Kno.e.sis collaborations/projects with AFRL-HE
Upcoming SlideShare
Loading in...5
×

Like this? Share it with your network

Share

Kno.e.sis collaborations/projects with AFRL-HE

  • 866 views
Uploaded on

Outline of projects supported by or in collaborations with AFRL's 711 Human Performance Wing

Outline of projects supported by or in collaborations with AFRL's 711 Human Performance Wing

More in: Education
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
866
On Slideshare
866
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
0
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide
  • How does computing serve human needs? Knowledge is the enabler…KNOWLEDGE IS THE ENABLER FOR COMPUTING TO SERVE HUMAN NEEDS AND IMPROVE HUMAN EXPERIENCE.
  • Cognitive model, cognitive behavioral model

Transcript

  • 1. Kno.e.sis’ collaborations/projects with AFRL
    Amit ShethLexisNexis Ohio Eminent Scholar; Director, Kno.e.sis Center
  • 2. A Vision for Basic & Fundamental Research
    Sample Current Research in Collaboration with/funded by AFRL
  • 3. “..Integrate biological and cognitive technologies to optimize and protect the Airman's capabilities to Fly, Fight, and Win in Air, Space, and Cyberspace.”
    If one hopes to achieve a full understanding of a system as complicated as a nervous system, a developing embryo, a set of metabolic pathways, a bottle of gas, or even a large computer program, then one must be prepared to contemplate different kinds of explanation at different levels of description that are linked, at least in principle, into a cohesive whole, even if linking the levels in complete detail is impractical. (Marr 1982, p. 20).
  • 4. Data and Facts
    Human Performance
    Knowledge and Understanding
    Health & Performance
    Cognitive Science, Psychology
    Neuroscience
    Anatomy, Physiology
    ACATATGGGTACTATTTACTATTCATGGGTACTATTTATGGCATATGGCGTACTATTCTAATCCTATATCCGTCTAATCTATTTACTATTATCTATTACTATACCTTTTGGGGAAAAAAATTCTATACCGTCTAATCCTATAAATCAAGCCG
    Cellular biology
    Molecular Biology
    Biochemistry
    Comp Sc & Engg
    Human CC
  • 5. Human
    …to improve the understanding of fundamental cognitive processes required for human performance in virtual Environments.
    … to develop and demonstrate interface technologies that revolutionize human-human and human-machine collaboration
    Collaborative visualization
    OntologiesDomain Models
    MetabolomicsToxicology
    … decision support/adaptive automation to maximize an operator’s information processing and decision effectiveness
    Data annotationScientific workflow
    create and deliver relevant biotechnology & nanotechnology solutions for the battlefield
    airmen and the integrated joint services mission.
    Molecular modeling
    Knowledge driven search/browsing
    Biomolecular
  • 6. Metabolomics: Exposure to Toxic Agents
    Determine whether exposure has occurred
    Including low-dose exposure
    Predict downstream outcome
    Organ/system toxicity vs. recovery
    Using easily deployable tests
    Blood, urine, etc.
    • Dr. Michael Raymer, CSE. WSU
    • 7. Dr. Nick Reo, Boonshoft School of Medicine, WSU
    • 8. Dr. Nick DelRaso,711 Human Effectiveness Wing, USAF
  • Image registration and mosaicking
    ArdyGoshtasby: Intelligent Systems Labs Lab
    Image mosaic
    Six-camera images
    Funded by AFRL
  • 9. Ontology supported Knowledge Discovery in the field of Human Performance and Cognition
    WSU: C. Thomas, P. Mendes, D. Cameron, A. Sheth, TK PrasadThanks: C. Ramakrishnan
    AFRL: V. Chan (Dr. Schlager)
  • 10. Ontology supported Knowledge Discovery in Human Performance and Cognition
    Enable exploration, analysis, and integration of available knowledge, to discover and synthesize new knowledge using Semantic Web Technologies
    Domain model generation from public, up-to-date resources such as Medline and Wikipedia
    Identification of entities and relationships in Pubmed (and mapping them to ontology)
    Magnesium -> isa -> Calcium Channel Blocker -> prevents -> Migraine
    Knowledge Discovery enabled by text extraction, ontology-based formalization, and graph-based search
    Semantic Browsing mediated by extracted knowledge
  • 11. Increased Human Performance using Collaborative Visualization
    Collaborative visualization environment:
    • Visualization environment enhanced with several input feeds including video streams (video conference, UAV, …)
    • 12. Utilization of 3D audio in correspondence with input feed
    • 13. Different visualization systems connected via network
    • 14. Content exchangeable by participants via dragging/shoving over
    Visualization of:
    • Medical data
    • 15. Training scenarios
    • 16. Surveillance data
    • 17. Textual data (transcribed audio, intelligence databases, …)
    Increased human performance:
    • Highly interactive system
    • 18. Intuitive exchange of information among participants
    • 19. Assistance in decision making
    Key Personnel:Thomas Wischgoll (WSU), Brian Simpson (711 HPW/RHCB), Robert Gilkey (WSU)
  • 20. Other relevant projects (partial list)
    • Semantics and Services enabled Problem Solving Environment for Tcruzi: services computing, data/text mining, knowledge discovery [UGA, Stanford, CCHMC]
    • 21. MIDAS: Medical Information in Disasters Access and Analysis System [UCI]
    • 22. Situational Awareness:
    • 23. Trust in Sensor Web & Semantic Sensor Web
    • 24. Citizen Sensors – human-in-the-loop sensing combined with machine sensing
    • 25. Sense Making – understanding and improving discourse on Social Media [Cognitive Sc., IBM, Microsoft]
    • 26. Cloud computing – interoperablility [IBM]
  • http://knoesis.org