Circulation, Endocrinology, Hepatology,  Gastroenterology, Nephrology,  Bone & Joints,  Diabetes  Metabolism/Nutrition Jun...
projected global deaths (millions) Cardiovascular diseases: world leading cause of death Causes of death  in Europe cancer...
   29% of deaths in France   27% ischemic cardiopathies  25% strokes  23% cardiac failure Cardiovascular diseases in Fran...
DIABETES PREVALENCE 2010 International Diabetes Federation Atlas DIABETES PREVALENCE 2030 International Diabetes Federatio...
major scientific issues in common  cardiovascular and metabolic diseases  <ul><li>interindividual variations risk </li></u...
up to 5x10 6  ? 10 x 10 6  ? up to 2 megabases ? Copy Number Variation [CNVs] Single Nucleotide Polymorphism  [SNPs] GENET...
Metagenome paves the way to  future understanding of interactions  between genome and environment  in obesity and inflamma...
600 millions years Hotamisligil GS Nature 2006 THE ENVIRONMENTAL CHALLENGE the need for an integrative approach metabolic ...
Hyperlipidemia Hypertension  Insulin resistance Increased adiposity gut microbiota    antibiotics pancreas liver Vijay-Ku...
INSTITUT THÉMATIQUE MULTI-ORGANISMES (ITMO) Circulation, Métabolisme, Nutrition (CMN) research units: 201 (%) staff resear...
Domains Circulation, Diabetes  Endocrinology Gastro-enterology, Hepatology Metabolism/Nutrition Uro-Nephrology Osteo-artic...
PLATFORMS CHU Cohorts CRNH genomic epigenetic metagenomic metabolomic lipidomic biostatistics
Genetics, Genomics and Epigenetics at Inserm 163 research teams 99 19 7 5 4 2 1 Not at scale
A observatory of M-F in France French Network of Metabolomics PF PF 4 main centers 80% labs (56) Health lipidome metabolom...
CHUs University Hospitals > 80% funding
CICs Centers for  Clinical  Investigation cardiovascular CIC network
CICs Centers for  Clinical  Investigation thrombosis CIC network
CICs Centers for  Clinical  Investigation diabetes CIC network
CRNHs Human Nutrition Research Centers COHORTS Cohort SU.VI.MAX    Cohort SU.FOL.OM3  NUTRINET Internet FOOD CONSUMPTION A...
2ND INTERNATIONAL RESEARCH MEETING 1. FROM HUMAN GENOMICS TO SYSTEM PATHWAYS   What could academia and industry achieve to...
Upcoming SlideShare
Loading in …5
×

01&02 rencontres biomédicale Christian Boitard

1,185 views
1,054 views

Published on

2ND INTERNATIONAL RESEARCH MEETING
4 JUNE 2010- HÔTEL DE MARIGNY PARIS

Published in: Health & Medicine, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,185
On SlideShare
0
From Embeds
0
Number of Embeds
8
Actions
Shares
0
Downloads
0
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

01&02 rencontres biomédicale Christian Boitard

  1. 1. Circulation, Endocrinology, Hepatology, Gastroenterology, Nephrology, Bone & Joints, Diabetes Metabolism/Nutrition June 2010 Fields INSTITUT THÉMATIQUE MULTI-ORGANISMES (ITMO) Circulation, Métabolisme, Nutrition (CMN) Strategy from genetic background & mechanisms of initiation/progression to biomarkers & Innovative therapies
  2. 2. projected global deaths (millions) Cardiovascular diseases: world leading cause of death Causes of death in Europe cancer stroke ischemic heart disease ♀ coronary heart diseases stroke other cardiovascular diseases cancer other lung injury stroke coronary heart diseases other cardiovascular diseases cancer other lung injury ♂
  3. 3.  29% of deaths in France 27% ischemic cardiopathies 25% strokes 23% cardiac failure Cardiovascular diseases in France  hypertension: (adults > 20) 12-13.10 6  obesity:12.4% of adults in 2006  diabetes: 6.2% (20-70) glucose intolerance: 5.6% 10% health care expenses in France USA  50% 1997  2007
  4. 4. DIABETES PREVALENCE 2010 International Diabetes Federation Atlas DIABETES PREVALENCE 2030 International Diabetes Federation Atlas Yoon KH et al, Lancet 2006 HYPERTENSION PREVALENCE 2000 Kearney PM et al. Lancet 2005 developing countries USA HYPERTENSION PREVALENCE 2025 Kearney PM et al. Lancet 2005 developing countries USA
  5. 5. major scientific issues in common cardiovascular and metabolic diseases <ul><li>interindividual variations risk </li></ul><ul><li>wide variations in distribution, </li></ul><ul><li>within & between countries </li></ul><ul><li>increasing incidence </li></ul><ul><li>« the rising tide » </li></ul>
  6. 6. up to 5x10 6 ? 10 x 10 6 ? up to 2 megabases ? Copy Number Variation [CNVs] Single Nucleotide Polymorphism [SNPs] GENETIC DIVERSITY CGTTACGGCATCGAGCTGCTGCA TCGTTACGGC G TCGAGCTGCTGCA Concannon P & Nepom GT N Engl J Med 2009 GENETIC DIVERSITY IN DIABETES Single Nucleotide Polymorphism [SNPs] low Odds Ratios highly multigenic « normal genes » [gene variants ] 2377 participants 255  T2D [Framingham Offspring Study] Sex Family history Age BMI Fasting plasma glucose Systolic blood pressure HDL-Cholesterol Fasting triglycerides Meiggs JB et al. N Engl J Med 2008 Sex-adjusted reclassification by genotype score 4.1% 11.9% < 50 0.47 > 50 sex-adjusted OR for T2D 1.12 vs. ENVIRONMENT Epigenetic variabili ty Baylin & Schuebel Nature 2007  Baranzini SE et al. Nature 2010 epigenome sequences of CD4 + lymphocytes from 3 pairs pairwise comparisons of CpG site methylation (ELAND-extended)
  7. 7. Metagenome paves the way to future understanding of interactions between genome and environment in obesity and inflammation
  8. 8. 600 millions years Hotamisligil GS Nature 2006 THE ENVIRONMENTAL CHALLENGE the need for an integrative approach metabolic diseases INFLAMMATION Immune-mediated diseases
  9. 9. Hyperlipidemia Hypertension Insulin resistance Increased adiposity gut microbiota  antibiotics pancreas liver Vijay-Kumar M et al. Science 2010 Altered gut microbiota in TLR5 -/- mice leads to metabolic syndrome
  10. 10. INSTITUT THÉMATIQUE MULTI-ORGANISMES (ITMO) Circulation, Métabolisme, Nutrition (CMN) research units: 201 (%) staff researchers university staff ~ 6/unit Heart & vessels 59 (30%) Metabolism Nutrition & Diabetes 72 (37%) Endocrine glands 9 (4%) Digestive tract 11 (5%) Liver 17 (8%) Kidney 19 (9%) Bone and joints 14 (7%) Heart & vessels 59 (30%) Metabolism Nutrition & Diabetes 72 (37%) Endocrine glands 9 (4%) Digestive tract 11 (5%) Liver 17 (8%) Kidney 19 (9%) Bone and joints 14 (7%) Heart & vessels 59 (30%) Metabolism Nutrition & Diabetes 72 (37%) Endocrine glands 9 (4% Digestive tract 11 (5%) Liver 17 (8%) Kidney 19 (9%) Bone and joints 14 (7%)
  11. 11. Domains Circulation, Diabetes Endocrinology Gastro-enterology, Hepatology Metabolism/Nutrition Uro-Nephrology Osteo-articular System INSTITUT THÉMATIQUE MULTI-ORGANISMES (ITMO) Circulation, Metabolism, Nutrition (CMN)
  12. 12. PLATFORMS CHU Cohorts CRNH genomic epigenetic metagenomic metabolomic lipidomic biostatistics
  13. 13. Genetics, Genomics and Epigenetics at Inserm 163 research teams 99 19 7 5 4 2 1 Not at scale
  14. 14. A observatory of M-F in France French Network of Metabolomics PF PF 4 main centers 80% labs (56) Health lipidome metabolome health health health plants plants œnology plants pharmacology, plants product quality microbiology, human health food security plants, fruits, œnology microbiology human health agriculture products health pharmacology nutrition environment ~10000 ? ~15000 ? ~1500 ? Metabolome small molecules – metabolites - [< 1000] occurring in a biological system. metabolome analysis towards systems biology [cells, tissues, whole organisms]
  15. 15. CHUs University Hospitals > 80% funding
  16. 16. CICs Centers for Clinical Investigation cardiovascular CIC network
  17. 17. CICs Centers for Clinical Investigation thrombosis CIC network
  18. 18. CICs Centers for Clinical Investigation diabetes CIC network
  19. 19. CRNHs Human Nutrition Research Centers COHORTS Cohort SU.VI.MAX   Cohort SU.FOL.OM3 NUTRINET Internet FOOD CONSUMPTION AND BEHAVIOR Health consequences food consumption & nutritional determinants of behavior Prevention, recommendations Education Energy and protein metabolism & aging Micronutrients and prevention Intestine, intestinal microflora & preventive nutrition OBESITY AND RELATED DISEASES Nutrigenomics Mechanisms of insulin resistance and type 2 diabetes Cardio-vascular risk & oxidative stress Food bioavailability Nutrition and cancer PREVENTIVE NUTRITION & AGING Cancer Sarcopemia Osteoporosis Cardio-vascular NUTRITION AND INTESTINE Prevention & treatments : fibers prebiotics fatty acids proteins… Nutrition and cancer (colon, breast) Intestinal inflammatory disease Intestine of the newborn Intestinal lipoproteins Obesity
  20. 20. 2ND INTERNATIONAL RESEARCH MEETING 1. FROM HUMAN GENOMICS TO SYSTEM PATHWAYS What could academia and industry achieve together in drug discovery? SPEAKERS : Xavier Jeunemaitre , HEGP, Paris Philippe Froguel , Lille Dusko Ehrlich , Jouy-en-Josas Questions and answers Alain Tedgui , HEGP, Paris Bart Staels , Lille Richard Moreau , Bichat, Paris Xavier Jouven , HEGP, Paris Questions and answers Chair : Christian Boitard- Director of ITMO CMN and Barbara Demeneix MNHN, Paris

×