Marcadores moleculares

15,779 views

Published on

0 Comments
7 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
15,779
On SlideShare
0
From Embeds
0
Number of Embeds
7
Actions
Shares
0
Downloads
659
Comments
0
Likes
7
Embeds 0
No embeds

No notes for slide

Marcadores moleculares

  1. 1. Raul Blas, 2010 Facultad de agronomia Dpto. Fitotecnia [email_address] Marcadores moleculares
  2. 2. Marker (Cambridge, 2002) a sign wich shows where something is. an action which is understood to represent or show a characteristic of a person or thing or feeling. Marcador Que marca (se ñ al que se pone a una persona o cosa para reconocerla), marca registrada …
  3. 3. Qué es un marcador? Un marcador es considerado como un carácter cuyo patrón de herencia puede definirse en un nivel morfológico (fenotípico), bioquímico o molecular. Se asocian marcadores con caracteres, para esclarecer la probabilidad de relación entre un locus genéticos y un carácter determinado
  4. 4. Marcadores moleculares <ul><li>Desde el punto de vista de un análisis de relación genética los marcadores moleculares son: </li></ul><ul><li>Puntos específicos fijados a un cromosoma </li></ul><ul><li>La herencia es completamente Mendeliana </li></ul>
  5. 5. Genética <ul><li>Primera ley de Mendel? </li></ul><ul><li>En un diploide los dos </li></ul><ul><li>Alelos de un gen segregan en los </li></ul><ul><li>gametos con igual frecuencia </li></ul><ul><li>individuo: Aa  gametos: A 50%, a 50% </li></ul>
  6. 6. <ul><li>Primera ley de Mendel y frecuencias F2? </li></ul><ul><li>F1  F1: Aa  Aa </li></ul>F2: 1/4 AA 2/4 Aa 1/4 aa (codominante) 3/4 A- 1/4 aa ( A dominante)
  7. 7. F2: AA 1/4 Aa 2/4 aa 1/4 (codominante) A- 3/4 aa 1/4 ( A dominante) No se puede distinguir AA o Aa Como se interpreta esto con marcadores moleculares: Aa aa AA Co-dominante Dominante Aa aa AA
  8. 8. <ul><li>Tipos de marcadores genéticos </li></ul><ul><ul><ul><li>1. Marcadores morfológicos (Efecto combinado de muchos genes y el ambiente). </li></ul></ul></ul><ul><ul><ul><li>Caracteres morfológicos son los más antiguos y ampliamente usados. </li></ul></ul></ul><ul><ul><ul><li>Son profundamente afectados por fluctuaciones ambientales y por las etapas de desarrollo de la planta, así como por el vasto número de individuos a analizar. </li></ul></ul></ul>
  9. 9. Marcador morfológico
  10. 10. Visualización de los Fragmentos Amplificados Polimorfismo 1 2 M 1 2 M
  11. 11. Marcadores moleculares Cualquier señal o traza molecular que nos permite estudiar un caracter ( Fenotipo ) o gen (Genotipo) asociado a este, y de herencia mendeliana (Marcador Genético) y detectada como secuencias de ADN o proteínas <ul><li>Detección de variabilidad a nivel de secuencias de ADN. </li></ul><ul><li>Fuentes de origen de MM </li></ul><ul><ul><li>1. ADN cromosómico (genómico) </li></ul></ul><ul><ul><ul><li>ADN codificante </li></ul></ul></ul><ul><ul><ul><li>ADN no codificante </li></ul></ul></ul><ul><ul><ul><li>ADN altamente repetido </li></ul></ul></ul><ul><ul><li>2. ADN extracromosómico </li></ul></ul><ul><ul><ul><li>ADN mitocondrial </li></ul></ul></ul><ul><ul><ul><li>ADN de cloroplastos </li></ul></ul></ul>AFLP RAPD SSR
  12. 12. <ul><li>Procedimientos Generales en el uso de MM: </li></ul><ul><ul><ul><li>1. Extracción de DNA </li></ul></ul></ul><ul><ul><ul><li>2. Generación de polimorfismo </li></ul></ul></ul><ul><ul><ul><ul><li>Enzimas de restricción </li></ul></ul></ul></ul><ul><ul><ul><ul><li>Reacción PCR </li></ul></ul></ul></ul><ul><ul><ul><ul><li>Combinación de los 2 anteriores (enzimas de restricción y PCR) </li></ul></ul></ul></ul><ul><ul><ul><li>3. Electroforesis (horizontal, y/o vertical) </li></ul></ul></ul><ul><ul><ul><li>4. Detección de los fragmentos </li></ul></ul></ul><ul><ul><ul><ul><li>Sondas marcadas </li></ul></ul></ul></ul><ul><ul><ul><ul><li>Bromuro de etidio, UV </li></ul></ul></ul></ul><ul><ul><ul><ul><li>Quimioluminiscencia </li></ul></ul></ul></ul><ul><ul><ul><ul><li>tincion en plata </li></ul></ul></ul></ul><ul><ul><ul><li>5. Autoradiografía y/o fotografia </li></ul></ul></ul><ul><ul><ul><li>6. Evaluación de los fragmentos </li></ul></ul></ul><ul><ul><ul><li>7. Análisis estadístico </li></ul></ul></ul>
  13. 13. Aislamiento de DNA ‘ CTAB’ Proteina/polisacaridos DNA Moler hojas Marcos Malosetti, 2007 Wageningen University + + cloroformo Transferir sobrenadante isopropanol Eliminar isopropanol, Disolver en H20, TE
  14. 14. Conceptos Enzimas de restricción (Endonucleasas): Son proteínas que reconocen secuencias cortas de nucleótidos específicas y cortan ADN en esas zonas. ADN Pst I
  15. 15. Iniciadores (“Primers”): Es una secuencia corta de ácido desoxirribonucleótido (ADN) que se ancla a una hebra del ADN molde. El cual se requiere para la síntesis de ADN in vitro (reacción de polimerización), ya que la ADN polimerasa solo no es capaz de iniciar la polimerización de ADN .
  16. 16. <ul><li>La reacción en cadena de la Polimerasa (Polymerase Chain Reaction - PCR): Es una técnica in vitro de amplificación enzimática del ADN. Mediante el cual se obtiene millones de copias de secuencias específicas del genoma de un organismo. </li></ul><ul><li>ciclos, consta de 3 pasos: </li></ul><ul><li>Denaturación : es una denaturación termal de la muestra de ADN , a 94- 95°C. </li></ul><ul><li>Anclaje de iniciadores (Renaturación) : la temperatura de la mezcla es enfriada hasta los 35-60°C. </li></ul><ul><li>Síntesis  (polimerización): La temperatura es elevada a 70 - 85 °C, la temperatura óptima (72°C) </li></ul>
  17. 17. <ul><li>Los componentes de amplificación para la reacción PCR son : </li></ul><ul><ul><ul><li>primers sintéticos , que son regiones complementarias a las cadenas opuestas que flanquean a la región de ADN blanco que se desea amplificar. </li></ul></ul></ul><ul><ul><ul><li>Una secuencia blanco en una muestra de ADN </li></ul></ul></ul><ul><ul><ul><li>Una enzima , la ADN Polimerasa termoestable que pueda resistir altas temperaturas de calentamiento (95° C a más). </li></ul></ul></ul><ul><ul><ul><li>Los cuatro deoxiribonucleótidos (dNTPs). </li></ul></ul></ul><ul><ul><ul><li>Un buffer para darle las condiciones adecuadas al sistema en conjunto. </li></ul></ul></ul>
  18. 20. 2 x -2x, x= número ciclos
  19. 21. Preparación de gel para electroforesis
  20. 22. Electroforesis : Es el movimiento de una partícula cargada (ion) en un campo eléctrico. El movimiento se realiza en medio líquido que está sostenida por sustancia sólida inerte, como papel o gel semisólido.
  21. 23. Sistema de marcadores DNA DNA ******* probe Basados en hibridación RFLP, VNTR, oligonucleotide fingerprinting Basados en amplificación DNA RAPD, DAF, AFLP, SSR, MP-PCR, ISSR, IRAP, REMAP, STS, SCAR, CAPS Basados en secuenciamiento ATTAGTCTTACCTAGGAATCGATT TAATCAGAATGGATCCTTAGCTAA EST, SNP, DNA microarray Gupta et al., 1999
  22. 24. Tipo de polimorfismo <ul><li>Alta resolucion : </li></ul><ul><li>Al nivel de par de bases </li></ul><ul><li>Baja resolucion : </li></ul><ul><li>Al nivel de fragmentos de restriccion o fragmentos amplificados </li></ul><ul><li>RFLP </li></ul><ul><li>RAPD </li></ul><ul><li>AFLP </li></ul><ul><li>SCAR </li></ul><ul><li>CAPS </li></ul><ul><li>SSR </li></ul><ul><li>i-SSR </li></ul>
  23. 25. + Enzimas de restricción = digestión Electroforesis en geles de agarosa DNA genómico Southern Blot Esponja Gel Membrana Papel toalla Membrana con DNA transferido Hibridación con sonda Perfil de polimorfismo obtenido RFLP
  24. 26. Esta técnica se vale de la capacidad que tienen las enzimas de restricción para poder reconocer secuencias especificas a lo largo del genoma, de modo que una mutación puntual dentro del sitio de restricción resultará en la pérdida o ganancia de una secuencia de reconocimiento, dando origen a un fragmento de restricción de diferente longitud a la del original. Las mutaciones causadas por una inserción, deleción o inversiones en el DNA también llevan a variación en la longitud de los fragmentos de restricción. Los fragmentos del genoma generados por las enzimas de restricción son separados en un gel de agarosa para luego ser transferidos a un soporte sólido que puede ser una membrana de nylon o nitrocelulosa. La transferencia de los fragmentos de DNA desde la matriz de agarosa hasta la membrana se realiza por capilaridad. Una vez que se encuentran en el soporte sólido, el DNA digerido y separado, puede ser hibridizado con una sonda (DNA de una sola hebra) que debe estar marcada para su fácil detección. La sonda se hibridará en el lugar donde encuentre la zona complementaria a su secuencia. Para hacer visible el lugar donde se ha hibridado la sonda, ésta debe tener algún tipo de señal (marcaje) RFLP
  25. 27. Obtención de marcadores RFLP.
  26. 28. Random Amplified Polymorphic DNA RAPD Amplificación de ADN anónimo con cebadores de secuencia arbitraria
  27. 29. Temperatura de Hibridizacion: 36-42C RAPD: iniciaodores unicos , cortos y aleaoritos
  28. 30. <ul><li>Consiste en la amplificación mediante PCR de un ADN anónimo, utilizando para ello un cebador de secuencia arbitraria </li></ul><ul><li>Normalmente se usa un solo iniciador de 10 nucleótidos de longitud </li></ul>
  29. 31. RAPD: AMPLIFICA MULTIPLES REGIONES (MULTILOCI)
  30. 32. Correspondencia entre fragmentos amplificados y bandas en un gel _ +
  31. 33. Los RAPDs son marcadores dominantes 1 3 2 1 2 3 A A a A a a AA Aa aa
  32. 35. Desventajas <ul><li>Problemas de reproducibilidad </li></ul><ul><li>Presencia de homoplasia en las bandas </li></ul><ul><li>Nivel de información limitada debido a su naturaleza dominante (no se puede diferenciar un heterocigoto de un homocigoto, el locus se reduce a un solo alelo) </li></ul>Ventajas <ul><li>Requiere baja cantidad de DNA </li></ul><ul><li>Facil de obtener </li></ul><ul><li>Aplicabilidad a cualquier genoma </li></ul><ul><li>Bajo costo </li></ul>
  33. 36. RAPD (Random Amplified Polymorphic DNA) <ul><li>Reaccion PCR </li></ul><ul><li>Primers deben encontrar secuencias complementarias entre 200 – 2500 pb </li></ul><ul><li>Tincion (bromuro de etidium) </li></ul>
  34. 37. RAPD Reaccion PCR Electroforesis Tinción y visualización de los fragmentos de amplificación Polimorfismo con la técnica RAPD
  35. 40. Amplified Fragment Length Polymorphism AFLPs
  36. 41. ADN Genómico Digestión Ligación PCR1:Preamplificación Pcr2:Amplificación selectiva Electroforesis Autoradiografía Tinción Nitrato de plata Metodología de obtención de Marcadores AFLP Mse adapter Eco adapter Mse primer N N Eco primer Eco R I Mse I Mse primer NNN NNN Eco primer
  37. 42. GAATTC TTAA CTTAAG AATT Principios de la técnica AFLP 1. Digestión del ADN Genómico Eco RI Mse I AATTC T G AAT Liberación de fragmentos con terminales Eco RI y Mse I TTAA TA Adaptador Eco RI Adaptador Mse I 2. Ligación con adaptadores de secuencia conocida AATTC N N T TA TTAA G N N AAT
  38. 43. AATTC N N T TA TTAA G N N AAT 3. Amplificación preselectiva 5 T G 5 AATTC T NN NN C T TA TTAA G A NN NN G AAT AATTC T NN NN C T TA TTAA G A NN NN G AAT 5’ T TG AG G 5’ AATTC T TG TC C T TA TTAA G A AC AG G AAT 4. Amplificación selectiva Electroforesis en geles de poliacrylamida
  39. 44. Obtención de marcadores AFLP Polimorfismo en Arracacha, según la combianción de los iniciadres E-AAC/M-CTT.
  40. 45. Desventajas <ul><li>Presencia de homoplasia en las bandas </li></ul><ul><li>Nivel de información limitada debido a su naturaleza dominante </li></ul>Ventajas <ul><li>Reproducibles </li></ul><ul><li>Elevado número de bandas obtenidas por gel </li></ul><ul><li>No se necesita información previa para su desarrollo (sondas o iniciadores específicos) </li></ul>
  41. 46. Raul Blas
  42. 47. Simple Sequence Repeat SSR Sinónimos Microsatélites STR - Short Tandem Repeat STMS - Sequence Tagged Microsatelite Site SSLP - Simple Sequence Length Polymorphism
  43. 48. <ul><li>Fragmentos de ADN formados por unidades repetitivas de secuencia simple. </li></ul><ul><li>Estas unidades o motivos se componen de 1 a 6 pares de bases y su grado de repetición es relativamente bajo. </li></ul><ul><li>Se utilizan un par de iniciadores (20 pb aprox) para su amplificación </li></ul>¿Que son microsatélites? TTTTT T TTTT = T 10 AGAGAG A G AGAG = AG 6 CATCATCAT CAT CATCAT = CAT 6 TAGTTAGTTAGT TAGT TAGTTAGT = TAGT 6 Mononucleotido Dinuclotido Trinucleotido Tetranucleotido
  44. 49. ADN genómico ...... CAGCCCGTAAATGTATCCATC ATTAGCTTTCGATAAAGACCA TCT C TCTCTCTC TCT CTC TCTCTC T CT C TGTGAAACCCAGTTGAATTAGAATTTTGAATTT ...... ...... GTCGGGCATTTACATAGGTAGTAATCGAAAGCTATTTCTGGT AGAGAGAGAGAGAGAGAGAGAGAGAGAG ACACTTTG GGTCAACTTAATCTTAAAACTTAAA ...... Microsatélite (TC) 14
  45. 50. http://www.personal.psu.edu/faculty/j/e/jec16/Image02.htm OBTENCION DE MICROSATELITES
  46. 51. Tipos de SSR Perfectos: (CA) n Imperfectos: (CA) n – CCA – (CA) m Compuestas: (CA) n (TG) m Compuesta interrumpido: (CA)n –TG-(TG)m Compleja: (CA)n –TG-(TG)m (TA)r n, m y r = número de repeticiones del motivo GT n los mas extendidos en genoma de mamíferos At n la mas extendida en genoma de vegetales GA n mas abundante en cebada y arroz
  47. 52. Marcadores microsatélite Etapas de la técnica SSR incluyen: Huamani, 2008 1. Reacción PCR, con dos iniciadores especificos para un locus SSR 2. Electroforesis en geles Poliacrilamida o agarosa (casos muy limitados) I II III PCR en P 1 , 3 y 6 I II III PCR en P 2 , 2 y 5 IBT Gene Amp F1 F2 F3 1 4 7 5 6 8 0 ce 9 enter stop 2 3 F4 F5 I II III PCR en 1 y 4 100 pb 1000 pb M P 1 P 2 1 2 3 4 5 6
  48. 54. Los SSR son marcadores codominantes 1 2 3 4 5 1 2 3 4 5
  49. 55. Extrategias de desarrollo de iniciadores SSR <ul><li>Clonamiento, secuenciamiento y diseño de iniciadores </li></ul><ul><li>Identificación de primers microsatélite a partir de marcadores ISSR </li></ul><ul><li>Búsqueda de marcadores SSR en la base de datos del Genbank. </li></ul><ul><li>Transferibilidad de otras especies afines (empleo de iniciadores disponibles) </li></ul>
  50. 56. <ul><li>Poseen alta variabilidad en sus loci, apropiado para los análisis de diversidad genética. </li></ul><ul><li>Se encuentran distribuidos por todo el genoma permitiendo hacer un buen muestreo genético del material en estudio. </li></ul>Ventajas Desventajas <ul><li>Su caractierizacion es especifica por especie </li></ul><ul><li>Su identificacion(descubrimiento) y hacerlo usable es costoso. Requiere secuenciamiento de librerias de DNA </li></ul>
  51. 57. <ul><li>Aplicacion de marcadores moleculares </li></ul><ul><ul><ul><li>Analisis de la diversidad genetica </li></ul></ul></ul><ul><ul><ul><li>Herencia y mapeo </li></ul></ul></ul><ul><ul><ul><li>Genes candidatos </li></ul></ul></ul><ul><ul><ul><li>Herramienta de seleccion: Seleccion asisitida por marcadores moleculares (MAS) </li></ul></ul></ul>Raul Blas, 2010
  52. 58. Fases sucesivas en la creación de una nueva variedad 1. Gestion de recursos 2. Cambios en los genotipos 3. Selección (selección estabilizadora), 4. Multiplicación del genotipo mejorado
  53. 59. Poblaciones naturales, variedades nativas, … Idiotipo Contexto: Agronomico Industrial Alimenticio social Objetivos Biologia Tecnologia Tiempo Materiales Presupuesto Ganancia gen é tica M é todos de mejoramiento Mejoramiento genetico de plantas
  54. 60. Fases sucesivas en la creación de una nueva variedad 1. Gestion de recursos gen é ticos 2. Cambios en los genotipos 3. Selección (selección estabilizadora), 4. Multiplicación del genotipo mejorado
  55. 61. <ul><li>Es la selección indirecta por la presencia o ausencia de un fenotipo o componente fenotípico deseado, basado en la secuencia o patrones de banda de los marcadores moleculares ubicadas dentro o cerca de genes que controlan el fenotipo. </li></ul><ul><li>La secuencia polimorfico o patron de banda del marcador molecular es indicativo de la presencia o ausencia de un gen específico o segmento cromosomal que es conocido y que lleva un alelo deseado. </li></ul>Selecci ó n asistida por marcadores moleculares – Molecular assisted selection ( MAS )
  56. 62. Capel et al. (2000)
  57. 63. <ul><li>Es la posibilidad de disponer de marcadores ligadas a los genes implicados en la variacion de los caracteres seleccionados. </li></ul><ul><li>MAS tiene los siguientes objetivos : </li></ul><ul><li>Dirigir las recombinaciones para acumular en un mismo genotipo los genes o segmentos cromosomicos favorables </li></ul><ul><li>Facilitar la selecci ó n (selecci ó n eficaz) </li></ul>… Molecular assisted selection ( MAS )
  58. 64. Aspectos a considerar en MAS  <ul><li>Distancia genética ( Mapas de ligamiento) </li></ul><ul><li>Marcadores asociados con caracteres de interes (< 5cM) (Kelly, 1995) </li></ul><ul><li>En algunos cultivos existen mapas bien definidos y densos : Arroz, maiz, trigo, tomate, papa </li></ul><ul><li>Modo de herencia (Calidad marcador) </li></ul><ul><li>Codominantes (capacidad de identificar los genotipos) </li></ul><ul><li>Tipo de marcador </li></ul><ul><li>Material genético </li></ul>
  59. 65. Generación de un mapa genético <ul><li>Mapa genético: Representacion de marcadores/ genes en los cromosomas (orden + distancias) </li></ul><ul><li>Requisitos: </li></ul><ul><ul><li>poblaciones segregantes </li></ul></ul><ul><ul><li>Determinación de los genotipos de los marcadores </li></ul></ul><ul><ul><li>Estimación de las frecuencias de recombinación entre todos los pares de marcadores </li></ul></ul><ul><ul><li>Determinación de grupos asociados </li></ul></ul><ul><ul><li>Determinación el orden por grupo de asociación </li></ul></ul>
  60. 66. Tama ñ o de la poblaci ó n <ul><li>Determinado por el numero de semillas y de marcadores disponibles, es importante establecer el numero minimo de individuos a utilizar para conocer la precision del calculo de las frecuencias de recombinacion que permitan construir un mapa fiable. </li></ul><ul><li>Usualmente la progenie a evaluar se cosntitule de >100 individuos a fin de reducir el error estandar </li></ul><ul><li>Otros autores consideran suficiente un numero de 50 individuos </li></ul>
  61. 67. Poblacion de mapeo <ul><li>Los descendientes mas usados tienen como punto de partida dos parentales homocigotas, esto por cruzmiento produce f 1 todos identicos y heterocigotas para todo los locus que han sido fijados alelos diferentes en los parentales </li></ul><ul><li>Se debe buscar parentales geneticamente bien alejadas para que el numero de locus polimorficas no sean limitantes </li></ul><ul><li>Tres tipos principales de poblacion de cartografia pueden ser derivados de estos cruzamientos </li></ul>
  62. 69. AA BB x F 1 BC 1 F 1 F 2 RIL DH AB AB, BB AA, BB AA, AB? BB AA, AB, BB duplicacion F 1 xBB X X X X X X Retrocruza: BC1F1 Poblacion segregante filial 2: F2 Lineas endogamicas recombinantes: RILs Lineas de haploides duplicados: DH Tipos de poblaciones para mapeo
  63. 70. Determinación del orden Ejemplo: Par Frecuencia de Recombinación ---- ------------- A-B 0.1 B-C 0.1 A-C 0.2 A B C +----------+----------+ <- 0.1 -> <- 0.1 -> <- 0.2 -> No es posible otro orden!!!
  64. 71. Ejemplo con tres marcadores <ul><li>Tabla de conteo de recombinaciones </li></ul><ul><ul><ul><li>Marcador 1 <–> Marcador 2 = 30 </li></ul></ul></ul><ul><ul><ul><li>Marcador 1 <–> Marcador 3 = 15 </li></ul></ul></ul><ul><ul><ul><li>Marcador 2 <–> Marcador 3 = 20 </li></ul></ul></ul><ul><ul><li>Cuáles son las posibilidades? </li></ul></ul>M1 M2 M3 M1 M3 M2 M2 M1 M3 30 20 15 30 20 15 20 30 15
  65. 72. Gebhart (2004)
  66. 73. Determinacion de sexo en plantas Phoenix dactylifera L
  67. 74. Ubicacion taxonomica: Family:Palmaceae Sub-family: Coryphyoideae Tribe:Phoeniceae Genus: Phoenix El genero Phoenix, presenta ~ 12 especies, incluida
  68. 78. CONVERTIR LOS MARCADORES AFLP A SCAR Secuenciar el fragmento y elaborar iniciadores especificos
  69. 79. SCAR “ Sequence-characterized amplified regions” <ul><li>Aplicaciones </li></ul><ul><li>Búsqueda de co-dominancia </li></ul><ul><li>Selección asistida </li></ul><ul><li>Análisis de asociación </li></ul>
  70. 80. Aplicabilidad de marcadores PVY-LB para mejoramiento
  71. 81. Objectivos: Identificación de clones con el gen Ry adg y Ry sto para inmunidad a PVY. Identificación de clones con genes R dem o R blb o QTLs (que gobiernen un alto porcentaje de la resistencia observada) para resistencia rancha (tizón).
  72. 82. <ul><li>Material vegetal </li></ul><ul><li>Se analizó en total 61 clones, mas 5 controles: </li></ul><ul><li>36 clones avanzados resistentes y/o tolerantes a TT y PVY : </li></ul><ul><ul><ul><li>población B3 </li></ul></ul></ul><ul><ul><ul><li>población LTVR </li></ul></ul></ul><ul><ul><ul><li>hibridos somaticos </li></ul></ul></ul><ul><li>25 cultivares nativos (Huanuco) de adg, gon y phu: </li></ul><ul><ul><ul><li>14 clones resistentes a LB </li></ul></ul></ul><ul><ul><ul><li>11 clones susceptibles a LB </li></ul></ul></ul>
  73. 83. <ul><li>Métodos : </li></ul><ul><li>Se utilizaron marcadores alelo-específicos (iniciadores-SCARs, CAPs) seleccionados en CIP and Max Plant Institute: </li></ul><ul><li>Identificación de clones con resistencia a PVY </li></ul><ul><li>Se han identificado y validado 4 iniciadores: </li></ul><ul><ul><li>Adg: RYSC3 </li></ul></ul><ul><ul><li>stolon (M5, M6 y M17)   </li></ul></ul>
  74. 84. Primers and its sequences used in genotipes screening
  75. 85. Resultados M= marcador de peso molecular (cada 100pb), la flecha indica el marcador con un peso molecular de 400bp M M M Tamizado para PVY Perfil de amplificación para 14 clones (primer M5)
  76. 86. ... Tamizado para PVY Perfil de amplificación para 18 clones (primer M17)
  77. 87. Identificacion de genes para resistencia a la rancha
  78. 88. S. phureja Clon 618 S. circaeifolium CIP-761030 (6b.25; 6b.39) F1 plantulas (~300) Analisis fenotipico Analisis molecular invernadero campo Analisis de datos, mapeo AFLP SSR selected clones Estrategia de trabajo para mapeo genetico x 92
  79. 89. <ul><li>Extraccion de DNA </li></ul><ul><li>PCR (amplificacion del marcador de interes) </li></ul><ul><li>Electroforesis </li></ul><ul><li>Visualizacion de DNA </li></ul><ul><li>Evaluacion de polimorfismo (lectura de geles) </li></ul><ul><li>Descarte de individuos sin alelo de interes </li></ul><ul><li>Plantas seleccionadas </li></ul>Procedimiento para la aplicacion de MM en la seleccion: MAS
  80. 90. Identificación de progenies hibridas
  81. 91. <ul><li>MM como herramienta en Mejoramiento </li></ul><ul><li>Confiabilidad y repetibilidad </li></ul><ul><li>Marcadores con estrecho ligamiento a genes de caracteristicas importantes </li></ul><ul><li>Muy importante para caracteristicas dificiles (aquellas que no pueden ser facil o confiablemente medidos usando metodologias tradicionales (e.g. resistencia a nematodes…) </li></ul><ul><li>Otros pueden no ser visibles o solo detectados en plantas maduras </li></ul><ul><li>Otros son muy dificiles o costosas para el tamizado </li></ul><ul><li>La posibilidad de manejar poblaciones de mejoramiento de gran tama ñ o (en espacio reducido) </li></ul>
  82. 92. <ul><li>Limitaciones de la Tecnica MAS </li></ul><ul><li>Mapa genetico denso para el cultivo </li></ul><ul><li>Marcador ligado al gen (<5 cM) </li></ul><ul><li>Equipamiento </li></ul><ul><li>Tecnicos calificados para lab. </li></ul>
  83. 93. Producción de semillas y uso de marcadores moleculares <ul><li>Caracterización de cultivares </li></ul><ul><li>Pureza genética de cultivares </li></ul>
  84. 94. Dos cultivares de soya Identificación de variedades
  85. 95. Pureza genética
  86. 96. <ul><li>Conclusion : </li></ul><ul><li>Marcadores moleculares pueden tener numerosas aplicaciones en los diferentes fases de la seleccion: </li></ul><ul><li>Optimizacion de la conservacion de recursos geneticos </li></ul><ul><li>Seleccion de los parentales </li></ul><ul><li>Identificacion de alelos interesantes </li></ul><ul><li>Construccion de genotipos acumulando alelos interesantes </li></ul><ul><li>Finalmente, los MM dispone al mejorador para gestionar y valorizar la variabilidad genética </li></ul>
  87. 97. La selección asistida por marcadores y la selección fenotípica tradicional no son estrategias excluyentes y los programas de mejoramiento genético de mayor eficiencia se logran mediante una combinación de ambas estrategias. Consideración

×