are important The results of several experiments indicate that it is very unlikely for the outcome in a vaccination-infection model in mice. that mast cells in addition to basophils make a substantial contribu- Because of the lack of antigen-specific immunoglobulins in a tion to the support of a humoral memory immune response. First, © 2008 Nature Publishing Group http://www.nature.com/natureimmunology primary immune response, basophils cannot be activated during depletion of basophils in mast cell–deficient mice also resulted in primary immunization by the classical immunoglobulin Fc receptor, significantly lower antibody titers after restimulation with an antigen. especially the FceRI-dependent pathway. However, as detailed above, Second, splenocytes and bone marrow cells used for adoptive transfer there are several alternative stimuli for basophil activation that may did not include mature mast cells (c-Kit+IgE+ or c-Kit+FceRIa+), and allow basophil activation during a primary response or may contribute all IgE+ cells in the spleen and bone marrow that were stained and to basophil activation during a memory immune response. In naive depleted with anti-IgE (R35-72) were CD49b+c-Kit– basophils. Third, mice, we did not detect basophil-dependent release of IL-4 or IL-6 in bone marrow–derived mast cells cultured for 1 or 3 weeks with IL-3 the spleen and bone marrow even when mice were immunized with and stem cell factor did not support B cell proliferation in vitro, APC or when splenocytes and bone marrow cells were incubated with whereas bone marrow–derived or freshly isolated basophils did sup- APC in vitro (data not shown). In addition, in contrast to depletion of port B cell proliferation. basophils before secondary immunization, depletion of basophils The percentage of basophils necessary to support B cell proliferation before primary immunization did not alter the humoral immune in vitro (0.1% of total cells) correlates very well with the frequency of response to APC injected either with or without adjuvant (data not basophils in the spleen (0.1–0.5% of leukocytes). Moreover, the shown). We also investigated if Fc receptor–independent activation of stimuli used to activate basophils in vivo and in vitro are fairly basophils takes place during a memory immune response to APC. In comparable, as antibodies to surface IgE or IgE receptors and IL-3 FcRg-deficient mice, which lack expression of FcgRI/III and FceRI, we induce about the same amount of activation of basophils as does found no basophil-dependent release of IL-4 and IL-6 after restimula- incubation of ‘sensitized’ basophils with an antigen. We have shown tion with APC in vivo or in vitro, which indicated that antigen-specific that basophil-derived IL-6 and IL-4, as well as help from CD4+ T cells, immunoglobulins and their receptors are absolutely required for which are endowed with B helper cell function after contact with basophil activation during a memory immune response to a conven- activated basophils, were necessary for full B cell function in vitro. tional protein antigen. Consistent with published data (obtained These data complement our in vivo findings that basophils were the mainly with mast cells)25,45–47, we found that FceRI was not absolutely main source of IL-6 and IL-4 in the spleen and bone marrow after required for the activation of sensitized basophils, as basophils from rechallenge with antigen and that basophils were an important cellular APC-immunized FceRI-deficient mice could be activated in vitro with component supporting humoral memory responses not only to model APC. However, in vivo, FceRI-deficient mice released less IL-4 and antigens such as APC and phycoerythrin but also in the biologically IL-6 in the spleen and bone marrow after restimulation with APC (10– relevant situation of vaccination and infection with a pathogen. 30% of the cytokine release of wild type-mice; data not shown). In addition, we were unable to detect any binding of APC to sensitized METHODS basophils from FcRg- or FceRI-deficient mice, most likely because the Mice and immunization. Female C57BL/6 mice at least 8 weeks of age (Elevage low-affinity interaction of immunoglobulins with FcgRII/III (FcgRI is Janviere) were used, if not specified otherwise. Mice deficient in IL-6 (Il6–/–), not expressed on basophils) does not allow detection by flow cyto- IL-4 (Il4–/–) or FceRIa (Fcer1a–/–) and mast cell–deficient mice (WBB6F1- metry. We also noticed basophil-dependent release of IL-4 and IL-6 for KitW/KitW-v) were from The Jackson Laboratory12,45,48. Mice deficient in FcRg up to 72 h after antigen rechallenge in the spleen but not in the bone (Fcer1g–/–)49 were from Taconic Farms. Primary immunization of mice was marrow, where basophil activation was detectable only for up to 4 h achieved by intraperitoneal injection of 100 mg APC or 100 mg phycoerythrin (Prozyme) mixed with 2 Â 109 heat-killed B. pertussis or in the absence after rechallenge. That correlates with our finding that at 4 h after of adjuvant. Restimulation with APC, phycoerythrin or PspA was done restimulation, antigen (APC) was detectable on basophils in the spleen without adjuvant. All animal experiments were approved by local govern- and the bone marrow, but at 16 h after restimulation, APC was mental authorities. detectable mainly on basophils in the spleen. Even in the spleen, the amount of APC on basophils rapidly and homogeneously decreased Immunization with PspA and infection with S. pneumoniae. S. pneumoniae within the first 16 h without the appearance of distinct populations of capsular group 3 strain A66.1 was grown in Todd-Hewitt broth (Difco) APC+ and APC– basophils. This indicates that the turnover of antigens supplemented with 0.1% (wt/vol) yeast extract to mid-log phase, then was bound to basophils is short and that the decrease in the number of ‘snap-frozen’ in liquid nitrogen and stored at –80 1C (ref. 37). S. pneumoniae APC+ basophils mainly resulted from a decrease of the concentration was quantified by determination of colony-forming units on sheep blood of APC and not from the death of some APC+ basophils and their agar plates (BD Biosciences) incubated for 18 h at 37 1C (ref. 50). On day 0, replacement by ‘naive’ basophils. C57BL/6 mice were immunized by intraperitoneal injection of 10 mg highly purified PspA37 without adjuvant. From day 21 to day 23, mice were depleted The protocol we have developed for the depletion of basophils of basophils or not, as described below. On day 25, mice were restimulated with differs in some ways from a protocol developed independently22. We 20 mg PspA without adjuvant. Blood was obtained on days 5, 7 and 10 after used a much lower total dose of anti-FceRIa (MAR-1; 30 mg versus restimulation for measurement of PspA-specific IgG1 and IgG2a. Alternatively, 200 mg), injected the antibody at shorter time intervals and used anaesthetized, orotracheally intubated mice were intratracheally infected on day intraperitoneal instead of intravenous injection. With our protocol, we 30 with freshly thawed aliquots of S. pneumoniae A66.1, adjusted to a dose achieved not only a complete and prolonged depletion of basophils in of 4.5 Â 106 colony-forming units per mouse. In control experiments, 740 VOLUME 9 NUMBER 7 JULY 2008 NATURE IMMUNOLOGY
    • ARTICLES nonimmunized mice were depleted of basophils or not and were infected with 104 activated basophils. Phorbol 12-myristate 13-acetate (10 ng/ml) and S. pneumoniae A66.1 according to the protocol and time schedule described ionomycin (1 mg/ml) were added during the final 4 h and brefeldin A above. Mice were monitored daily for bacteremia over an observation period of (5 mg/ml) was added during the final 2.5 h of culture. 1 week by collection of blood samples from the tail vein and plating of blood on sheep blood agar plates. ELISA. APC- and phycoerythrin-specific immunoglobulins were quantified by two different types of ELISA. In the first type, plates were coated with APC or In vivo depletion of basophils and restimulation. For depletion of basophils, phycoerythrin (10 mg/ml). After blockade with 3% (wt/vol) BSA, plasma mice were injected twice daily for 3 d with 5 mg anti-FceRIa (MAR-1; samples were applied to the plate at various dilutions. Biotinylated anti-IgG1 eBioscience) or an isotype control antibody, if not specified otherwise. Mice (A85-1) or anti-IgG2a (R19-15) followed by streptavidin–horseradish perox- were allowed to ‘rest’ for 2 d and then were restimulated intraperitoneally with idase (DakoCytomation) was used for detection. Horseradish peroxidase– © 2008 Nature Publishing Group http://www.nature.com/natureimmunology 100 mg APC or phycoerythrin without adjuvant. Where indicated, splenocytes conjugated polyclonal anti–mouse immunoglobulin (P260; DakoCytomation) and bone marrow cells were obtained at several time points after restimulation was used for detection of total immunoglobulin. For the second type of ELISA, and were cultured for 4 h without stimulation at a density of 2 Â 106 cells per plates were coated with anti-IgG1 (A85-1) or anti-IgG2a (R19-15). After 200 ml culture medium for analysis of cytokine release. blockade, plasma samples were applied and APC- or phycoerythrin-specific antibodies were detected with biotinylated APC or phycoerythrin (Prozyme), Spleen and bone marrow transfer. Donor mice were immunized twice at followed by horseradish peroxidase–labeled streptavidin. For measurement of a 4-week interval with 100 mg APC mixed with heat-killed B. pertussis. At total IgG1 or IgM in cell culture supernatants, a sandwich ELISA was done with 4 weeks after the second immunization, splenocytes and bone marrow cells the antibodies A85-3 and II/41 for coating and A85-1 and R6-60.2 for from the femur and tibia bones were collected and pooled. After samples detection, respectively. In some cases, purified mouse IgG1 (MOPC21; Sigma) were stained with biotinylated anti-CD138 (281-2), they were depleted of was included as a standard; otherwise, absorbance values are provided. ABTS plasma cells with anti-biotin microbeads (Miltenyi). Subsequently, half the cell (2,2¢-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid; Roche) was used as samples were depleted of basophils by being stained with a fluorescein color reagent. IL-4, IL-5, IL-6, IL-10 and IL-13 were measured with commer- isothiocyanate–labeled anti-IgE (R35-72) and anti–fluorescein isothiocyanate cially available ELISA kits (OptEIA; BDBioscience). For measurement of IL-4 microbeads (Miltenyi). Cells from both groups were counted and an capture antibody in spleen or bone marrow preparations (Fig. 1d,e and equal number of cells (98 Â 106) was injected intravenously; one acceptor Supplementary Figs. 2 and 7), cells were cultured directly on ELISA plates mouse received on average 50% of the splenocytes and bone marrow cells of coated with anti-IL-4 to avoid consumption of soluble IL-4. PspA-specific one donor mouse. immunoglobulins were quantified by sandwich ELISA with PspA (1 mg/ml) coating followed by incubation with mouse plasma and detection of bound Isolation and culture of cells. Splenocytes and bone marrow cells were immunoglobulins with biotinylated anti-IgG1 (A85-1) or anti-IgG2a (R19-15) depleted of basophils in vitro with fluorescein isothiocyanate-labeled anti-IgE followed by streptavidin–horseradish peroxidase. followed by anti–fluorescein isothiocyanate microbeads, for wild-type mice, or anti-CD49b microbeads, for FcRg-deficient or FceRIa-deficient mice, with LD Flow cytometry. The following antibodies and reagents were used for columns (130-042-901; Miltenyi). Cell samples were depleted of CD4+ T cells flow cytometry: fluorescein isothiocyanate–anti-CD45 (LCA; 30-F11), fluor- with anti-CD4 microbeads (Miltenyi). Basophils were enriched from spleno- escein isothiocyanate–anti-CD11b (M1/70), phycoerythrin–anti-CD19 or cytes and bone marrow cells with anti-CD49b microbeads (Miltenyi) and then phycoerythrin-indodicarbocyanine–anti-CD19 (1D3), phycoerythrin–anti- were stained with anti-CD45 (LCA; 30F11) and anti-CD49b (HMa2). Cells in CD11c or APC–anti-CD11c (HL3), phycoerythrin–anti-HLA-IA/IE (M5/ the lymphocyte gate with low expression of CD45 and high expression of 114.15.2), phycoerythrin-indodicarbocyanine–anti-CD4 or APC–anti-CD4 CD49b were then isolated by flow cytometry sorting on a FACSAria (BD). (RM4-5), phycoerythrin-indodicarbocyanine–anti-CD8 (53-6.7), phyco- When only activated basophils were needed, cells were sorted by flow cytometry erythrin–anti-c-Kit (2B8), phycoerythrin–anti-CD138 (281-2), phyco- after being stained with anti-IgE. If not otherwise specified, ‘activated baso- erythrin–anti-CD49b or APC–anti-CD49b (HMa2 or DX5), streptavidin- phils’ indicates basophils activated by preincubation with anti-IgE during phycoerythrin or streptavidin–phycoerythrin-cyanine 5.5, and fluorescein the isolation procedure. The purity of isolated basophils was routinely over isothiocyanate–anti-IgE or biotin–anti-IgE (R35-72; all from BDBioscience); 90%, as determined by expression of surface IgE and CD49b. CD4+ T cells, biotin–anti-FceRIa (MAR-1; eBiosciences); and APC or phycoerythrin CD8+ T cells and CD19+ B cells were isolated by microbeads (Miltenyi) with a (10 mg/ml; Prozyme). For intracellular staining, cells were treated with Fix/ purity of over 95%. For measurement of cell proliferation, B cells were stained Perm and Perm/Wash solutions (BD Bioscience) according to the manufac- for 15 min at 37 1C with 1–5 mM CFSE (carboxyfluorescein diacetate turer’s instructions and were stained with APC (0.1 mg/ml) or phycoerythrin succinimidyl diester). B cells were cultured for 3 d (for measurement of (0.1 mg/ml), or with phycoerythrin-labeled anti-interferon-g (H22), anti-IL-2 proliferation) or for up to 7 d (for measurement of immunoglobulin produc- (JES6-5H4), anti-IL-4 (30340.11), anti-IL-6 (MP520F3) and anti-IL-10 tion) with CD4+ T cells polyclonally activated with anti-CD3 (0.5 mg/ml; (JEF052A5; all from BD Bioscience). Where applicable, red blood cells were 145-2C11) and basophils activated with IL-3 (10 ng/ml), anti-FceRIa lysed with FACS Lysing Solution (BD Bioscience) and cells were analyzed on a (0.5 mg/ml; MAR-1) or anti-IgE (0.5 mg/ml; R35-72). If not otherwise specified, FACSCalibur with CellQuest software (BD Bioscience). 5 Â 104 B cells and 5 Â 104 T cells were used and all cells were cultured in 96- Real-time PCR analysis. Total RNA was isolated from resorted CD4+ T cells well U-bottomed plates in 200 ml RPMI 1640 medium with 10% (vol/vol) FCS, with Qiagen RNeasy Columns and was reverse-transcribed with oligo(dT) penicillin-streptomycin, nonessential amino acids, 1 mM sodium pyruvate and reverse transcriptase (Invitrogen). A Light Cycler (Roche) and the and 50 mM b-mercaptoethanol. Blocking anti-IL-4 (30340.11), anti-IL-6 QuantiTect SYBR Green PCR kit (Qiagen) were used for real-time PCR (MP520F3) and anti-CD40L (MR1) were used at a concentration of 50 mg/ml. (oligonucleotides, Supplementary Table 1 online). The expression of each Where indicated, Transwell filter plates were used (polyester membranes gene was quantified in calculated units according to its standard curve and the with pore size of 0.4 mm; Costar). In some experiments, CD4+ T cells were cycle threshold of signal detection and is presented relative to expression of the resorted by flow cytometry after 3 d of culture with B cells and anti-CD3 in ‘housekeeping’ gene Hprt1 (encoding hypoxanthine guanine phosphoribosyl the presence or absence of 1 Â 104 activated basophils. Resorted CD4+ T cells transferase 1). were used either directly for mRNA isolation or for a second culture. When a second culture was done, resorted CD4+ T cells were cultured in 200 ml Statistical analysis. Statistical significance was calculated with a one-sided medium with 4 Â 104 freshly isolated CD4+ T cells, 5 Â 104 freshly isolated Student’s t-test. Statistical significance of the appearance of bacteremia in B cells, anti-CD3 and IL-2 (10 U/ml) for 3 d for measurement of B cell and survival of S. pneumoniae–infected mice was calculated by Kaplan- proliferation and cytokine production or for 7 d for measurement of immu- Meier analysis. noglobulin production. For intracellular cytokine staining, CD4+ T cells were activated for 2 d with B cells and anti-CD3 in the presence or absence of 1 Â Note: Supplementary information is available on the Nature Immunology website. NATURE IMMUNOLOGY VOLUME 9 NUMBER 7 JULY 2008 741
    • ARTICLES ACKNOWLEDGMENTS 24. Ben-Sasson, S.Z., Le Gros, G., Conrad, D.H., Finkelman, F.D. & Paul, W.E. Cross- ¨ We thank K. Schmidbauer, M. Wondrak and N. Gobel for technical assistance, and linking Fc receptors stimulate splenic non-B, non-T cells to secrete interleukin 4 and ¨ D. Schlondorff for critical reading of the manuscript. Supported by the Deutsche other lymphokines. Proc. Natl. Acad. Sci. USA 87, 1421–1425 (1990). Forschungsgemeinschaft (M.M.) and the University Hospital Regensburg. 25. Seder, R.A. et al. Mouse splenic and bone marrow cell populations that express high- affinity Fce receptors and produce interleukon 4 are enriched in basophils. Proc. Natl. Acad. Sci. USA 88, 2835–2839 (1991). AUTHOR CONTRIBUTIONS 26. Min, B. et al. Basophils produce IL-4 and accumulate in tissues after infection with a A.D. contributed to the results in Figures 1–5; U.A.M., C.W., R.M., S.H. and Th2-inducing parasite. J. Exp. Med. 200, 507–517 (2004). D.E.B. contributed to the results in Figure 4c,d; M.R.G. contributed to the 27. Hessel, E.M. et al. Immunostimulatory oligonucleotides block allergic airway inflam- results in Figures 1 and 3; C.M. and L.A.K.-S., contributed to the results in mation by inhibiting Th2 cell activation and IgE-mediated cytokine induction. J. Exp. Figures 6–9; M.N. and Y.T. contributed to the results in Figures 1 and 6–9; and Med. 202, 1563–1573 (2005). 28. Hida, S., Tadachi, M., Saito, T. & Taki, S. Negative control of basophil expansion by M.M. contributed to the results in Figures 1–9. IRF-2 critical for the regulation of Th1/Th2 balance. Blood 106, 2011–2017 © 2008 Nature Publishing Group http://www.nature.com/natureimmunology (2005). Published online at http://www.nature.com/natureimmunology/ 29. Oh, K., Shen, T., Le Gros, G. & Min, B. Induction of Th2 type immunity in a mouse Reprints and permissions information is available online at http://npg.nature.com/ system reveals a novel immunoregulatory role of basophils. Blood 109, 2921–2927 reprintsandpermissions/ (2007). 30. Khodoun, M.V., Orekhova, T., Potter, C., Morris, S. & Finkelman, F.D. Basophils initiate IL-4 production during a memory T-dependent response. J. Exp. Med. 200, 857–870 1. McHeyzer-Williams, L.J., Malherbe, L.P. & McHeyzer-Williams, M.G. Checkpoints in (2004). memory B-cell evolution. Immunol. Rev. 211, 255–268 (2006). 31. Takai, T., Ono, M., Hikida, M., Ohmori, H. & Ravetch, J.V. Augmented humoral 2. Zinkernagel, R.M. & Hengartner, H. Protective ‘immunity’ by pre-existent neutralizing and anaphylactic responses in FcgRII-deficient mice. Nature 379, 346–349 antibody titers and preactivated T cells but not by so-called ‘immunological memory’. (1996). Immunol. Rev. 211, 310–319 (2006). 32. Kuhn, R., Rajewsky, K. & Muller, W. Generation and analysis of interleukin-4 deficient 3. Manz, R.A., Thiel, A. & Radbruch, A. Lifetime of plasma cells in the bone marrow. mice. Science 254, 707–710 (1991). Nature 388, 133–134 (1997). 33. Maurer, D. et al. Expression of functional high affinity immunoglobulin E receptors 4. Julius, M.H., Masuda, T. & Herzenberg, L.A. Demonstration that antigen-binding cells (FceRI) on monocytes of atopic individuals. J. Exp. Med. 179, 745–750 (1994). are precursors of antibody-producing cells after purification with a fluorescence- 34. Maurer, D. et al. Peripheral blood dendritic cells express FceRI as a complex composed activated cell sorter. Proc. Natl. Acad. Sci. USA 69, 1934–1938 (1972). of FceRIa- and FceRIg-chains and can use this receptor for IgE-mediated allergen 5. McHeyzer-Williams, L.J. & McHeyzer-Williams, M.G. Antigen-specific memory B cell presentation. J. Immunol. 157, 607–616 (1996). development. Annu. Rev. Immunol. 23, 487–513 (2005). 35. Kita, H. et al. Does IgE bind to and activate eosinophils from patients with allergy? 6. Fagarasan, S. & Honjo, T. T-independent immune response: new aspects of B cell J. Immunol. 162, 6901–6911 (1999). biology. Science 290, 89–92 (2000). 36. Langermann, S. et al. Protective humoral response against pneumococcal infection in 7. Mack, M. et al. Identification of antigen-capturing cells as basophils. J. Immunol. 174, mice elicited by recombinant bacille Calmette-Guerin vaccines expressing pneumo- 735–741 (2005). coccal surface protein A. J. Exp. Med. 180, 2277–2286 (1994). 8. Bell, J. & Gray, D. Antigen-capturing cells can masquerade as memory B cells. J. Exp. 37. Swiatlo, E., King, J., Nabors, G.S., Mathews, B. & Briles, D.E. Pneumococcal surface Med. 197, 1233–1244 (2003). protein A is expressed in vivo, and antibodies to PspA are effective for therapy in a 9. Wolniak, K.L., Noelle, R.J. & Waldschmidt, T.J. Characterization of (4-hydroxy-3- murine model of pneumococcal sepsis. Infect. Immun. 71, 7149–7153 (2003). nitrophenyl)acetyl (NP)-specific germinal center B cells and antigen-binding B220– 38. Gor, D.O., Ding, X., Briles, D.E., Jacobs, M.R. & Greenspan, N.S. Relationship between cells after primary NP challenge in mice. J. Immunol. 177, 2072–2079 (2006). surface accessibility for PpmA, PsaA, and PspA and antibody-mediated immunity to 10. Driver, D.J., McHeyzer-Williams, L.J., Cool, M., Stetson, D.B. & McHeyzer-Williams, systemic infection by Streptococcus pneumoniae. Infect. Immun. 73, 1304–1312 M.G. Development and maintenance of a B220– memory B cell compartment. (2005). J. Immunol. 167, 1393–1405 (2001). 39. Hasbold, J., Corcoran, L.M., Tarlinton, D.M., Tangye, S.G. & Hodgkin, P.D. Evidence 11. McHeyzer-Williams, L.J., Cool, M. & McHeyzer-Williams, M.G. Antigen-specific B cell from the generation of immunoglobulin G–secreting cells that stochastic mechanisms memory: expression and replenishment of a novel B220– memory B cell compartment. regulate lymphocyte differentiation. Nat. Immunol. 5, 55–63 (2004). J. Exp. Med. 191, 1149–1166 (2000). 40. Abbas, A.K., Murphy, K.M. & Sher, A. Functional diversity of helper T lymphocytes. 12. Prussin, C. & Metcalfe, D.D. 5. IgE, mast cells, basophils, and eosinophils. J. Allergy Nature 383, 787–793 (1996). Clin. Immunol. 117, 450–456 (2006). 41. Rincon, M., Anguita, J., Nakamura, T., Fikrig, E. & Flavell, R.A. Interleukin (IL)-6 directs 13. Gibbs, B.F. Human basophils as effectors and immunomodulators of allergic inflam- the differentiation of IL-4-producing CD4+ T cells. J. Exp. Med. 185, 461–469 (1997). mation and innate immunity. Clin. Exp. Med. 5, 43–49 (2005). 42. Kopf, M., Herren, S., Wiles, M.V., Pepys, M.B. & Kosco-Vilbois, M.H. Interleukin 6 14. Lantz, C.S. et al. Role for interleukin-3 in mast-cell and basophil development and in influences germinal center development and antibody production via a contribution of immunity to parasites. Nature 392, 90–93 (1998). C3 complement component. J. Exp. Med. 188, 1895–1906 (1998). 15. Kawakami, T. & Galli, S.J. Regulation of mast-cell and basophil function and survival by 43. Matsuda, T., Yamasaki, K., Taga, T., Hirano, T. & Kishimoto, T. Current concepts of IgE. Nat. Rev. Immunol. 2, 773–786 (2002). B cell modulation. Int. Rev. Immunol. 5, 97–109 (1989). 16. Valent, P. et al. Interleukin 3 activates human blood basophils via high-affinity binding 44. Seder, R.A. & Paul, W.E. Acquisition of lymphokine-producing phenotype by CD4+ sites. Proc. Natl. Acad. Sci. USA 86, 5542–5546 (1989). T cells. Annu. Rev. Immunol. 12, 635–673 (1994). 17. Bischoff, S.C., Brunner, T., De Weck, A.L. & Dahinden, C.A. Interleukin 5 modifies 45. Dombrowicz, D. et al. Absence of FceRIa chain results in upregulation of FcgRIII- histamine release and leukotriene generation by human basophils in response to dependent mast cell degranulation and anaphylaxis. Evidence of competition between diverse agonists. J. Exp. Med. 172, 1577–1582 (1990). FceRI and FcgRIII for limiting amounts of FcR b and g chains. J. Clin. Invest. 99, 18. Bischoff, S.C., Krieger, M., Brunner, T. & Dahinden, C.A. Monocyte chemotactic protein 915–925 (1997). 1 is a potent activator of human basophils. J. Exp. Med. 175, 1271–1275 (1992). 46. Miyajima, I. et al. Systemic anaphylaxis in the mouse can be mediated largely through 19. Yoshimoto, T. et al. IL-18, although antiallergic when administered with IL-12, IgG1 and FcgRIII. Assessment of the cardiopulmonary changes, mast cell degranula- stimulates IL-4 and histamine release by basophils. Proc. Natl. Acad. Sci. USA 96, tion, and death associated with active or IgE- or IgG1-dependent passive anaphylaxis. 13962–13966 (1999). J. Clin. Invest. 99, 901–914 (1997). 20. Geiser, T., Dewald, B., Ehrengruber, M.U., Clark-Lewis, I. & Baggiolini, M. The 47. Piccinni, M.P. et al. Human bone marrow non-B, non-T cells produce interleukin 4 in interleukin-8-related chemotactic cytokines GROa, GROb, and GROg activate human response to cross-linkage of Fce and Fcg receptors. Proc. Natl. Acad. Sci. USA 88, neutrophil and basophil leukocytes. J. Biol. Chem. 268, 15419–15424 (1993). 8656–8660 (1991). 21. Sokol, C.L., Barton, G.M., Farr, A.G. & Medzhitov, R. A mechanism for the initiation of 48. Kopf, M. et al. Impaired immune and acute-phase responses in interleukin-6-deficient allergen-induced T helper type 2 responses. Nat. Immunol. 9, 310–318 (2008). mice. Nature 368, 339–342 (1994). 22. Gauchat, J.F. et al. Induction of human IgE synthesis in B cells by mast cells and 49. Takai, T., Li, M., Sylvestre, D., Clynes, R. & Ravetch, J.V. FcR g chain deletion results in basophils. Nature 365, 340–343 (1993). pleiotrophic effector cell defects. Cell 76, 519–529 (1994). 23. Mukai, K. et al. Basophils play a critical role in the development of IgE-mediated 50. Winter, C. et al. Lung-specific overexpression of CC chemokine ligand (CCL) 2 chronic allergic inflammation independently of T cells and mast cells. Immunity 23, enhances the host defense to Streptococcus pneumoniae infection in mice: role of 191–202 (2005). the CCL2–CCR2 axis. J. Immunol. 178, 5828–5838 (2007). 742 VOLUME 9 NUMBER 7 JULY 2008 NATURE IMMUNOLOGY
    • 1 Supplementary information a Naive APC immun. Naive APC immun. IL-4-KO IL-4-KO IL-4-KO IL-4-KO 100 101 102 103 104100 101 102 103 104 100 101 102 103 104100 101 102 103 104 FL1-H FL1-H FL4-H FL4-H CD49b CD49b WT WT WT WT 100 101 102 103 104100 101 102 103 104 100 101 102 103 104100 101 102 103 104 IgE APC b WT WT IgE 10 0 101 102 103 10 4 100 101 102 10 3 104 FcRγ-KO FcRγ-KO IgE 10 0 101 102 103 10 4 100 101 102 10 3 104 FcεRI-KO FcεRI-KO IgE 10 0 101 102 103 10 4 100 101 102 10 3 104 APC Control Supplementary Figure 1. Antigen does not bind to basophils in immunized IL-4-KO, FcRγ-KO and FcεRI-KO mice. (a) Flow cytometry of splenocytes from C57BL/6 wild-type mice (WT) and IL-4-KO mice immunized twice with 100 µg APC + heat-killed B. pertussis at a 4 week interval (‘APC immun’) or remained naive. Five weeks after the second immunization splenocytes were stained in vitro either with α-CD49b and α-IgE to detect basophils or with APC (10 µg/ml) and α-CD49b to measure the ability of basophils to bind APC. (b) C57BL/6 wild-type mice (WT), FcRγ-KO and FcεRI-KO mice were immunized with APC as described above and stained in vitro with either APC (10 µg/ml) and α-IgE (left panels) or, as control, with α-IgE (right panels). Data are representative of five (a, b) independent experiments.
    • 2 a ** Splenocytes ** Bone marrow cells 100 Cytokines (pg/ml) 800 ** 80 600 60 IL-4 IL-4 * 400 40 IL-6 IL-6 20 200 0 0 – + – + – + – + – + – + – + – + – + – + – + – + Total Baso⎯ Total Baso⎯ Total Baso⎯ Total Baso⎯ Total Baso⎯ Total Baso⎯ WT FcRγ-KO FcεRI-KO WT FcRγ-KO FcεRI-KO b APC on basophils 1600 4h after APC 1200 16 h after APC 800 4h after PBS 400 0 Spleen BM c 0.3 ** Spleen Bone marrow Cytokines (ng/ml) 0.4 IL-4 ** IL-6 0.2 IL-4 0.2 0.1 IL-6 ** ** 0 0 Total Baso⎯ CD4⎯ Total Baso⎯ CD4⎯ – + – + – + – + – + – + Spleen BM Total Baso⎯ CD4⎯ Total Baso⎯ CD4⎯ Supplementary Figure 2. Antigen binding and activation of basophils. (a) ELISA assay of cells from wild-type mice (WT), FcRγ-KO mice and FcεRI-KO mice 4 wk after immunization with APC + heat-killed B. pertussis. Splenocytes and bone marrow cells were depleted of basophils (Baso–) or left undepleted (Total) in vitro and then 2 × 106 in 200 µl medium were cultured for 4 h with PBS (–) or 1 µg/ml APC (+) after which the concentration of IL-4 and IL-6 was measured. The results were reproduced twice (b) Flow cytometry of basophils from spleen and bone marrow (BM) from C57BL/6 wild-type mice (WT) mice six weeks after primary immunization with APC that were restimulated by intraperitoneal injection of 100 µg APC or PBS for 4 and 16 h. The mice were sacrificed and the amount of APC present on basophils was quantified on cells stained in vitro with an FITC-labelled α-IgE. The experiment was repeated two times. (c) ELISA assay on cells from either APC-immunized mice that were restimulated by intraperitoneal injection of 100 µg APC (left) or PE-immunized mice that were restimulated by intraperitoneal injection of
    • 3 100 µg PE (+) or PBS (–) (right). Two (left) and twenty-four (right) hours after restimulation splenocytes and bone marrow cells were prepared. For each population of cells they either remained undepleted (Total) or were depleted in vitro of basophils (Baso–) or of CD4+ T cells (CD4–) and then cultured for 4 h in plain medium and then release of IL-4 and IL-6 was measured. Data are the mean ± s.e.m. of three independent experiments (a, c) or are representative of two independent experiments (b).
    • 4 CD45 CD49b CD45 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 IgE IgE CD45 ckit CD45 ckit 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 CD49b IgE Supplementary Figure 3. Identification of basophils by various surface markers. Flow cytometry of splenocytes stained with the indicated combinations of α-IgE, α-CD45, α-CD49b and α-c-kit. Data are representative of more than ten independent experiments.
    • 5 a BM Spleen Liver CD49b Control 0 10 1 10 2 10 3 10 40 10 10 101 102 103 104100 101 102 103 104 CD49b Basophils depleted 100 101 102 103 104100 101 102 103 104100 101 102 103 104 IgE IgE IgE Basos (% of leukocytes) 1.2 Control 0.8 Basophils 0.4 depleted 0 BM Spleen Liver b PBS α-FcεRIα (5 µg/ml) 4 h, 37°C 4 h, 37° no wash C, MFI = 275 MFI = 265 CD49b 100 101 102 103 104100 101 102 103 104 IgE IgE Supplementary Figure 4. Depletion of basophils with α-FcεRIα. (a) Flow cytometry and quantification of basophils in C57BL/6 mice injected twice daily for 3 days with 5 µg of α-FcεRIα (n = 5, white bars, Basophils depleted) or with PBS (n = 5, black bars, Control). Two days after the last injection the numbers of basophils were quantified in the bone marrow, spleen and liver. A representative plot is shown in the upper panel and a quantification of basophils as percentage of total leukocytes is given in the lower panel. (b) Flow cytometry of bone marrow cells preincubated for 4 h at 37 °C with α-FcεRIα (5 µg/ml) or PBS; without washing, cells were then stained with α-CD49b and α-IgE to detect basophils. The same level of surface IgE (MFI, mean fluorescence intensity) was detectable on basophils in both groups. Data represent the mean ± s.e.m. of five independent experiments (a) or are representative of two independent experiments (b).
    • 6 Blood Spleen BM LN Spleen BM CD45 100 101 102 103 104100 101 102 103 104100 101 102 103 104100 101 102 103 104100 101 102 103 104100 101 102 103 104 FL2-H FL2-H FL2-H FL2-H FL2-H FL2-H CD49b 100 101 102 103 104100 101 102 103 104100 101 102 103 104100 101 102 103 104100 101 102 103 104100 101 102 103 104 FcεRI FcεRI FcεRI FcεRI Control Control FL2-H FL2-H FL2-H FL2-H FL2-H FL2-H Monocytes Dendritic cells Counts 10 0 10 1 10 2 103 104 100 10 1 10 2 10 3 10 4 FL3-H FL3-H Control ; FcεRI Control ; FcεRI Supplementary Figure 5. Reactivity of anti-FcεRIα (MAR-1). Flow cytometry of peripheral blood leukocytes (Blood), splenocytes (Spleen), bone marrow cells (BM) and lymph node cells (LN) incubated with 1 µg/ml biotinylated α-FcεRIα or PBS as control, followed by streptavidin-PE and α-CD45 and α- CD49b to detect basophils (upper panel) or with α-CD11b, α-MHCII and α-CD11c to detect monocytes and dendritic cells in the spleen (lower panel, grey area = PBS, thick line = α-FcεRIα). Data are representative of three independent experiments.
    • 7 a 1 4 5 6 CD11b CD11b MHC II 2 Control 3 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 FL4-H FL4-H FL2-H 1 4 5 6 CD11b CD11b MHC II Basophils 2 depleted 3 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 CD11c CD11c MHC II Control 4 50 % of PBMC (spleen) 3 Basophils depleted 40 2 5 30 1 6 20 2 1 3 10 0 0 Total CD11b+ CD11b⎯ Total MHCII⎯ MHCII+ CD4+ CD19+ DC DC DC monos monos monos % of peritoneal leukocytes Cells per mouse (x 1000) b 0.4 Peritoneal lavage 600 400 0.3 * 0.2 IgE 200 0.1 0 0 100 101 102 103 104 Peritoneal Mast cells c-kit leukocytes Supplementary Figure 6. The MAR-1 antibody (α-FcεRIα) does not deplete monocytes, dendritic cells, CD4+ T cells or B cells. (a) Flow cytometry of monocyte and dendritic cell subsets and CD4+ T cells and B cells quantified as percentage of total mononuclear cells in the spleen from mice depleted of basophils with α-FcεRIα as described (Basophils depleted, n = 3) or remained undepleted (Control, n = 3). Cells were evaluated two days after the final injection of α-FcεRIα. Total dendritic cells (population 1), CD11b+ dendritic cells (population 2), CD11b– dendritic cells (population 3), total monocytes (population 4), MHCII+ monocytes (population 5) and MHCII– monocytes (population 6) were identified by staining with α-CD11b, α-MHCII and α-CD11c and gating on the mononuclear cell population in the light scatter plots. Basophils were completely depleted in all α-FcεRIα–treated mice in the blood, spleen and bone marrow (data not shown). (b) Flow cytometry and quantification of mature mast cells (IgE+c-kit+) detectable in the peritoneal lavage in basophil-depleted mice. Data are representative of three (a) or four (b) independent experiments or represent the mean ± s.e.m. of three (a) or four (b) independent experiments.
    • 8 500 400 IL-4 Cytokines (pg/ml) IL-6 300 200 100 Basophil depletion No Yes No Yes No Yes Organ Spleen BM BM In vitro stimulation No stimulation α-FcεRIα Supplementary Fig. 7. Depletion of basophils with α-FcεRIα does not result in an increased basal release of cytokines two days after depletion. ELISA assay of supernatants from splenocytes and bone marrow cells (2 x 106 cells in 200 µl medium) cultured for 4 h with no stimulation in vitro or, for bone marrow cells, with the α-FcεRIα (0.5 µg/ml); splenocytes and bone marrow cells were from C57BL/6 mice depleted of basophils by injection of 5 µg of α-FcεRIα twice daily for three days (n = 4) or remained undepleted (n = 4). Data represent the mean ± s.e.m. of four independent experiments.
    • 9 Control Baso-depleted 1 CD19 2 Spleen 10 0 10 1 10 2 10 3 10 410 0 10 1 10 2 10 3 10 4 APC (10 µg/ml) extracellular 1 CD19 3 2 Spleen 10 0 10 1 10 2 10 3 10 410 0 10 1 10 2 10 3 10 4 FL4-H FL4-H CD19 3 2 BM 10 0 10 1 10 2 10 3 10 410 0 10 1 10 2 10 3 10 4 4 CD138 3 Spleen 10 0 10 1 10 2 10 3 10 410 0 10 1 10 2 10 3 10 4 FL4-H FL4-H 4 CD138 3 2 BM 10 0 10 1 10 2 10 3 10 410 0 10 1 10 2 10 3 10 4 APC (0.1 µg/ml) intracellular Supplementary Figure 8. Identification of APC specific B cells and plasma cells. Flow cytometry of APC-specific B cells (population 1) identified in the spleen by extracellular staining with APC (10 µg/ml) and antibodies against CD19 and IgE. Basophils (population 2) were double positive for APC and surface IgE (not shown). Example of one control and one basophil-depleted mouse from the group of mice described in Fig. 3b. No APC-specific B cells were detectable in the bone marrow (not shown). APC- specific plasma cells (population 3) and plasma cells not specific for APC (population 4) were identified by extracellular staining with antibodies against CD138 and CD19 and intracellular staining with APC (0.1 µg/ml) in the spleen and the bone marrow (BM). Data are representative of more than ten independent experiments.
    • 10 Total CD138⎯ CD138⎯ IgE⎯ CD138 0 101 102 103 104 100 101 102 103 104100 101 102 103 10410 FL1-H FL1-H FL1-H APC 0 101 102 103 104 100 101 102 103 104100 101 102 103 10410 FL1-H FL1-H FL1-H IgE IgE IgE Supplementary Figure 9. In vitro depletion of plasma cells and basophils for adoptive transfer experiments. Flow cytometry of bone marrow cells from APC immunized mice stained with APC (10 µg/ml, extracellular) and α-CD138 and α-IgE before depletion of cells (Total), after depletion of plasma cells (CD138–) or after depletion of plasma cells and basophils (138–IgE–). Data are representative of five independent experiments.
    • 11 a APC-specific IgG1 (OD) APC-specific IgG2a (OD) 0.16 PBS * CD138⎯ 0.6 0.12 CD138⎯ IgE⎯ 0.4 0.08 0.04 ** 0.2 0 0 3 5 7 11 3 5 7 11 Days after immunization Days after immunization b 1200 CFSE (B cells) 800 400 0 Basophils 0 1 5 10 10 20 40 (x 1,000) α-IL-4 α-IL-6 Supplementary Figure 10. Reproduction of some in vivo and in vitro results in BALB/c mice. (a) ELISA assays for antibody production in plasma of BALB/c mice after adoptive cell transfer as described in Fig. 5b (n = 10 mice per group). Plasma was diluted 1:2,000 for detection of APC specific IgG1 and 1:10 for detection of APC-specific IgG2a, with APC coated plates. (b) Proliferation assay, as measured by CSFE dilution, of B cells in coculture with anti-CD3 activated CD4+ T cells and various numbers of activated basophils. Antibodies against IL-4 and IL-6 were added in one sample (far right). Data are representative of one (a) or two (b) independent experiments.
    • 12 a 600 CFSE (B cells) Separated 400 Together 200 0 0 20,000 40,000 Activated basophils b 400 Without A: CFSE (B cells) basophils 300 With 200 B: basophils 100 0 No SN(A) SN(A) SN(B) SN(B) SN 50 % 30 % 50 % 30 % c CFSE (B cells) 1600 Control 1200 α-CD40L 800 400 0 0 1 5 10 20 Activated basophils (x 1,000) Supplementary Figure 11. Soluble and contact dependent basophil factors contribute to support B cells. (a-c) Proliferation assays, as measured by CSFE dilution, of B cells. (a) Anti-CD3 activated CD4+ T cells (100,000/well) and CFSE-labelled B cells (100,000/well) were cultured in the lower well of a 24 well transwell filter plate. Activated basophils were added at various numbers into the upper well (Separated) or into the lower well (Together). Proliferation of B cells was measured by flow cytometry after 3 days. (b) In a primary culture CD4+ T cells were activated with anti-CD3 and B cells for 3 days in the presence or absence of 25,000 activated basophils. Cell culture supernatant from the primary culture without basophils (SN(A)) or with basophils (SN(B)) was used at 30% or 50 % of total culture volume in a second culture of freshly isolated CFSE-labelled B cells and activated CD4+ T cells. (c) CSFE-labelled B cells cultured with various numbers of activated basophils and a blocking antibody against CD40L and anti- CD3 activated CD4+ T cells. Data are representative of two independent experiments (a-c).
    • 13 1000 CFSE (B cells) Without 800 basophils 600 30,000 400 basophils 200 0 CD4+ CD8+ CD4+ CD8+ Supplementary Figure 12. Basophil induced B cell proliferation is enabled by CD4+ T cells but not by CD8+ T cells. Proliferation assay, as measured by CSFE dilution, of B cells cultured with (white bars) or without (black bars) activated basophils in combination with anti-CD3 activated CD4+ T cells (50,000/well), with anti-CD3 activated CD8+ T cells (50,000/well) or a combination of both anti-CD3 activated CD4+ and CD8+ T cells (50,000 of each/well). CFSE dilution was measured by flow cytometry. Data are representative of two independent experiments.
    • 14 IgM release (OD) 0.06 0.04 0.02 Prestim. without 0 basophils Prestim. IgG1 release (ng/ml) with 500 basophils 400 300 200 100 0 0 1,000 5,000 10,000 Resorted CD4+ T cells Supplementary Figure 13. Basophils induce a ‘B helper’ phenotype in CD4+ T cells. Antibody production from CD4+ T cells prestimulated for 3 days with anti-CD3 and B cells in a first culture with (black bars) or without (grey bars) activated basophils and then the cells were resorted by flow cytometry. A secondary culture was then performed with various numbers of the resorted, prestimulated CD4+ T cells, 50,000 freshly isolated B cells, 40,000 freshly isolated CD4+ T cells, anti-CD3 and IL-2. After 7 days the concentrations of IgM and IgG1 were measured. Data are representative of two independent experiments.
    • 15 600 6 IL-4 (pg/ml) IL-6 (ng/ml) 400 4 200 2 0 0 500 120 IL-10 (pg/ml) 400 IL-13 (pg/ml) 300 80 200 40 100 0 0 α-IL-4 – + – + – + – + α-IL-4 – + – + – + – + α-IL-6 – – + + – – + + α-IL-6 – – + + – – + + No basophils 30,000 basophils No basophils 30,000 basophils Supplementary Figure 14. Basophil induced IL-10 and IL-13 production in CD4+ T cells is dependent on IL-4 and IL-6. ELISA assays on culture supernatants of CD4+ T and B cells cultured for 3 days with α-CD3 in the presence or absence of activated basophils. Blocking antibodies against IL-4 or IL-6 or both were then added as indicated. Data are representative of two independent experiments.
    • 16 a Gate on FcεRI+ 1 2 CD49b 1 = BMBA 2 = BMMC 100 101 102 103 104 100 101 102 103 104 FcεRI c-kit b IL-4 (pg/ml) TNF (pg/ml) IL-6 (ng/ml) 400 1.5 300 20 1 200 10 100 0.5 0 0 0 BMBA BMMC BMBA BMMC BMBA BMMC c B cell proliferation 600 CFSE (B cells) No stimulation 400 α-FcεRIα (0.5µg/ml) 200 0 – BMBA BMMC Supplementary Figure 15. Bone marrow-derived basophils, but not bone marrow-derived mast cells, enhance B cell proliferation. (a) Flow cytometry of bone marrow cells cultured for 1 week in medium containing IL-3 (10 ng/ml) and stem cell factor (50 ng/ml) and then stained for surface expression of CD49b, c-kit and FcεRI. BMBA, bone marrow derived basophils; BMMC, bone marrow derived mast cells. (b) ELISA assay on release of cytokines from cells in a stimulated in culture for 20 h with α-FcεRIα (0.5 µg/ml) (grey bars) or remained non-stimulated (black bars). (c) Proliferation of B cells induced by incubation with BMBA (5,000/well) or BMMC (5,000/well); proliferation was measured in a coculture of 50,000 B cells and 50,000 anti-CD3 activated CD4+ T cells. Data are representative of two independent experiments (a-c).
    • 17 Supplementary Table Supplementary Table 1. List of primers used for real time RT-PCR. Gata3 5’CTGGAGGAGGAACGCTAATG’3 5’GTTGAAGGAGCTGCTCTTGG’3 Il2 5’CCCACTTCAAGCTCCACTTC’3 5’ATCCTGGGGAGTTTCAGGTT’3 Il6 5’CCGGAGAGGAGACTTCACAG’3 5’CAGAATTGCCATTGCACAAC’3 Il4 5’TCAACCCCCAGCTAGTTGTC’3 5’TGTTCTTCGTTGCTGTGAGG’3 Il10 5’CCAAGCCTTATCGGAAATGA’3 5’TTTTCACAGGGGAGAAATCG’3 Il13 5’CAGCATGGTATGGAGTGTGG’3 5’AGGCCATGCAATATCCTCTG’3 Hprt 5’ATCAGTCAACGGGGGACATA’3 5’AACCTTAACCATTTTGGGGC’3