Next Generation Sequencing 
File Formats. 
Pierre Lindenbaum 
@yokofakun 
pierre.lindenbaum@univ-nantes.fr 
http://plinden...
You don't need to have a deep knowledge of those formats. 
(Unless you're doing NGS) 
Pierre Lindenbaum@yokofakun pierre.l...
Understand how people have solved their BIG data problems. 
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr h...
Why sequencing ? 
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegn...
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFh...
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFh...
Well, that's a little more complicated ... 
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGlein...
FASTQ 
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.i...
FASTQ 
FASTQ: text-based format for storing both a DNA sequence and 
its corresponding quality scores 
Pierre Lindenbaum@y...
FASTQ 
FASTQ for single end 
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanum...
FASTQ 
FASTQ for paired end 
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanum...
FASTQ Example 
@IL31_4368:1:1:996:8507/1 
NTGATAAAGTAATGACAAAATAATGACATTATTGTTACTATGGTTACTGTGGGA 
+ 
(94**0-)*7=06>>><<<<<...
FASTQ name 
@EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG 
Col Brief description 
EAS139 the unique instrument nam...
lter (read is bad), N otherwise 
18 0 when none of the control bits are on, otherwise it is an even number 
ATCACG index s...
FASTQ Quality 
Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscp...
FASTQ Quality 
A quality value Q is an integer mapping of p (i.e., the probability 
that the corresponding base call is in...
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
File formats for Next Generation Sequencing
Upcoming SlideShare
Loading in...5
×

File formats for Next Generation Sequencing

5,609

Published on

Course File formats for Next Generation Analysis . September 2013; Univ-Nantes.

Published in: Health & Medicine, Technology
3 Comments
17 Likes
Statistics
Notes
No Downloads
Views
Total Views
5,609
On Slideshare
0
From Embeds
0
Number of Embeds
39
Actions
Shares
0
Downloads
0
Comments
3
Likes
17
Embeds 0
No embeds

No notes for slide

Transcript of "File formats for Next Generation Sequencing"

  1. 1. Next Generation Sequencing File Formats. Pierre Lindenbaum @yokofakun pierre.lindenbaum@univ-nantes.fr http://plindenbaum.blogspot.com https://github.com/lindenb/courses Institut du Thorax. Nantes. France September 19, 2014 Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  2. 2. You don't need to have a deep knowledge of those formats. (Unless you're doing NGS) Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  3. 3. Understand how people have solved their BIG data problems. Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  4. 4. Why sequencing ? Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  5. 5. Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  6. 6. Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  7. 7. Well, that's a little more complicated ... Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  8. 8. FASTQ Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  9. 9. FASTQ FASTQ: text-based format for storing both a DNA sequence and its corresponding quality scores Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  10. 10. FASTQ FASTQ for single end Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  11. 11. FASTQ FASTQ for paired end Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  12. 12. FASTQ Example @IL31_4368:1:1:996:8507/1 NTGATAAAGTAATGACAAAATAATGACATTATTGTTACTATGGTTACTGTGGGA + (94**0-)*7=06>>><<<<<<22@>6;;;5;6:;63:4?-622647..-.5.% @IL31_4368:1:1:996:21421/1 NAAGTTAATTCTTCATTGTCCATTCCTCTGAAATGATTCAGAAATACTGGTAGT + (**+*2396,@<+<:@@@;;5)<0)69606>4;5>;>6&<102)0*+8:&137; @IL31_4368:1:1:997:10572/1 NAATGTATGTAGACCCTTCACATTCAAAGGCAAATACAATATCATCATGTCTTC + (/9**-0032>:>>9>4@@=>??@@:-66,;>;<;6+;255,1;7>>>>3676' @IL31_4368:1:1:997:15684/1 NGCAATCAATGCTATGATTGATCCTGATGGAACTTTGGAGGCTCTGAACAACAT + ()1,*37766>@@@>?@<?@@:>@0>>><-888>8;>*;966>;;;@8@4,.2. @IL31_4368:1:1:997:15249/1 NCGTTATAATGGAATTATTTTTCTTCCTTTATTTAATGTGTTGACAAAGAGAAC Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  13. 13. FASTQ name @EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG Col Brief description EAS139 the unique instrument name 136 the run id FC706VJ the owcell id 2 owcell lane 2104 tile number within the owcell lane 15343 'x'-coordinate of the cluster within the tile 197393 'y'-coordinate of the cluster within the tile 1 the member of a pair, 1 or 2 (paired-end or mate-pair reads only) Y Y if the read fails
  14. 14. lter (read is bad), N otherwise 18 0 when none of the control bits are on, otherwise it is an even number ATCACG index sequence Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  15. 15. FASTQ Quality Pierre Lindenbaum@yokofakun pierre.lindenbaum@univ-nantes.fr httNp:e/x/tpGleinnedreantiboanumS.ebqluoegnscpinogtF.icleomFhotrtmpas:t/s/. github.com/lindenb/courses
  16. 16. FASTQ Quality A quality value Q is an integer mapping of p (i.e., the probability that the corresponding base call is incorrect). Qsanger =

×