Plan for day 1 <ul><li>What is bioinformatics? </li></ul><ul><ul><li>Case: microRNAs </li></ul></ul><ul><li>The course </l...
What is bioinformatics? Morten Lindow Bioinformatics Centre University of Copenhagen
A big change in biology has taken place Measure the expression of a  single gene  in a  single sample Measure the expressi...
Before    Now Find interaction partners for one protein (co immunoprecipitation  -> western blot) Find interaction partne...
Biology has become an information science GGCAAACCCTGTGATTCAGTTTGTCTGTGATTTGCTTAACCGGGATATTTCTTCTCGACCTTTATCTGATGCTGATCGTG...
Genome sequencing is just the beginning <ul><li>Where are the genes? </li></ul><ul><li>How are they regulated? </li></ul><...
Definition <ul><li>The book: ” bioinformatics  involves the technology that uses computers for analysis, storage, retrieva...
Definition Wikipedia: ”…  The terms  bioinformatics  and  computational biology  are often used interchangeably. However  ...
Bioinformatics? Search for homologs to a protein sequence Retrieve information about a genome segment Predict the structur...
Grand challenges in bioinformatics <ul><li>How to fully decipher the digital content of the genome </li></ul><ul><li>How t...
Example projects at the bioinformatics centre <ul><li>Protein structure prediction using Dynamic Bayesian Networks </li></...
A bioinformatician has <ul><li>Adaptability </li></ul><ul><ul><li>An open mind </li></ul></ul><ul><ul><li>Willingness / ab...
Networks between microRNAs and transcription factors In which you will learn a bit about: accessing and searching for info...
Imagine <ul><li>You are studying the oncogene  c-Myc (a transcription factor) </li></ul><ul><li>You have isolated a comple...
Finding it in the genome <ul><li>Is this a known molecule? </li></ul><ul><li>Since the human genome has been fully sequenc...
RNA folding <ul><li>Can it fold as a hairpin? </li></ul><ul><ul><li>Get the sequence with flanks </li></ul></ul><ul><ul><l...
Summary so far ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCACGTTCTTTGGGATGAGAACAACTTTAC...
What controls the controller? <ul><li>Find the transcription start site </li></ul><ul><ul><li>Use and integrate existing d...
Summary so far ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCACGTTCTTTGGGATGAGAACAACTTTAC...
Prediction of transcription factor binding sites <ul><li>Does certain combinations of TFs occur together? </li></ul><ul><l...
Prediction of microRNA targets ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCACGTTCTTTGGG...
Prediction of microRNA targets <ul><li>RNAs interact by forming base pairs (A-U C-G G-U) </li></ul><ul><li>Align microRNA ...
Regulatory systems ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCACGTTCTTTGGGATGAGAACAACT...
A feedback loop? miR-155 and Bach ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCACGTTCTTT...
Bioinformatics is like LEGO® <ul><li>Build using different bricks to get  Biological knowledge </li></ul><ul><ul><li>Datab...
Masters of Bioinformatics
What you have seen <ul><li>Database </li></ul><ul><li>UCSC human genome browser </li></ul><ul><li>Using known information ...
Plan for day 1 <ul><li>What is bioinformatics? </li></ul><ul><ul><li>Case: microRNAs </li></ul></ul><ul><li>The course </l...
Upcoming SlideShare
Loading in...5
×

What Is Bioinformatics?

861

Published on

An interactive lesson to kick off a course in introductory bioinformatics

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
861
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
14
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • Picture from miRanda (Enright et al)
  • Transcript of "What Is Bioinformatics?"

    1. 1. Plan for day 1 <ul><li>What is bioinformatics? </li></ul><ul><ul><li>Case: microRNAs </li></ul></ul><ul><li>The course </li></ul><ul><ul><li>Registration </li></ul></ul><ul><ul><li>Layout </li></ul></ul><ul><ul><li>Expectations </li></ul></ul><ul><ul><li>Evaluation and exam </li></ul></ul><ul><li>General computer tools and skills </li></ul><ul><li>LUNCH </li></ul><ul><li>13:00. Setup and connect computers </li></ul><ul><li>13:15. Software overview </li></ul><ul><li>CLC Combined Workbench (presentation, installation, demo) </li></ul><ul><li>dChip: Download and test </li></ul><ul><li>Cytoscape: Download and test </li></ul><ul><li>Install and play with general computer tools </li></ul>
    2. 2. What is bioinformatics? Morten Lindow Bioinformatics Centre University of Copenhagen
    3. 3. A big change in biology has taken place Measure the expression of a single gene in a single sample Measure the expression of all genes in many samples Before Now
    4. 4. Before  Now Find interaction partners for one protein (co immunoprecipitation -> western blot) Find interaction partners for all proteins (yeast two-hybrid – phage display)
    5. 5. Biology has become an information science GGCAAACCCTGTGATTCAGTTTGTCTGTGATTTGCTTAACCGGGATATTTCTTCTCGACCTTTATCTGATGCTGATCGTG TTAAGATAAAAAAGGCTCTTAGAGGTGTCAAAGTTGAAGTGACTCATCGAGGAAACATGCGCCGGAAGTACCGCATTTCC GGTTTGACTGCTGTGGCCACTCGGGAATTGACATTCCCAGTAGATGAAAGAAATACTCAGAAATCTGTTGTAGAATACTT CCACGAAACATATGGTTTTCGCATTCAGCACACTCAACTACCATGCTTGCAAGTTGGGAATTCTAATAGGCCTAATTACT TACCAATGGAGGTATGCAAGATTGTTGAAGGCCAGCGGTATTCCAAAAGATTGAATGAGAGACAGATCACTGCTTTGCTG AAGGTTACCTGTCAGCGCCCGATAGATCGAGAAAAAGATATCTTACAGACGGTGCAACTCAATGATTATGCTAAAGATAA TTATGCTCAAGAGTTTGGCATCAAAATAAGTACTTCTCTGGCTTCTGTTGAGGCTCGTATACTGCCTCCTCCATGGCTTA AGTACCACGAGTCTGGAAGGGAAGGGACTTGTCTGCCACAAGTTGGTCAATGGAACATGATGAATAAGAAAATGATCAAT GGTGGAACGGTGAATAATTGGATCTGCATCAACTTTTCTAGGCAAGTGCAGGACAATCTAGCGCGTACATTTTGTCAGGA ACTTGCTCAAATGTGTTACGTATCTGGCATGGCATTTAATCCGGAACCAGTCCTCCCACCAGTCAGTGCTCGCCCTGAGC AAGTAGAGAAGGTCTTGAAGACTAGATATCATGATGCCACATCAAAACTCTCCCAAGGAAAAGAAATTGATCTGCTTATT GTCATTCTGCCCGATAATAATGGATCATTATACGGTGATTTGAAACGCATATGTGAGACTGAACTCGGCATAGTCTCTCA ATGTTGCCTGACAAAGCATGTCTTTAAGATGAGCAAACAATACATGGCTAATGTTGCGCTGAAGATTAATGTGAAGGTTG GAGGAAGAAACACAGTGCTTGTTGATGCTCTATCTAGGCGGATTCCTCTAGTCAGTGATCGACCCACCATTATATTTGGT GCTGATGTTACCCACCCTCACCCTGGAGAGGATTCAAGCCCATCTATTGCTGCTGTTGTGGCATCTCAGGATTGGCCTGA AATCACTAAATATGCTGGATTAGTTTGCGCTCAAGCGCATAGGCAGGAGCTCATTCAGGATCTGTTCAAAGAGTGGAAGG ATCCTCAGAAAGGTGTGGTGACTGGTGGCATGATAAAGGAGTTGCTCATAGCCTTCCGTAGATCAACTGGGCATAAACCA CTAAGGATCATCTTCTACAGGGATGGAGTCAGTGAGGGACAATTTTACCAAGTTTTGCTCTATGAACTTGATGCCATCCG CAAGGCCTGTGCTTCGCTGGAAGCAGGTTATCAACCACCAGTGACATTTGTGGTGGTGCAGAAGCGTCATCACACGAGGC TGTTTGCTCAGAACCACAATGATCGCCATTCGGTGGACAGAAGTGGGAATATTTTACCTGGCACTGTTGTGGACTCTAAA ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCA CGTTCTTTGGGATGAGAACAACTTTACTGCAGATGGACTTCAATCTCTGACCAATAACTTATGTTACACGTATGCAAGAT GCACACGCTCAGTTTCAATTGTTCCCCCTGCATATTATGCACATCTAGCAGCTTTTAGGGCTCGATTCTACATGGAGCCA GAGACATCAGACAGTGGCTCAATGGCTAGTGGGAGCATGGCACGTGGAGGTGGAATGGCTGGTAGAAGCACACGCGGGCC TAATGTCAATGCTGCAGTGAGGCCACTCCCAGCTCTGAAAGAGAATGTGAAGCGTGTCATGTTCTACTGCTGAGTTGATT CACCCTCTATCTATCTTTATGACCTAAATTAATGAAGAATATCATGTATGCTTTCTAAGACTTATCGTGTGTTTGGATAT TTCATCACTCTTTCTCTATGAGTATGAGATGCTTTATGACTCTTGTTTGACAACTACTAAACTTTATTATTCAAAACAGA CTTTGATCCTTTCAAAAAAAAAAAAAAAAAAAA TAGAGAGAGAGAGAAAGATATAGAGAGAACACAGAGAGGCGAGAGCGACGTAGGGTTGGTGTTTCGTACGGATTTTCTCG GTCAATCCTAGTTTCTCCGGCGAGAGATTGCTTTTCAGGAATCATCATGGTGAGAAAGAGAAGAACGGATGCTCCATCTG AAGGAGGTGAAGGCTCTGGGTCTCGTGAAGCTGGTCCAGTCTCAGGTGGTGGACGTGGTTCACAGCGAGGTGGTTTCCAG CAGGGAGGAGGACAACACCAAGGTGGAAGGGGTTATACTCCTCAACCTCAACAGGGAGGTCGTGGTGGTCGTGGATATGG GCAACCACCACAACAGCAACAACAGTATGGAGGACCACAAGAGTACCAAGGAAGAGGAAGAGGAGGACCTCCTCATCAAG GAGGTCGAGGAGGGTATGGCGGTGGCCGTGGAGGTGGACCTTCTTCTGGACCACCGCAGAGACAATCAGTTCCCGAGCTG CATCAAGCTACCTCACCTACTTATCAAGCGGTGTCTTCTCAGCCTACACTGTCTGAGGTGAGTCCTACCCAGGTACCAGA ACCTACTGTTCTGGCTCAGCAATTTGAACAACTCTCTGTTGAACAAGGAGCTCCCAGTCAGGCAATCCAGCCTATACCGT CTTCTAGCAAGGCTTTCAAGTTTCCAATGAGGCCTGGTAAAGGACAGAGTGGAAAGCGTTGCATTGTGAAGGCTAACCAT TTCTTTGCTGAACTGCCTGATAAGGATTTGCACCATTATGATGTTACCATTACTCCGGAAGTTACATCAAGGGGTGTCAA TCGTGCTGTGATGAAACAACTTGTTGATAATTATCGTGATTCTCACCTTGGAAGTCGTCTTCCAGCGTATGATGGTCGAA AAAGTCTTTACACTGCTGGTCCACTTCCCTTTAACTCCAAGGAGTTCAGAATCAATCTTCTTGACGAAGAAGTAGGGGCT GGAGGTCAAAGACGAGAAAGGGAATTTAAAGTTGTGATCAAGCTAGTTGCACGTGCTGATCTGCATCACCTAGGAATGTT TTTGGAGGGGAAACAATCAGATGCCCCACAGGAAGCTCTGCAGGTTCTTGACATTGTTCTTCGTGAGCTGCCGACCTCTA GGTATATTCCGGTGGGCCGGTCCTTTTATTCCCCTGATATAGGAAAAAAACAATCATTGGGGGATGGCTTGGAGAGCTGG CGTGGATTCTACCAAAGCATTCGTCCTACACAGATGGGCTTATCACTCAATATTGATATGTCATCGACAGCCTTCATAGA GGCAAACCCTGTGATTCAGTTTGTCTGTGATTTGCTTAACCGGGATATTTCTTCTCGACCTTTATCTGATGCTGATCGTG TTAAGATAAAAAAGGCTCTTAGAGGTGTCAAAGTTGAAGTGACTCATCGAGGAAACATGCGCCGGAAGTACCGCATTTCC GGTTTGACTGCTGTGGCCACTCGGGAATTGACATTCCCAGTAGATGAAAGAAATACTCAGAAATCTGTTGTAGAATACTT CCACGAAACATATGGTTTTCGCATTCAGCACACTCAACTACCATGCTTGCAAGTTGGGAATTCTAATAGGCCTAATTACT TACCAATGGAGGTATGCAAGATTGTTGAAGGCCAGCGGTATTCCAAAAGATTGAATGAGAGACAGATCACTGCTTTGCTG AAGGTTACCTGTCAGCGCCCGATAGATCGAGAAAAAGATATCTTACAGACGGTGCAACTCAATGATTATGCTAAAGATAA TTATGCTCAAGAGTTTGGCATCAAAATAAGTACTTCTCTGGCTTCTGTTGAGGCTCGTATACTGCCTCCTCCATGGCTTA AGTACCACGAGTCTGGAAGGGAAGGGACTTGTCTGCCACAAGTTGGTCAATGGAACATGATGAATAAGAAAATGATCAAT GGTGGAACGGTGAATAATTGGATCTGCATCAACTTTTCTAGGCAAGTGCAGGACAATCTAGCGCGTACATTTTGTCAGGA ACTTGCTCAAATGTGTTACGTATCTGGCATGGCATTTAATCCGGAACCAGTCCTCCCACCAGTCAGTGCTCGCCCTGAGC AAGTAGAGAAGGTCTTGAAGACTAGATATCATGATGCCACATCAAAACTCTCCCAAGGAAAAGAAATTGATCTGCTTATT GTCATTCTGCCCGATAATAATGGATCATTATACGGTGATTTGAAACGCATATGTGAGACTGAACTCGGCATAGTCTCTCA ATGTTGCCTGACAAAGCATGTCTTTAAGATGAGCAAACAATACATGGCTAATGTTGCGCTGAAGATTAATGTGAAGGTTG GAGGAAGAAACACAGTGCTTGTTGATGCTCTATCTAGGCGGATTCCTCTAGTCAGTGATCGACCCACCATTATATTTGGT GCTGATGTTACCCACCCTCACCCTGGAGAGGATTCAAGCCCATCTATTGCTGCTGTTGTGGCATCTCAGGATTGGCCTGA AATCACTAAATATGCTGGATTAGTTTGCGCTCAAGCGCATAGGCAGGAGCTCATTCAGGATCTGTTCAAAGAGTGGAAGG ATCCTCAGAAAGGTGTGGTGACTGGTGGCATGATAAAGGAGTTGCTCATAGCCTTCCGTAGATCAACTGGGCATAAACCA CTAAGGATCATCTTCTACAGGGATGGAGTCAGTGAGGGACAATTTTACCAAGTTTTGCTCTATGAACTTGATGCCATCCG CAAGGCCTGTGCTTCGCTGGAAGCAGGTTATCAACCACCAGTGACATTTGTGGTGGTGCAGAAGCGTCATCACACGAGGC TGTTTGCTCAGAACCACAATGATCGCCATTCGGTGGACAGAAGTGGGAATATTTTACCTGGCACTGTTGTGGACTCTAAA ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCA CGTTCTTTGGGATGAGAACAACTTTACTGCAGATGGACTTCAATCTCTGACCAATAACTTATGTTACACGTATGCAAGAT GCACACGCTCAGTTTCAATTGTTCCCCCTGCATATTATGCACATCTAGCAGCTTTTAGGGCTCGATTCTACATGGAGCCA GAGACATCAGACAGTGGCTCAATGGCTAGTGGGAGCATGGCACGTGGAGGTGGAATGGCTGGTAGAAGCACACGCGGGCC TAATGTCAATGCTGCAGTGAGGCCACTCCCAGCTCTGAAAGAGAATGTGAAGCGTGTCATGTTCTACTGCTGAGTTGATT CACCCTCTATCTATCTTTATGACCTAAATTAATGAAGAATATCATGTATGCTTTCTAAGACTTATCGTGTGTTTGGATAT TTCATCACTCTTTCTCTATGAGTATGAGATGCTTTATGACTCTTGTTTGACAACTACTAAACTTTATTATTCAAAACAGA Digital genome Environment Organism Tissue Cell Intracellular signaling Current bioinformatics
    6. 6. Genome sequencing is just the beginning <ul><li>Where are the genes? </li></ul><ul><li>How are they regulated? </li></ul><ul><li>What do they do? </li></ul><ul><li>How do they interact? </li></ul><ul><li>How did they evolve? </li></ul>GGCAAACCCTGTGATTCAGTTTGTCTGTGATTTGCTTAACCGGGATATTTCTTCTCGACCTTTATCTGATGCTGATCGTG TTAAGATAAAAAAGGCTCTTAGAGGTGTCAAAGTTGAAGTGACTCATCGAGGAAACATGCGCCGGAAGTACCGCATTTCC GGTTTGACTGCTGTGGCCACTCGGGAATTGACATTCCCAGTAGATGAAAGAAATACTCAGAAATCTGTTGTAGAATACTT CCACGAAACATATGGTTTTCGCATTCAGCACACTCAACTACCATGCTTGCAAGTTGGGAATTCTAATAGGCCTAATTACT TACCAATGGAGGTATGCAAGATTGTTGAAGGCCAGCGGTATTCCAAAAGATTGAATGAGAGACAGATCACTGCTTTGCTG AAGGTTACCTGTCAGCGCCCGATAGATCGAGAAAAAGATATCTTACAGACGGTGCAACTCAATGATTATGCTAAAGATAA TTATGCTCAAGAGTTTGGCATCAAAATAAGTACTTCTCTGGCTTCTGTTGAGGCTCGTATACTGCCTCCTCCATGGCTTA AGTACCACGAGTCTGGAAGGGAAGGGACTTGTCTGCCACAAGTTGGTCAATGGAACATGATGAATAAGAAAATGATCAAT GGTGGAACGGTGAATAATTGGATCTGCATCAACTTTTCTAGGCAAGTGCAGGACAATCTAGCGCGTACATTTTGTCAGGA ACTTGCTCAAATGTGTTACGTATCTGGCATGGCATTTAATCCGGAACCAGTCCTCCCACCAGTCAGTGCTCGCCCTGAGC AAGTAGAGAAGGTCTTGAAGACTAGATATCATGATGCCACATCAAAACTCTCCCAAGGAAAAGAAATTGATCTGCTTATT GTCATTCTGCCCGATAATAATGGATCATTATACGGTGATTTGAAACGCATATGTGAGACTGAACTCGGCATAGTCTCTCA ATGTTGCCTGACAAAGCATGTCTTTAAGATGAGCAAACAATACATGGCTAATGTTGCGCTGAAGATTAATGTGAAGGTTG GAGGAAGAAACACAGTGCTTGTTGATGCTCTATCTAGGCGGATTCCTCTAGTCAGTGATCGACCCACCATTATATTTGGT GCTGATGTTACCCACCCTCACCCTGGAGAGGATTCAAGCCCATCTATTGCTGCTGTTGTGGCATCTCAGGATTGGCCTGA AATCACTAAATATGCTGGATTAGTTTGCGCTCAAGCGCATAGGCAGGAGCTCATTCAGGATCTGTTCAAAGAGTGGAAGG ATCCTCAGAAAGGTGTGGTGACTGGTGGCATGATAAAGGAGTTGCTCATAGCCTTCCGTAGATCAACTGGGCATAAACCA CTAAGGATCATCTTCTACAGGGATGGAGTCAGTGAGGGACAATTTTACCAAGTTTTGCTCTATGAACTTGATGCCATCCG CAAGGCCTGTGCTTCGCTGGAAGCAGGTTATCAACCACCAGTGACATTTGTGGTGGTGCAGAAGCGTCATCACACGAGGC TGTTTGCTCAGAACCACAATGATCGCCATTCGGTGGACAGAAGTGGGAATATTTTACCTGGCACTGTTGTGGACTCTAAA ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCA CGTTCTTTGGGATGAGAACAACTTTACTGCAGATGGACTTCAATCTCTGACCAATAACTTATGTTACACGTATGCAAGAT GCACACGCTCAGTTTCAATTGTTCCCCCTGCATATTATGCACATCTAGCAGCTTTTAGGGCTCGATTCTACATGGAGCCA GAGACATCAGACAGTGGCTCAATGGCTAGTGGGAGCATGGCACGTGGAGGTGGAATGGCTGGTAGAAGCACACGCGGGCC TAATGTCAATGCTGCAGTGAGGCCACTCCCAGCTCTGAAAGAGAATGTGAAGCGTGTCATGTTCTACTGCTGAGTTGATT CACCCTCTATCTATCTTTATGACCTAAATTAATGAAGAATATCATGTATGCTTTCTAAGACTTATCGTGTGTTTGGATAT TTCATCACTCTTTCTCTATGAGTATGAGATGCTTTATGACTCTTGTTTGACAACTACTAAACTTTATTATTCAAAACAGA CTTTGATCCTTTCAAAAAAAAAAAAAAAAAAAA TAGAGAGAGAGAGAAAGATATAGAGAGAACACAGAGAGGCGAGAGCGACGTAGGGTTGGTGTTTCGTACGGATTTTCTCG GTCAATCCTAGTTTCTCCGGCGAGAGATTGCTTTTCAGGAATCATCATGGTGAGAAAGAGAAGAACGGATGCTCCATCTG AAGGAGGTGAAGGCTCTGGGTCTCGTGAAGCTGGTCCAGTCTCAGGTGGTGGACGTGGTTCACAGCGAGGTGGTTTCCAG CAGGGAGGAGGACAACACCAAGGTGGAAGGGGTTATACTCCTCAACCTCAACAGGGAGGTCGTGGTGGTCGTGGATATGG GCAACCACCACAACAGCAACAACAGTATGGAGGACCACAAGAGTACCAAGGAAGAGGAAGAGGAGGACCTCCTCATCAAG GAGGTCGAGGAGGGTATGGCGGTGGCCGTGGAGGTGGACCTTCTTCTGGACCACCGCAGAGACAATCAGTTCCCGAGCTG CATCAAGCTACCTCACCTACTTATCAAGCGGTGTCTTCTCAGCCTACACTGTCTGAGGTGAGTCCTACCCAGGTACCAGA ACCTACTGTTCTGGCTCAGCAATTTGAACAACTCTCTGTTGAACAAGGAGCTCCCAGTCAGGCAATCCAGCCTATACCGT CTTCTAGCAAGGCTTTCAAGTTTCCAATGAGGCCTGGTAAAGGACAGAGTGGAAAGCGTTGCATTGTGAAGGCTAACCAT TTCTTTGCTGAACTGCCTGATAAGGATTTGCACCATTATGATGTTACCATTACTCCGGAAGTTACATCAAGGGGTGTCAA TCGTGCTGTGATGAAACAACTTGTTGATAATTATCGTGATTCTCACCTTGGAAGTCGTCTTCCAGCGTATGATGGTCGAA AAAGTCTTTACACTGCTGGTCCACTTCCCTTTAACTCCAAGGAGTTCAGAATCAATCTTCTTGACGAAGAAGTAGGGGCT GGAGGTCAAAGACGAGAAAGGGAATTTAAAGTTGTGATCAAGCTAGTTGCACGTGCTGATCTGCATCACCTAGGAATGTT TTTGGAGGGGAAACAATCAGATGCCCCACAGGAAGCTCTGCAGGTTCTTGACATTGTTCTTCGTGAGCTGCCGACCTCTA GGTATATTCCGGTGGGCCGGTCCTTTTATTCCCCTGATATAGGAAAAAAACAATCATTGGGGGATGGCTTGGAGAGCTGG CGTGGATTCTACCAAAGCATTCGTCCTACACAGATGGGCTTATCACTCAATATTGATATGTCATCGACAGCCTTCATAGA GGCAAACCCTGTGATTCAGTTTGTCTGTGATTTGCTTAACCGGGATATTTCTTCTCGACCTTTATCTGATGCTGATCGTG TTAAGATAAAAAAGGCTCTTAGAGGTGTCAAAGTTGAAGTGACTCATCGAGGAAACATGCGCCGGAAGTACCGCATTTCC GGTTTGACTGCTGTGGCCACTCGGGAATTGACATTCCCAGTAGATGAAAGAAATACTCAGAAATCTGTTGTAGAATACTT CCACGAAACATATGGTTTTCGCATTCAGCACACTCAACTACCATGCTTGCAAGTTGGGAATTCTAATAGGCCTAATTACT TACCAATGGAGGTATGCAAGATTGTTGAAGGCCAGCGGTATTCCAAAAGATTGAATGAGAGACAGATCACTGCTTTGCTG AAGGTTACCTGTCAGCGCCCGATAGATCGAGAAAAAGATATCTTACAGACGGTGCAACTCAATGATTATGCTAAAGATAA TTATGCTCAAGAGTTTGGCATCAAAATAAGTACTTCTCTGGCTTCTGTTGAGGCTCGTATACTGCCTCCTCCATGGCTTA AGTACCACGAGTCTGGAAGGGAAGGGACTTGTCTGCCACAAGTTGGTCAATGGAACATGATGAATAAGAAAATGATCAAT GGTGGAACGGTGAATAATTGGATCTGCATCAACTTTTCTAGGCAAGTGCAGGACAATCTAGCGCGTACATTTTGTCAGGA ACTTGCTCAAATGTGTTACGTATCTGGCATGGCATTTAATCCGGAACCAGTCCTCCCACCAGTCAGTGCTCGCCCTGAGC AAGTAGAGAAGGTCTTGAAGACTAGATATCATGATGCCACATCAAAACTCTCCCAAGGAAAAGAAATTGATCTGCTTATT GTCATTCTGCCCGATAATAATGGATCATTATACGGTGATTTGAAACGCATATGTGAGACTGAACTCGGCATAGTCTCTCA ATGTTGCCTGACAAAGCATGTCTTTAAGATGAGCAAACAATACATGGCTAATGTTGCGCTGAAGATTAATGTGAAGGTTG GAGGAAGAAACACAGTGCTTGTTGATGCTCTATCTAGGCGGATTCCTCTAGTCAGTGATCGACCCACCATTATATTTGGT GCTGATGTTACCCACCCTCACCCTGGAGAGGATTCAAGCCCATCTATTGCTGCTGTTGTGGCATCTCAGGATTGGCCTGA AATCACTAAATATGCTGGATTAGTTTGCGCTCAAGCGCATAGGCAGGAGCTCATTCAGGATCTGTTCAAAGAGTGGAAGG ATCCTCAGAAAGGTGTGGTGACTGGTGGCATGATAAAGGAGTTGCTCATAGCCTTCCGTAGATCAACTGGGCATAAACCA CTAAGGATCATCTTCTACAGGGATGGAGTCAGTGAGGGACAATTTTACCAAGTTTTGCTCTATGAACTTGATGCCATCCG CAAGGCCTGTGCTTCGCTGGAAGCAGGTTATCAACCACCAGTGACATTTGTGGTGGTGCAGAAGCGTCATCACACGAGGC TGTTTGCTCAGAACCACAATGATCGCCATTCGGTGGACAGAAGTGGGAATATTTTACCTGGCACTGTTGTGGACTCTAAA ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCA CGTTCTTTGGGATGAGAACAACTTTACTGCAGATGGACTTCAATCTCTGACCAATAACTTATGTTACACGTATGCAAGAT GCACACGCTCAGTTTCAATTGTTCCCCCTGCATATTATGCACATCTAGCAGCTTTTAGGGCTCGATTCTACATGGAGCCA GAGACATCAGACAGTGGCTCAATGGCTAGTGGGAGCATGGCACGTGGAGGTGGAATGGCTGGTAGAAGCACACGCGGGCC TAATGTCAATGCTGCAGTGAGGCCACTCCCAGCTCTGAAAGAGAATGTGAAGCGTGTCATGTTCTACTGCTGAGTTGATT CACCCTCTATCTATCTTTATGACCTAAATTAATGAAGAATATCATGTATGCTTTCTAAGACTTATCGTGTGTTTGGATAT TTCATCACTCTTTCTCTATGAGTATGAGATGCTTTATGACTCTTGTTTGACAACTACTAAACTTTATTATTCAAAACAGA
    7. 7. Definition <ul><li>The book: ” bioinformatics involves the technology that uses computers for analysis, storage, retrieval, manipulation and distribution of information related to biological macromolecules such as DNA, RNA and proteins.” </li></ul>
    8. 8. Definition Wikipedia: ”… The terms bioinformatics and computational biology are often used interchangeably. However bioinformatics more properly refers to the creation and advancement of algorithms , computational and statistical techniques, and theory to solve formal and practical problems posed by or inspired from the management and analysis of biological data. Computational biology, on the other hand, refers to hypothesis-driven investigation of a specific biological problem using computers , carried out with experimental and simulated data, with the primary goal of discovery and the advancement of biological knowledge. “
    9. 9. Bioinformatics? Search for homologs to a protein sequence Retrieve information about a genome segment Predict the structure of an RNA molecule Build a phylogentic tree connecting a set of proteins Find differentially expressed genes using microarrays Make a model of protein-protein interactions Model the contractions of a muscle Make an equation describing a neuronal action potential Construct cardiac blood-flow model Differential equations to describe prey/predator dynamics
    10. 10. Grand challenges in bioinformatics <ul><li>How to fully decipher the digital content of the genome </li></ul><ul><li>How to do all vs all comparison of thousands of genomes </li></ul><ul><li>How to extract regulatory networks from the above </li></ul><ul><li>How to integrate multiple high-throughput data types dependably </li></ul><ul><li>How to visualize and explore large scale multi-dimensional data </li></ul><ul><li>How to convert static network maps into dynamic mathematical models </li></ul><ul><li>How to predict protein structure and function ab initio </li></ul><ul><li>How to identify signatures for cellular states (healthy vs diseased) </li></ul><ul><li>How to build hierachical models across multiple scales of time and space </li></ul><ul><li>How to reduce complex multi-dimensional models to underlying principles </li></ul>Lee Hood
    11. 11. Example projects at the bioinformatics centre <ul><li>Protein structure prediction using Dynamic Bayesian Networks </li></ul><ul><li>RNA secondary structure prediction using Markov Chain Monte Carlo </li></ul><ul><li>Evolutionary changes between humans and chimps </li></ul><ul><li>Automated gene finders </li></ul><ul><li>Regulation of gene expression </li></ul><ul><ul><li>Prediction of cis-regulatory sites </li></ul></ul><ul><ul><li>Integration with high-throughput data </li></ul></ul><ul><li>Gene expression profile changes in cancer </li></ul>
    12. 12. A bioinformatician has <ul><li>Adaptability </li></ul><ul><ul><li>An open mind </li></ul></ul><ul><ul><li>Willingness / ability to cross traditional disciplinary borders </li></ul></ul><ul><ul><li>Ability to learn - fast </li></ul></ul><ul><li>Flair for biology </li></ul><ul><ul><li>Thorough understanding of molecular biology </li></ul></ul><ul><li>Flair for information handling and technology </li></ul><ul><ul><li>Programming </li></ul></ul><ul><ul><li>Databases </li></ul></ul><ul><li>Flair for mathematics / statistics </li></ul><ul><ul><li>Modelling </li></ul></ul>In the Bioinformatics Program we help you develop these skills!
    13. 13. Networks between microRNAs and transcription factors In which you will learn a bit about: accessing and searching for information in bio-databases, what microRNAs are, predict RNA structure
    14. 14. Imagine <ul><li>You are studying the oncogene c-Myc (a transcription factor) </li></ul><ul><li>You have isolated a complex containing the mRNA for c-Myc </li></ul><ul><li>In this complex you find a small RNA </li></ul><ul><li>You get excited! </li></ul><ul><li>You manage to clone and sequence it </li></ul><ul><ul><li>caaagugcuuacagugcagguagu </li></ul></ul><ul><li>Now what? </li></ul>
    15. 15. Finding it in the genome <ul><li>Is this a known molecule? </li></ul><ul><li>Since the human genome has been fully sequenced: </li></ul><ul><ul><li>We must be able to find out where it is encoded </li></ul></ul><ul><ul><li>Go to a genome browser </li></ul></ul><ul><li>Wow! It is a microRNA </li></ul><ul><li>Sidestep: What are microRNAs? </li></ul><ul><li>Let’s assume this was NOT known already </li></ul>
    16. 16. RNA folding <ul><li>Can it fold as a hairpin? </li></ul><ul><ul><li>Get the sequence with flanks </li></ul></ul><ul><ul><li>Fold it at Vienna RNA </li></ul></ul>RNA ? More details: RNA-lecture
    17. 17. Summary so far ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCACGTTCTTTGGGATGAGAACAACTTTACTGCAGATGGACTTCAATCTCTGACCAATAACTTATGTTACACGTATGCAAGAT Prediction of precursor structure Identify transcript miRNA gene RNA protein A microRNA
    18. 18. What controls the controller? <ul><li>Find the transcription start site </li></ul><ul><ul><li>Use and integrate existing data </li></ul></ul><ul><ul><ul><li>Genome browser : Known transcripts, genome annotation (from cDNA data) </li></ul></ul></ul><ul><ul><ul><li>Auxilary information (not yet in genome browser) </li></ul></ul></ul><ul><ul><ul><ul><li>Known 5’ ends (from RIKEN CAGE-tags) </li></ul></ul></ul></ul><ul><ul><ul><ul><li>Known RNA polymerase II binding sites (from ChIP) </li></ul></ul></ul></ul><ul><ul><li>Construct predictive models </li></ul></ul><ul><ul><ul><li>Machine learning / Inference (HMM, Neural Nets, SVM, GLM) </li></ul></ul></ul><ul><ul><ul><li>You need a bioinformatician for this!! </li></ul></ul></ul>ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCACGTTCTTTGGGATGAGAACAACTTTACTGCAGATGGACTTCAATCTCTGACCAATAACTTATGTTACACGTATGCAAGAT ? ?-- miR-17 --?
    19. 19. Summary so far ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCACGTTCTTTGGGATGAGAACAACTTTACTGCAGATGGACTTCAATCTCTGACCAATAACTTATGTTACACGTATGCAAGAT Prediction of binding sites Prediction of precursor structure Identify transcript miRNA gene RNA protein A microRNA
    20. 20. Prediction of transcription factor binding sites <ul><li>Does certain combinations of TFs occur together? </li></ul><ul><li>In certain groups of genes? </li></ul><ul><li>Is this significant? </li></ul><ul><li>What biological meaning does it make? </li></ul>CCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCACGTTCTTTGGGATGAGAACAACTTTACTGCAGATGGACTTCAATCTCTGACCAATAACTTATGTTACACGTATGCAAGAT In another lecture: Motif Search UCSC transcription factor track
    21. 21. Prediction of microRNA targets ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCACGTTCTTTGGGATGAGAACAACTTTACTGCAGATGGACTTCAATCTCTGACCAATAACTTATGTTACACGTATGCAAGAT Transcriptional unit RNA ?
    22. 22. Prediction of microRNA targets <ul><li>RNAs interact by forming base pairs (A-U C-G G-U) </li></ul><ul><li>Align microRNA and target (more details in Alignment-lecture ) </li></ul><ul><li>Build in biology: </li></ul><ul><ul><li>Some part of the miRNA is more important than others </li></ul></ul><ul><ul><li>Binding sites conserved in evolution tend to be more functional </li></ul></ul><ul><li>MiRanda predictions </li></ul>?
    23. 23. Regulatory systems ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCACGTTCTTTGGGATGAGAACAACTTTACTGCAGATGGACTTCAATCTCTGACCAATAACTTATGTTACACGTATGCAAGAT Maybe feedback regulation? A microRNA Regulates other RNA ( prevents them from being translated to proteins ) Transcriptional unit RNA
    24. 24. A feedback loop? miR-155 and Bach ATCTGCCACCCTACAGAGTTTGACTTTTACCTCTGTAGTCATGCTGGTATTCAGGGCACTTCTCGACCTGCTCATTACCACGTTCTTTGGGATGAGAACAACTTTACTGCAGATGGACTTCAATCTCTGACCAATAACTTATGTTACACGTATGCAAGAT BIC - mir-155 Bach2-binding sites (repressor) Bach2-proteins miR-155 “ Lack of BIC and microRNA miR-155 expression in primary cases of Burkitt lymphoma. ” Genes Chromosomes Cancer. 2006 Feb;45(2):147-53 “ These results indicate that BACH2 plays important roles in regulation of B cell development.” Oncogene. 2000 Aug 3;19(33):3739-49
    25. 25. Bioinformatics is like LEGO® <ul><li>Build using different bricks to get Biological knowledge </li></ul><ul><ul><li>Databases of experimental data ( sequence, genome annotation, molecule interactions etc, etc) </li></ul></ul><ul><ul><li>Scan for transcription factor binding sites </li></ul></ul><ul><ul><li>RNA folding and classification </li></ul></ul><ul><ul><li>miRNA target prediction </li></ul></ul><ul><li>Or design your own LEGO bricks! </li></ul><ul><ul><li>Enter the master’s program </li></ul></ul>
    26. 26. Masters of Bioinformatics
    27. 27. What you have seen <ul><li>Database </li></ul><ul><li>UCSC human genome browser </li></ul><ul><li>Using known information to find likely transcription start site </li></ul><ul><li>The horror of ids/names </li></ul><ul><li>Alignment and sequence search </li></ul><ul><li>Sequence search with BLAT against human genome </li></ul><ul><li>Alignment to find miRNA targets </li></ul><ul><li>RNA </li></ul><ul><li>RNA folding of miRNA-precursor </li></ul><ul><li>Promoter analysis </li></ul><ul><li>Predicted transcription factor binding sites </li></ul><ul><li>What you missed – but will see later: </li></ul><ul><li>Construct phylogenetic trees </li></ul><ul><li>Analysis of protein structure </li></ul><ul><li>Expression analysis </li></ul><ul><li>Network analysis </li></ul>
    28. 28. Plan for day 1 <ul><li>What is bioinformatics? </li></ul><ul><ul><li>Case: microRNAs </li></ul></ul><ul><li>The course </li></ul><ul><ul><li>Registration </li></ul></ul><ul><ul><li>Layout </li></ul></ul><ul><ul><li>Expectations </li></ul></ul><ul><ul><li>Evaluation </li></ul></ul><ul><li>General computer tools and skills </li></ul><ul><li>LUNCH </li></ul><ul><li>13:00. Setup and connect computers </li></ul><ul><li>13:15. Software overview </li></ul><ul><li>CLC Combined Workbench (presentation, installation, demo) </li></ul><ul><li>dChip </li></ul><ul><li>Cytoscape </li></ul>
    1. A particular slide catching your eye?

      Clipping is a handy way to collect important slides you want to go back to later.

    ×