Oligoinformatics And Drug Development
Upcoming SlideShare
Loading in...5
×
 

Oligoinformatics And Drug Development

on

  • 533 views

Outlines and exemplified how bioinformatics is particularily well to facilitate the discovery of oligonucleotide drugs.

Outlines and exemplified how bioinformatics is particularily well to facilitate the discovery of oligonucleotide drugs.

One hour talk I gave a Aalborg University in 2010.

Statistics

Views

Total Views
533
Views on SlideShare
514
Embed Views
19

Actions

Likes
0
Downloads
12
Comments
0

2 Embeds 19

http://www.linkedin.com 13
https://www.linkedin.com 6

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment
  • Thank you for the invitation to speak to you today. I am going to speak to you about “Bioinformatics in the development and understanding of oligonucleotide drugs”. As far as I know, not many of you work with drug development. However, I think most of you would agree that biology is becoming an information science and that you are working with bioinformatics in one way or another almost every day. Also the usefulness of oligonucleotides should be familiar to all the bioscientists. What I find especially fascinating and powerful is the combination of the three: bioinformatics, drug development and oligonucleotides
  • Working with dyes at the German chemical company IG Farben, Paul Ehrlich in 1872, introduced the concept of a chemoreceptor. A molecule that specifically binds to one of his chemicals.For more than 100 years, drug development – very primitive at first, now highly sophisticated – has focused on proteins as targets. Finding the right regulator of a protein has mainly been a process of trial and error. This picture show aspirin in its binding pocket of the dimeric cox-enzyme. Looking at that spaghetti, I don’t think it is strange that trial and error have been the main road forward for finding molecules that can bind and regulate proteins, Also computationally this is an extremely difficult problem.
  • However, there are alternatives. Proteins are translated from RNA. RNA is chemically and structurally simpler. Even a 1D representation of RNA is very useful for finding ligands.. Simply by basepairing. Moreover contrary to proteins, most RNA are present in the same subcellular compartments. Therefore regulation on RNA level is more generic approach. The same class of molecules can be used for most RNAs. I am of course talking about oligonucleotides
  • Some oligonucleotides are especially interesting…..miRNA….. siRNA….. ASOs…explain gapmers and RNAseH mechanism
  • There are many miOneoligo to find themOne oligo to bind themAnd in complex forever blind them
  • On their a one experiment/one gene basisonly 2 of these were significant with the number of replicates we got. However, by integrating pathway information and biological knowledge, suddenly it becomes clear – and statistically significant – that these many small changes work in a coordinated to downregulate cholesterol biosynthesis. Explain figure….

Oligoinformatics And Drug Development Oligoinformatics And Drug Development Presentation Transcript

  • Therapeutic antagonism of microRNAs Bioinformatics in the development and understanding of oligonucleotide drugs Morten Lindow Group leader, Bioinformatics Santaris Pharma A/S Aalborg University November 2010
  • Most drugs work on proteins
  • CGCUGUGAGGUG Chemically simple GUA 1D…GGGCGACACUCCACCAUGAAU……Fewer cellular compartments ||||||||||||||| Easy to develop regulator translation Chemically diverse 3D Many types of interactions with ligands Diverse cellular compartments Hard to develop regulator
  • Enzyme-directing oligonucleotides ASOs siRNA miRNA RNAseH RISC RISC
  • Designing oligos as RNA regulators Intelligent design Natural selection (oligoinformatics) ASOs siRNAs miRNAsTargetSurveyor.pl Lindow et al., PLoS Comput Biol. 2007 Plant genomes have7/10 have IC50<5nM >2000 genomic pre-miRConserved across species structures withMinimal off-targets complementarity to… mRNA. Just waiting for the right niche to show up.
  • CGCUGUGAGGUGGUA ||||||||||||||| CCCCCUGAUGGGGGCGACACUCCACCAUGAAUCACUC• Vast compound libraries• Combinatorial chemistry TargetSurveyor.pl ~2 years ~2 months• High through put screening on Automated oligosynthesis primary target• Specificity screen on related qPCR receptors• Tolerability screen Lead optimization 23 optimized leads 2 in pre-clinical dev 2 in phase 1 1 in phase 2 Clinical development
  • Both Nature and Business makeuse of oligonucleotides
  • LNA-antimiR – miravirsen- an oligo to regulate an oligo 8 LNA, 7 DNA miravirsen miR-122 RISC Inhibits expression
  • Wienholds et al, Science (2005)
  • Antagonism of miR-122 leads to reduced plasma cholesterol Single i.v. injection of Three i.v. injections of miravirsen miravirsen in mice in African green monkeysElmen&Lindow et al, Nature 2008Esau et al, Cell Metab 2006
  • miR-122 and hepatitis C virus HCV is a single stranded RNA virus HCV genome resembles an mRNA 170 million infected worldwide Current treatment often ineffective and with serious side effects2x miR-122 bindingsites in 5‟NTR Viral replication Jopling et al, Science 2005 Elmen&Lindow et al., Nature 2008
  • HCV is the target indication formiravirsen
  • ? Can miravirsen reduce HCV-load in vivo?? Can HCV mutate to escape miravirsen treatment?? What is the physiological role of miR-122?? Does miravirsen have any off-targets?
  • miravirsen reduces HCV in chimpanzeesLanford et al, Science 2010
  • Can HCV mutate to escape miravirsen treatment? Direct-acting small molecule inhibitor LNA-antimiR targeting the host factor of viral RNA polymerase miR-122 Rebound during Rebound 2 weeks after treatment end of treatment Period of treatmentCooper et al, J Hepat, 2009 Lanford et al, Science 2010
  • Deep sequencing of virus fromtreated animalsHCV specific primers to amplify miR-122 binding region454 deep sequencing73,000 to 214,000 reads at 4 time points Does frequency of variants change?
  • No evidence of viral escape frommiravirsen!
  • Antagonism of miR-122:Effects on gene expressionWhat is the physiological role of miR-122?Are miR-122 targets upregulated after miravirsentreatment? Can this be used as an efficacyendpoint?Is there a non-sequence specific effect of treatmentwith LNA-oligos?Is there a sequence specific effect of treatmentwithmiravirsen? (off-target effect on mRNAs?)
  • Distance between transcriptomes 5 fat mice treated with miravirsen 5 fat mice treated with 2 mismatch control 5 fat mice treated with salineData from Elmen & Lindow et al, Nature 2008
  • Are miR-122 targets upregulated after miravirsen treatment? miR-122 RISC Inhibits expressionOn the level of the individual gene only a few targets are significantly upregulated(n=5) and only with about 25%
  • Sequence and expression analysis combined yields a miR-signature Expression analysis Sequence analysis antimiR mRNA changes All ~20 000 genes Control predicted miR-122 targetsfor each gene: log2(antimiR/control) 0 means no change
  • miR-signature is an efficacy endpoint Null-hypothesis: Are the distributions of background and 14503 predicted targets mRNAs with identical? no site Test:Density two-sided Kolmogorov- Smirnov 879 mRNA with p=6.60E-27 miR-122 site 0 0 Response to miravirsen treatment log2(miravirsen/saline)
  • Microarray data from four different experiments Model Liver Northern Serum cholesterol levelsMonkeyNormal dietMonkeyHigh-fat dietMouseNormal dietMouseHigh-fat diet
  • On gene level: only little consistencybetween mice and primates
  • Pathway level changes Unbiased pathway analysis 6% 0 1( & 1 ( 1& - 2 "+ $ ( /# & 2 * # & 1) !"$ ) #*+ ./#% ( / /45" 0 # & % - ) 0 " .3 ( 0 & %% " ( ( ,( (1 2 # ! - % . ( " # *+))))))))))))4 4 + -%( )))))+ 5 ( ##," ))))))( 4+ &(%$ )))))))))))))-%$ 0 4 " )))))))))))) # * " % +)))))) & " $ . $+#$ (+ )% 8 $ % 9 . & 5 - # < , +* % - $ .1 ./0)2 " . %#," ) : * 8 ) -%( % , 3 4& + 56 ( % & , *% $ .+$ % ( )% # & . % , !"$ # %& . (.(+ ),, *% $+ ).+ 8 : 9 ( - $ . ), ./ 1 $ 0 * + - $. ) ./ 1 0 7 ; *5 ( , "& . % )/ 3 *##, & * 1 -% 6 + ) /$ % %, !"$ # %& !"$ # %& %, () $ %* + %, () $ %* + monkey mouse
  • Pathways responding consistentlyacross diets and species
  • Cholesterol synthesis enzymes aredownregulated across diets and species Hagedorn, et. al, unpublished
  • Systems biology successfullyexplains pharmacology!
  • Off-target effects? miR RISC Yes, the antimiR binds and derepress targets of the miR antimiR Direct effect on (partially) complementary targets?
  • cells or animals treated with oligo or siRNA 1. Calculate fold change in the concentration of each mRNA Untreated or mock treated animals 2. Rank mRNAs by fold change up in treated down in treated 3. Sequence analysis: Mark presence of all „words‟ of length k 4. Test if a word is over/under represented in one end of the ranked listSylamer, Enright lab, 2009
  • 6 nt words 7 nt words Sites complementary to miR-122 Noise level Sites complementary to oligoObad et al., Nature Genetics, in press
  • No evidence of direct regulation ofmRNAs by LNA-antimiRs!
  • miravirsen is in clinical trials★Preclinical tox: “SPC3649 (miravirsen) was tolerated at doses that far exceed those intended for human clinical use”★Phase Ia study completed: Single dose, dose-escalationin healthy volunteers★Phase Ib completed: Multiple ascending doses in healthy volunteers★Phase II ongoing: Hepatitis C patients
  • Phase 1a. Dose dependent reduction of plasmacholesterol in humans
  • Summary Bioinformatics: Sequence analysis facilitates oligonucleotide drug development  Design of specific, potent and tolerable oligonucleotide drugs  Methods for expression data analysis on efficacy and specificity Systems biology: miR-122 coordinates expression level of cholesterol biosynthesis enzymes HCV-treatment: Miravirsen appears to be a promising new HCV treatment  First time a microRNA is a drug target  No escape mutants in treated chimpanzees  Awaiting phase II data
  • AcknowledgementsSantaris microRNA research groupSakari KauppinenSusanna ObadJoacim ElmenSantaris Bioinformatics groupAndreas PetriLena Hansson (now Intomics)Elfar Torarinson (sysadm consult)Peter Hagedorn (post doc, now at LEOPharma)Center for biological sequence analysis, DTUHenrik Bjørn Nielsen
  • More….. mirmaid.org microRNA information for computers, open source API to miR data resources bio-geeks.com, blog with other geeks about bioinformatics RNA.dk – homepage for new big project about Enabling RNA Therapeutics oligoinformatics.org, New. Specialized blog on oligos and informatics Student project inquiries: mol@santaris.com