Estudio caso bioseguridad papaya gm
Upcoming SlideShare
Loading in...5
×
 

Estudio caso bioseguridad papaya gm

on

  • 1,152 views

 

Statistics

Views

Total Views
1,152
Views on SlideShare
1,151
Embed Views
1

Actions

Likes
0
Downloads
27
Comments
1

1 Embed 1

http://lac.netmidas.com 1

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
  • Deseo tener comunicacion, porque en Puno-san Gaban estamos promoviendo el cultivo de Papaya
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Estudio caso bioseguridad papaya gm Estudio caso bioseguridad papaya gm Presentation Transcript

  • CURSO: “BIOSEGURIDAD Y BIOTECNOLOGIA MODERNA” Estudio de caso en bioseguridad: 4. Papaya GM Jorge Benavides Ranilla Instituto Nacional de Innovación Agraria, INIA La Molina
  • Papaya, es un fruto tropical con altocontenido de vitaminas A y C.Es un cultivo rentable por dar frutosen el primer año.Contiene papaina para usoindustrial y medicinal.
  • Origen de la Papaya Cultivated Domesticated papaya somewhere In Pacific between Taken into Asia Islandssouthern Mexico by 1800 and tropics in the 1600s GuatemalaCarica spp
  • Producción mundial de Papaya 6000 5000 40001,000s mt 3000 2000 1000 0 1965 1970 1975 1980 1985 1990 1995 2000 FAOSTAT, 1965 - 2000
  • Producción mundial de PapayaRegion País (1,000 TM)Africa Nigeria (748), Ethiopia (215), Congo (210)Asia India (700), Indonesia (484)Americas Brazil (1,476), Mexico (745) FAOSTAT database, 2000-2002
  • Los 10 paises mayores productores de papaya son:Brazil, Mexico, Nigeria, Indonesia, India, Ethiopa,Congo, Peru, China y Filipinas.Exportan ImportanMexico y Brazil USAUSA (Hawaii) yFilipinas JaponBrazil y Holanda Union EuropeaReference: FAO (FAOSTAT) 2005
  • La papaya en el Perú• Ranking-- Peru es el 8° productor a nivel mundial– 9° in the area sembrada (11,736 has)– 6° en volumen produced (175,428 TM)• Usos– 99.9% consumo interno– 0.01% es exportado, – En conserva (25.4 TM) – Congelada (4.9 TM) – Fresco (0.22 TM)• Ingresos por la exportación: – US $ 58 mil/año en 2009–La exportacion de papaya es debido a la presencia de laenfermedad por PRSV• Papaya cultivada es susceptible a la infección de PRSV• PERDIDAS: 40%
  • CARACTERISTICAS GENERALES DEL VIRUS PRSV• Virus de la Mancha Anillada de la Papaya• Miembro de la familia de los potyvirus• Forma de bastón alargado, partículas de 800-900 nm en longitud• RNA lineal de una sola hebra de 12 kb total, encapsulado por una proteína de cubierta
  • DATOS SOBRE EL CULTIVO DE PAPAYOA NIVEL NACIONAL:La producción nacional de papaya fue de 0.18 millones de toneladasmétricas en una superficie cultivada de 11,736 Ha (MINAG, 2006): Cuadro: Perú producción, superficie cosechada y rendimiento de papaya según Región o SubRegion 2006 Superficie Región cosechada Producción Rendimiento (Ha) Nacional 11,736 175,428 14.95 Huanuco 2,333 32,543 13.95 Ucayali 3,757 70,884 18.87 Pasco 93 1,364 14.67 Loreto 632 7,308 11.56 San Martin 992 11,893 11.99 Cusco 744 11,748 15.79 Madre de Dios 179 1,763 9.85 Puno 268 2,663 9.94 Ayacucho 145 1,378 9.50 Junin 1,324 10,537 7.96 Apurimac 67 540 8.06 Fuente: Direcciones Regionales de Agricultura- Dirección de Información Agraria Elaboración Ministerio de Agricultura. Dirección General de Información Agraria 2007
  • DATOS SOBRE EL CULTIVO DE PAPAYOA NIVEL MUNDIAL:La producción mundial de papaya fue de 5.4 millones de toneladasmétricas en una superficie cultivada de 340,594 Ha (FAO, 2001): Rendimiento de Papaya por País - 2001 40 35 30 25 TM/ha 20 15 10 5 0 ia a a ia na rú o go il di si as nd ic er Pe hi on ne In ex Br ig il a C C do N M Ta In
  • PROBLEMÁTICA NACIONAL Presencia del virus de la mancha anillada (PRSV-P), que ocasionapérdidas de 12000 TM/año (40%). 9 000 Ha de plantaciones infestadas equivalente a 25 000productores afectados. No se conocen genes de resistencia naturales.
  • SINTOMAS DEL PRSV enrrollamiento de hojas aclaramiento de nervadurasExudado de tallo ydebilitamiento del pedúnculo= caída de frutos 12 Manchas circulares en el fruto
  • VIRUS TRANSMITIDO POR AFIDOS 13
  • Estrategias• Mejoramiento tradicional• Mejoramiento asistido por marcadores MAS• Tecnología de Post cosecha• Mutaciones inducidas por metodos químicos y físicos• Ingeniería Genética
  • Fases de desarrollo de plantas transgenicas Gene DiscoveryLaboratorio Transformacion Cultivo de tejidos Invernadero Campo Comercializacion
  • Tecnología de papaya transgénicaSilenciamiento génico : gen RNA proteína DNA RNA evitando la expresión del gen (SGT) RNA proteína evitando que sea traducido (SGPT) 17
  • Silenciamiento a nivel del RNA • dsRNA formación de RNAs pequeños • este proceso se encuentra altamente conservado a lo largo de la evolución.ANIMALES: RNA de interferencia (RNAi)HONGOS: “quelling”PLANTAS: silenciamiento génico post-transcripcional(PTGS) 18
  • Uso del silenciamiento del ARN para la resistencia a virus•La generación de construcciones de ARNdh son muy eficientes en la inducción de silenciamiento del ARN Secuencia viral Secuencia viral Promotor Intron Terminador 90-100% plantas resistentes 19
  • MODELO DE SILENCIAMIENTO GENICOPOST_TRANSCRIPCIONAL VIRUS ssRNA Silenciamiento del virus Defensa 20
  • MODELO DE SILENCIAMIENTO GENICOPOST_TRANSCRIPCIONAL 21
  • Colecta de material de papayo contaminados con PRSV en Junín
  • Madre mía La Unión Colecta de material de papayo infectados con PRSV en Tulumayo Sutulluy distintas localidades: Chinchaivito Región San Martín: la Unión y Madre Mía Región Huánuco: Tulumayo y Chinchaivito Región Ucayali: Sutulluy
  • Colecta de Material Infectado con el Virus PRSV en Región Huánuco y San Martín
  • Mantenimiento en invernadero de plantas infestadascon virus y aislamiento de variantes virales de PRSV
  • INFECCION MECANICA PAPAYA CORTE DE HOJA PLANTA LIBRE DE VIRUS REALIZANDO INFECTADA INFECTADA PEQUEÑAS LESIONES LOCALES INFECCION DIRECTATAMPON FOSFATO EXTRACTO DEL VIRUS
  • EVALUACION DE LOS PLANTONES DE PAPAYO INFECTADOS
  • EXTRACCION DE ARN A PARTIR DE HOJAS INFECTADAS CORTE DE HOJAS INFECTADASPLANTON DE PAPAYOINFECTADO CON EL VIRUSPRSV ALMACENAMIENTO EN NITROGENO LIQUIDO
  • MORTEROS PRE COLOCACION DE LASMUESTRAS TRAIDAS DE ENFRIADOS MUESTRAS EN MORTEROINVERNADERO EN N2LIQUIDO TUBOS CON BUFFER DE EXTRACCION POLVO FINO DEL TEJIDOAGREGANDO N2 LIQUIDO A TRITURADOLAS MUETRAS TRITURACIÓN DEL TEJIDO VEGETAL
  • CALIDAD DE ARN TOTAL A PARTIR DE HOJAS DE PLANTAS DE PAPAYO INFECTADAS CON PRSV 28S RNAr 18S RNAr ELECTROFORESIS EN GEL DE AGAROSA AL 1%
  • Reacción de PCR 31
  • SINTESIS DE ADN COMPLEMENTARIO (ADNc)Y AMPLIFICACION POR PCR DE LA PROTEINA DE CUBIERTA 1.2kpb
  • Secuencia de la proteína de cubierta del PRSV (NCBI)
  • FORMATO DE MACROGEN PARA SECUENCIAMIENTO Custom primers sent along with DNA samples. Conc.(pmole/ul Name Sequence Tm value ) REP4 5´ GCTTCCGGAGCATCGATTGGAGCG 3´ 10 52 MB12A 5´ GACTCAACAAACACACAAGCGCA 3´ 10 52 Reaction Information 1 Total 42 sequencing reactions were ordered. # Sample Name Name of Seq primer PCR Primers (F/R) DNA conc. (ng/ul) 1 CP010202 REP4 Leave blank if no PCR 30 2 CP010202 MB12A Leave blank if no PCR 30 3 CP010204 REP4 Leave blank if no PCR 18 4 CP010204 MB12A Leave blank if no PCR 18 5 CP020102 REP4 Leave blank if no PCR 18 6 CP020102 MB12A Leave blank if no PCR 18 7 CP010308 REP4 Leave blank if no PCR 18 8 CP010308 MB12A Leave blank if no PCR 18 9 CP020506 REP4 Leave blank if no PCR 18 10 CP020506 MB12A Leave blank if no PCR 18 11 CP020105 REP4 Leave blank if no PCR 15 12 CP020105 MB12A Leave blank if no PCR 15 13 CP010106 REP4 Leave blank if no PCR 15 14 CP010106 MB12A Leave blank if no PCR 15
  • CROMATOGRAMAS DE SECUENCIAS VIRALES
  • SECUENCIAS COMPLETAS DE LA PROTEINA DE CUBIERTA DE PRSV OBTENIDAS
  • ANÁLISIS POR BLAST DE LA SECUENCIA DEAMINOACIDOS A PARTIR DE LA SECUENCIANUCLEOTIDICA CP010308
  • Secuenciamiento y análisis Filogenético de las razas virales 63 CP020204 52 CP020404 Región 43 CP020101 Huánuco y San M Huánuco y 100 San Martín CP020105 CP020102 CP010104 CP010202 CP010204 Junín Región Junín 72 80 CP010308 0.002
  • 27 Mexico 29 99 53 Thailandia China 3 Venezuela 2 17 Thailandia 45 98 Perú 99 99 99 Indonesia 52 Mexico 84 Thailandia 0 079 Florida USA 76 4 3 Thailandia Taiwan 0 99 Thailandia Mexico 0 99 13 China Mexico 4 98 Vietnam 75 Australia 10 11471 Vietnam 01 Mexico 9 28 Vietnam Jamaica 99 96 Florida USA América 2 37 Filipinas 0 1 35 Mexico 71 37 43 China Vietnam Asia 99 13 Florida USA Thailandia 0 9 9 Cuba Vietnam 99 10 Venezuela Japon 1 99 6 Mexico 15 Thailandia 6399 2 24 Venezuela Vietnam 0 31 35 Vietnam- China Brasil 21 58 1 4 79 15 Taiwan - Malasia 91 China 94 Vietnam India 7 27 Mexico Vietnam 29 99 9953 Thailandia 84 China India 17 60 Sri Lanka Thailandia India 45 98 99 99 India Indonesia 99 Pakistan 0 84 Thailandia 76 India Thailandia
  • Se realizó el diseño final delconstructo utilizando elprograma Vector NTI 10® deinvitrogen (Figura N°2), en lascuales incluía los fragmentosde interés, los sitios de corteenzimático y el tamaño totaldel plásmido, que resulto serde 9,724 pares de base.Este diseño y la construcciónvirtual del plásmido fueronmuy importantes para eldesarrollo físico del constructo
  • Todas las extracciones de ADN plasmídico fueron realizadas utilizando elkit comercial de promega Wizard ® plus SV Minipreps DNA PurificationSystem y resuspendidas en 50ul de agua libre de nucleasa.
  • Transformación genética
  • Transformación bacteriana y análisis de plásmidos quiméricos  Se han ligado las secuencias de interés en un vector comercial de clonamiento pGEM-T Bacteria E. coli dH5α El INIA cuenta con un equipoElectroporador, que se esta utilizando paraIncorporar las secuencias de interés en un vector
  •  Actualmente ya se tiene una lista de los vectores y fragmentos que nosproporcionaría el CIP:• Vector pCAMBIA 2305.1• Vector pCAMBIA 1305.1• pCIP92• pCIP90• pCIP41
  • Aislamiento por PCR (Reacción en cadena de la Polimerasa) Se han estandarizado las condiciones para obtener los fragmentosde interés mediante la amplificación por PCR con secuenciasespecificas; además se cuenta con técnicas de purificación a partir degeles de agarosa. Producto amplificado por PCR Producto purificado a partir de un gel de agarosa
  •  Además se cuenta con un cepario criopreservado a -70ºC de los plasmídos utilizados para las actividades de transformación genética.El Analizador genético adquirido por elCNBAF, permitió el secuenciamientoparcial del constructor pINIA001 Incubadora con shaker para cultivos bacterianos
  • In vitroSe cuenta con un protocolo de medio de micropropagación de plántulas de papayo in vitro.
  • Propagación del material vegetal  Se cuenta con la variedad de papayo PTM311 susceptibles al PRSV.  Mediante un acuerdo con el IIAP se realizó la transferencia del material vegetal para su uso con fines de investigación.Plántulas de papayo micropropagadas Cuarto de propagación con condiciones Plántulas de papayo regeneradas optimas para la regeneración del material vegetal
  • Germinación de semillas de papayo  Se ha establecido un protocolo de desinfección de semillas para ser introducidas in vitro.  Se tiene un medio de germinación in vitro.  Las plántulas obtenidas son utilizadas para la transformación genética Semillas germinadasCámara germinadora después de 3 semanas de introducidas
  • C3.- Desarrollar metodologías para la producciónde plantas de papayo resistentes al PRSV.  Se están desarrollando eventos de transformación con el gen GUS en hojas de papayo para estandarizar la metodología de trabajo.
  • Transformación genética con el constructo pINI001 en Papaya La transformación genética fue mediada por A. tumefaciens Medio de regeneración Medio selectivo de regeneración de embriones
  • C4.- Elaborar protocolos de bioseguridad para laexperimentación en la producción de plantas de papaya  Se realizó un taller con especialistas de diferentes instituciones a nivel nacional e internacional, para elaborar protocolos de bioseguridad en el caso de papaya transgénica.  Se tiene un informe técnico de esta reunión, así mismo se está a la espera de la aprobación de las “Normas internas de seguridad de la biotecnología del Instituto Nacional de Innovación Agraria”, producto del tallerDesarrollo de protocolos de bioseguridad en laboratorio,invernadero y campo para la manipulación de plantas realizado.transgénicas en el Perú
  •  Se ha incorporado el sexado de plantones de papayo con el fin deincrementar las medidas de bioseguridad para evitar posibles escapesmediante el flujo génico. Para lo cual se cuenta con secuenciasespecificas que permiten seleccionar plántulas de papayo hembras, queserán utilizadas en la transformación genética. SDP2 – SDP3 M14 M15 M16 M17 M18 M19 M20 H/M H/M F F F H/M F CFW – CRV U10 M1 M2 M3 M4 M5 M6 H/M H/M H/M F H/M F H/M NAPF76 – NAPF77 U10 M1 M2 M3 M4 M5 M6 H/M H/M H/M F H/M F H/M SDP1 –SDP2 M1 M2 M3 M4 M5 M6 H/M H/M F H/M F H/M Blga. Yenny Aquino encargada de realizar pruebas de determinación de sexo en papayo
  •  Se ha remitido al Comité Interno de Bioseguridad del INIA losprotocolos y documentación solicitada para obtener la autorización detrabajar con OVM´s en papayo.
  • Estandarización de protocolos para detección de eventos transgénicos en papayo Equipo de PCR en tiempo Real Se han establecido protocolos para la determinación de eventos transgénicos enpapaya. Así mismo una vez que se tenga la inserción del fragmento CP en el genoma dela papaya, este será analizado utilizando sondas especificas. Para estos tipos de análisis el INIA cuanta con un equipo de PCR en tiempoReal de ultima generación adquirido por el CNBAF
  • C5.- Fortalecimiento Institucional para el desarrollo de ingeniería genética y la bioseguridad  Capacitación en bioinformática dirigida por especialistas del CIP al personal profesional del INIATaller realizado en el CIP,organizado por el proyectoPapayo “Herramientas básicasde bioinformática aplicada alproyecto Papayo”
  • Infraestructura y equipos Se han adquirido equipos como la cámara de flujo vertical debioseguridad clase II, en donde se realiza actualmente los eventosde transformación genética en papayo y en microorganismos comoE. coli y Agrobacterium thumefaciens.
  • Invernadero de Bioseguridad Actualmente se esta construyendo uninvernadero de bioseguridad, donde sepondrán las plantas de papayos transgénicaspara su confinamiento y se realizaran laspruebas de resistencia al virus PRSV. Área para la construcción del Invernadero de Bioseguridad
  • Equipos y kits comerciales adquiridos para el proyecto papayo por intermedio del CIP.Kits paraextracción y Mini centrifugapurificación deácidos nucleicos Adquisición de Micropipetas
  • El Proceso de la Tecnología de la Papaya Transgénica
  • ConclusionesLos protocolos para el desarrollo del constructo pINIA001 resultaron ser eficientes a un 99%. Por loque al final se logro obtener el constructo pINIA001, el cual fue verificado con pruebas molecularesde PCR y con enzimas de restricción.La desinfección de semillas con el protocolo establecido resulto ser óptimo para la eliminación deHongos y bacterias a un 80%.El medio de germinación fue eficiente a un 60 %, pero se logro obtener buena cantidad deexplantes a partir de las semillas geminadas.Los callos transformados se mantienen viables en medio selectivo con kanamicina por lo que sededuce que en estos se encuentra por lo menos parte del gen de resistencia nptII. Se espera tenerla regeneración total y la propagación de la planta para poder realizar las pruebas moleculares.La transformación genética en papayo con embriones somáticos, resulta ser un proceso largo, portal motivo los resultados de la inserción del transgen no se pueden determinar hasta laregeneración del callo.Los primers y protocolos de PCR que fueron utilizados para verificar la inserción de los fragmentosen el constructo, también son viables para la verificación de la inserción del transgen en losexplantes de papayo transformados.