Your SlideShare is downloading. ×
Conversion De Protooncogenes En Oncogenes
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Conversion De Protooncogenes En Oncogenes

16,136
views

Published on

Published in: Health & Medicine

5 Comments
8 Likes
Statistics
Notes
No Downloads
Views
Total Views
16,136
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
772
Comments
5
Likes
8
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. HOSPITAL LLUÍS ALCANYÍS SERVICIO DE PATOLOGÍA Xàtiva – Valencia 12 al 14 de enero de 2009 BASES MOLECULARES DEL CÁNCER APLICACIÓN A LA PATOLOGÍA TUMORAL
  • 2. Conversión de Protooncogenes en Oncogenes Pascual Meseguer García Servicio de Patología Hospital Lluís Alcanyís de Xàtiva
  • 3. Índice de la presentación
    • El genoma
    • El gen
    • El protooncogén
    • El oncogén
    • Otros genes implicados en el cáncer
    • Activación de los oncogenes
    • El código epigenético
    • Una breve reseña histórica
    • Conclusiones
  • 4. 1. ¿Que es el genoma?
    • Todo el ADN contenido en un organismo:
      • Genes.
      • Secuencias no codificantes.
      • ADN mitocondrial.
    • El Genoma Humano está constituido por 3.000 1 000.000 bases (20.500 genes )
    19.500 genes 50.000 genes
  • 5. Ácido desoxirubonucléico (ADN) Doble hélice de nucleótidos 1 m
  • 6.
    • Un nucleótido consta de:
    • Una molécula de azúcar
    • Una molécula de ácido fosfórico
    • Una base nitrogenada:
      • A denina
      • T imina
      • G uanina
      • C itosina
    Nucleótidos A denina  T imina G uanina  C itosina
  • 7.
    • Un nucleótido consta de:
    • Una molécula de azúcar
    • Una molécula de ácido fosfórico
    • Una base nitrogenada:
      • A denina
      • T imina
      • G uanina
      • C itosina
    Nucleótidos A denina  T imina G uanina  C itosina
  • 8.
    • Un nucleótido consta de:
    • Una molécula de azúcar
    • Una molécula de ácido fosfórico
    • Una base nitrogenada:
      • A denina
      • T imina
      • G uanina
      • C itosina
    Nucleótidos A denina  T imina G uanina  C itosina T A G A A A A G G G T T T C T C C C
  • 9. Código genético
    • Es el lenguaje en el que están escritos los genes (es universal).
    • A , T , G , y C son las "letras" del código genético
    Homo sapiens otospiralin (OTOS) ; Location: 2q37.3 CCCATCCAGGCAGCACGGCTGGCTGAGCAGAGACAAGGGCTGCCACACTGGGACTGGTAGAGGAAGCCCTGACGGATGGGTGGTCTCGCCCTTCCTGGGTTCATCCTGCTGCAGGTGGGCCTGAGTCGCAGATCAGAACACCGGGAAGATGCAGGCCTGCATGGTGCCGGGGCTGGCCCTCTCCTCCTACTGGGGCCTCTTGAGGGGCCAAGCCTGTGCAGGAGGAAGGAGACCCTTACGCGGAGCTGCCGGCCATGCCCTACTGGCCTTTTCCACCTCTGACTTCTGGAACTATGTGCAGCACTTCCAGGCCCTGGGGGCCTACCCCCAGATCGAGGACTGGCCCGAACCTTCTTTGCCCACTTCCCCCTGGGGAGCACGCTGGGCTTCCACGTTCCCTATCAGGAGGACTGAATGGTGTCCAGCCTGGTGCCCGCCCACCCCGCCAGGCTGCACTCGGTCGGGCCTCCACAGGCATGGAGTCCCCGCAAAAACCTGGCCCCTGCAGGAGTCAGGCCTGGTCTCACGCTCAATAAACTCCGGACTGAAGATGCA
  • 10. Tamaño del Genoma Humano 170 m Monumento a Washington
  • 11. Codón
    • Por ejemplo:
    • El codón TTT = Fenilalanina
    • El codón TTA = Leucina
    • El codón GTA = Valina.
    Son tres bases nitrogenadas en una secuencia de ADN o ARN, las cuales especifican un solo aminoácido (1 codón = 1 aa).
  • 12. 2. ¿Qué es un gen?
    • Unidad física y funcional de la herencia.
    • Están compuestos por ADN. (100-2.000.000 bases).
    • La mayoría contiene la información para elaborar una proteína específica.
    Transcriptoma Transcriptoma: Conjunto de mRNAs que una célula determinada transcribe en una situacion normal o patológica. Transcriptoma
  • 13. Gen
  • 14. Estructura de un Gen potenciador TTGIOCTGRACIASTPGBPORDLDCVATENDERDTTC TTGIOCT GRACIAS TPGB POR DLDCV ATENDER DTTC GRACIAS POR ATENDER
  • 15. Replicación del ADN
  • 16. Transcripción: DNA To mRNA Adenina  Uracilo Guanina  Citosina DNA
  • 17.  
  • 18.  
  • 19.  
  • 20. Transferencia
  • 21. 3. ¿Qué es un protooncogén?
    • Es un gen normal que interviene la proliferación celular.
    • Se considera que son dominantes , ya que transforman a las células aunque sus alelos sean normales.
  • 22. 4. ¿Qué es un oncogén?
    • Es la forma mutada de un protooncogén.
    • Codifica una proteína anormal (oncoproteína), que se mantiene activa independientemente de las señales reguladoras (no se degrada).
    • Esto convierte a la célula en tumoral por una proliferación desordenada.
    • En los humanos se han identificado más de 60 oncogenes.
  • 23.
    • Factores de crecimiento: v-sis, HST, KST
    • Receptores de los factores de crecimiento:
      • Con actividad Tirosina Kinasa: EGFR, c-KIT, HER2-NEU
      • Sin actividad Tirosina Kinasa: mas
    • Factores de transcripción: v-fos, v-jun, v-myc (G0 a G1)
    • Remodeladores de la cromatina: ALL1 (MLL)
    • Transductores de señales:
      • Tirosina Kinasa citoplasmática: SRC, ABL
      • Asociados a la proteína G: H-RAS, K-RAS, N-RAS, BRAF
    Clasificación de los oncogenes En función de la proteína que codifican Lista de Oncogenes
  • 24. Gen normal Protooncogén Gen mutado Oncogén Expresión Expresión Proteína normal Proteína anómala ( Oncoproteína ) Hay estímulo Hay estímulo La proteína actúa La proteína actúa No hay estímulo No hay estímulo La proteína no actúa La proteína actúa Mutación Función normal Actividad excesiva Cáncer Oncogén Sobreexpresión
  • 25. 5. Otros genes implicados en el cáncer Genes de invasión/metástasis Genes de los miRNA Genes de activación/desactivación de carcinógenos Genes reparadores del ADN Genes que regulan el envejecimiento (Telomerasa) Genes de la Apoptosis (evasión de la apoptosis) Genes de diferenciación celular Genes supresores del cáncer Genes adicionales Principales responsables
  • 26. Genes oncosupresores
    • Son genes normales que actúan deteniendo la división celular.
    • La mutación de un gen supresor hace que “pierda esta función” y se pueda desarrollar un tumor.
    • Para que se produzca la transformación neoplásica de la célula, deben resultar dañados los dos alelos (son recesivos ).
    Cuando están activos ejercen un efecto antiproliferativo en la célula
  • 27. Gen oncosupresor Gen oncosupresor mutado Expresión Expresión Proteína normal oncosupresora Proteína anómala ( no Oncosupresora ) Hay estímulo Hay estímulo La proteína actúa La proteína no actúa No hay estímulo No hay estímulo La proteína no actúa La proteína no actúa Mutación Función normal No hay actividad Cáncer Gen supresor
  • 28. Ejemplos de Genes supresores
    • RB : Frena el avance de la fase G1 a S en el ciclo celular.
    • Retinoblastoma familiar
    • P53 : Induce a otros genes:
      • Detienen el ciclo celular (p21).
      • Promueven la reparación de ADN (GADD45)
      • o promueven la apoptosis (BAX)
      • Síndrome de Li-Fraumeni
    • APC : Regula la degradación de la β -Catenina
    • Poliposis familiar adenomatosa de colon
    • NF-1, NF-2: Acción similar a APC (neurofibromatosis 1 y 2)
    • PTEN (síndrome de Cowden) VHL (von Hippel-Lindau), WT1
    Producen síndromes cuando hay mutación en la “línea germinal” El guardián del genoma
  • 29.
    • La vía extrínseca o de los "receptores de muerte“
      • Receptores: La proteína Fas, TRAIL y TNF- α
    • Vía intrínseca o del estrés celular (o mitocondrial)
    • Proteínas de la familia BCL2
      • Subfamilia Bcl-2 (anti-apoptótica): Bcl-2, Bcl-XL, Bcl-W, MCL-1
      • Subfamilia Bax (pro-apoptótica): Bax, Bak, Bok
      • Subfamilia BH3 (pro-apoptótica): Bad, Bid, Bik, Blk, BimL
    • Vía citotóxica (perforina/granzima)
    • Utilizada por los linfocitos T citotóxicos y NK
    Genes de la apoptosis Si estos genes están mutados: La célula puede evadir la apoptosis y convertirse en tumoral
  • 30. Genes que regulan la reparación del ADN
    • Su función es reparar las mutaciones no letales de otros genes.
    • Tipos:
      • Reparación de errores de emparejamiento (mismatch) *
      • MSH2, MLH1 (Síndrome de Lynch, Sindr. de Muir-Torre)
      • Reparación de la escisión de nucleótidos (1).
      • XPA, XPB, XPC (Xerodermia pigmentosa)
      • Reparación de la recombinación.
      • AMT (Ataxia telangiectasia) (BRCA1, BRCA2)
    • * Las mutaciones de lo genes “mismatch” se pueden manifestar como inestabilidad de los microsatélites (CACACACACA)
    • Human DNA repair genes
  • 31. Genes reparadores de errores de emparejamiento F7-corrector ortográfico
  • 32. 6. Activación de los oncogenes
    • UN PROTOONCOGÉN SE TRANSFORMA EN UN ONCOGÉN POR:
    • 1. Mutaciones ocasionadas por:
      • Error fortuito en la duplicación de ADN.
      • Causas físicas
        • Radicaciones ionizantes (Rx, R gamma).
        • Rayos ultravioleta (UVB, UVC)
      • Causas químicas: Carcinógenos (tabaco).
      • Causas biológicas: Virus oncogénicos (v-onc a c-onc), aflatoxinas.
    • 2. Fallo en alguno de los mecanismos de reparación del ADN.
    • 3. Remodelación de la cromatina (cambios epigenéticos):
      • Cambios en la compactación del ADN (alteración en las histonas)
      • Metilación de nucleótidos
  • 33. Mutaciones
    • Genómica: Pérdida o ganancia de cromosomas completos: Poliploidía, Aneuploidía (Trisomía, monosomía)
    • Cromosómica: Reordenamiento de la estructura cromosómica: Inversiones, deleciones, duplicaciones, translocaciones.
    • Molecular o puntual: Inserciones o deleciones de bases. (perdida de sentido, sin sentido)
  • 34. Mutación genómica Trisomía 21
    • Leucemia aguda infantil
      • Linfoblástica
      • Mieloblástica
      • Megacarioblástica
  • 35. Mutación cromosómica: Deleción Se pierden Genes
  • 36. Mutación cromosómica: Inserción Se puede alterar la estructura de los Genes
  • 37. Mutación cromosómica: Duplicación Se puede duplicar la actividad de los Genes
  • 38. Mutación cromosómica: Inversión Se puede alterar la estructura de los Genes
  • 39. Mutación cromosómica: Translocación Se puede alterar la estructura de los Genes
  • 40. Mutación cromosómica: Translocación Robertsoniana Se pierden Genes Se puede alterar la estructura de los Genes
  • 41. Ejemplo de translocación Cromosoma de philadelphia Ph’ t(9;22)(q34;q11).
  • 42. Mutación molecular: Deleción
  • 43. Mutación molecular: Inserción
  • 44. Mutación molecular: Frameshift (desfase del marco de lectura)
    • Se altera la agrupación de codones, dando una traducción completamente diferente del original.
  • 45. Mutación molecular: Misssense (Con sentido alterado)
  • 46. Mutación molecular: Nosense (Sin sentido) Pueden dar lugar a la formación de un “codón de parada” Codón de Parada UAA UAG UGA
  • 47. Ejemplo de mutación puntual
    • Una mutación sustituye el aminoácido glicina por valina en el gen RAS.
    • Produce una proteína RAS insensible a la inactivación por GAP, por lo que la proteína RAS permanece activa.
  • 48. miRNA Regulan negativamente la expresión génica
  • 49. miRNA Oncomirs=miRNA implicados en el Cáncer miRNA con actividad oncogénica Incrementa la actividad del oncogén miRNA con actividad oncogénica Reduce la oncosupresión miRNA actuaría como oncosupresor miRNA actuaría como oncosupresor 21-23 miR-34a
  • 50.  
  • 51. 7. Código Epigenético Metilación : El aumento de la metilación interfiere la transcripción. (inactivaría un Gen Supresor y favorecería el cáncer) La disminución de la metilación de un protooncogén, activa su transcripción y favorece el cáncer. “ Código de las Histonas”: Acetilación , metilación fosforilación. La acetilación de histonas aumenta la transcripción, debido a que se une menos al ADN. La metilación de histonas puede tanto activar como reprimir la transcripción dependiendo de qué residuos de lisina estén metilados “ Epimutaciones” ejemplos
  • 52. 8. Una breve reseña histórica
    • El inicio del descubrimiento de los oncogenes fue en 1910.
    • Por los estudios del patólogo Francis Peyton Rous.
  • 53. ¿Que hizo Rous?
    • Transmitió el sarcoma de pollo a docenas de gallinas, mediante un extracto de cultivo celular tumoral, que no contenía células vivas.
    • Sospechó que el agente causal debería ser de menor tamaño que las células y que las bacterias (agente carcinógeno) (virus).
  • 54. Virus del sarcoma de Rous (src)
    • Está formado por cuatro genes:
      • Tres son imprescindibles para la multiplicación del virus.
      • v-src actúa como oncogén.
        • gag , proteínas de la cápside
        • pol , reverse transcriptase
        • env , proteínas de la envoltura
        • src , codifica una tirosina kinasa
  • 55. En la década de los ochenta
    • Bishop y Varmus descubrieron que las secuencias del v-src también se encuentran en el ADN de las células normales ( c-src ) (protooncogén).
    • El c-src está tanto en aves, como en muchos vertebrados e incluso en los humanos.
    • v-src contiene intrones y exones:
    • Son secuencias exclusivas de ADN animales y no virales.
    • El v-src debió ser arrastrado por el virus al desprenderse del ADN de alguna célula animal infectada durante la evolución.
  • 56. Virus del sarcoma de Rous (src) c-src v-src
  • 57. Virus del sarcoma de Rous (src) c-src codifica la proteína “Bishop pp60c-src” Se une al interior de la membrana celular Fosforilando proteínas de transmisión de señales (las inactiva) v-src codifica una proteína “Bishop pp60c-src” anormal
  • 58. Conclusiones
    • Los protooncogenes son genes normales que regulan la proliferación celular.
    • Los oncogenes son protooncogenes mutados que provocan proliferación celular excesiva.
    • Hay otros factores no genéticos (epigenéticos) que actúan en la oncogénesis .
    • Para que exista una transformación maligna se deben alterar otros genes ( progresión tumoral ).
  • 59. MUCHAS GRACIAS POR SU ATENCIÓN NÓICNETA US ROP SAICARG SAHCUM
  • 60. HOSPITAL LLUÍS ALCANYÍS SERVICIO DE PATOLOGÍA Xàtiva – Valencia 12 al 14 de enero de 2009 BASES MOLECULARES DEL CÁNCER APLICACIÓN A LA PATOLOGÍA TUMORAL
  • 61. ENLACES http://www.ncbi.nlm.nih.gov/projects/genome/guide/human/ Genoma humano http://atlasgeneticsoncology.org/index.html Atlas de genética en oncología y hematología http://ghr.nlm.nih.gov/ Genetic home reference http://proteinatlas.org/index.php Atlas de proteínas humanas http://www.cgal.icnet.uk/DNA_Repair_Genes.html Human DNA repair genes http://content.nejm.org Oncogenes and Cáncer N Eng J Med 2008;358-502-11
  • 62.  
  • 63. P53 “ El Guardián del genoma” E6
  • 64. Gen RB Normal Gen RB Mutante
  • 65. Caspasas: ( c isteinil- asp artato protea sas )
  • 66. Carcinogénesis
    • Es un proceso de pasos múltiples, tanto a nivel fenotípico como genético (acumulación de mutaciones) Progresión Tumoral .
  • 67.  
  • 68. telómeros
  • 69.  

×