Kyle Jensen MIT Ph.D. Thesis Defense


Published on

  • Be the first to comment

No Downloads
Total views
On SlideShare
From Embeds
Number of Embeds
Embeds 0
No embeds

No notes for slide

Kyle Jensen MIT Ph.D. Thesis Defense

  1. 1. Motif discovery in sequential data Kyle Jensen Thesis Offense Department of Chemical Engineering Massachusetts Institute of Technology Thesis committee: Greg Stephanopoulos William Green Robert Berwick Isidore Rigoutsos ChE, MIT ChE, MIT EECS, MIT IBM
  2. 2. Sequencing throughput, like processor power, is growing exponentially
  3. 3. As a result, Genbank is overflowing
  4. 4. Anatomics Biomics Chromosomics Cytomics Enviromics Epigenomics Fluxomics Glycomics Glycoproteomics Immunogen. Immunomics Immunoproteomics Integromics Interactomics Ionomics Lipidomics Metabolomics Metabonomics Metagenomics Metallomics Metalloproteomics Methylomics Mitogenomics Neuromics Neuropeptido. Oncogenomics Peptidomics Phenomics Phospho-prot. Phosphoproteomics Physiomics Physionomics Post–genomics Postgenomics Pre–genomics Rnomics Secretomics Subproteomics Surfaceomics Syndromics Transcriptomics And the “ome-ome” keeps growing
  5. 5. Together, these data form a rich network of information
  7. 7. A grammar is a mathematical system for describing the structure of a language S -> NP VP NP 1 -> D NP | PN NP 2 -> ADJ NP | N VP -> V NP D -> a | the PN -> peter | paul | mary ADJ -> large | black N -> dog | cat | horse V -> is | likes | hates
  8. 8. GRAMMAR S -> NP VP NP -> D NP | PN NP -> ADJ NP | N VP -> V NP D -> a | the PN -> peter | paul | mary ADJ -> large | black N -> dog | cat | horse V -> is | likes | hates S => NP VP => PN VP => mary VP => mary V NP => mary hates NP => mary hates D NP 1 => mary hates the NP 1 => mary hates the N => mary hates the dog S => NP VP => NP V NP => NP V D NP 1 => NP V a NP 1 => NP V a ADJ NP 1 => NP is a ADJ NP 1 => NP is a ADJ ADJ NP 1 => NP is a large ADJ NP 1 => NP is a large ADJ N => NP is a large black N => NP is a large black cat=> PN is a large black cat => peter is a large black cat
  9. 9. Grammars can describe biological phenomena in the same manner as natural languages <ul><li>Two examples </li><ul><li>Example: a declarative sentence in English
  10. 10. Example: eukaryotic gene structure </li></ul></ul>S D N NP V A P NP D N the boy is upset over the girl the advisor is pleased with the research S -> NP V A P NP NP -> { D N N gene start codon upstream primary transcript TATA box exon intron exon stop codon ATGACTGACTGATCGATCGATCGATCGATGATCGTACGATCGATGCATCGATCGATCGATCGATCGA
  11. 11. Grammars are suitable for describing any complex arrangement of sequential data <ul><li>The grammar of biological sequences </li></ul>language grammar linguistic example biological example complexity
  12. 14. Simple, regular grammars are compactly written as regular expressions [LIVF].........[LIV][RK].(9,20)WS.WS....[FYW]
  14. 16. Part 1: Rational design of antimicrobial peptides using linguistic methods
  15. 17. Antimicrobial peptides are small proteins that attack and kill bacteria <ul><li>Functional characteristics: </li><ul><li>Part of innate immune system </li><ul><li>all multicellular eukaryotes </li></ul><li>Attack bacterial membrane </li><ul><li>electrostatic attraction
  16. 18. effective at µg/mL concentrations </li></ul></ul></ul><ul><li>Applications of AmPs: </li><ul><li>Novel class of antibiotics </li><ul><li>low bacterial resistance
  17. 19. activity against “MDR” pathogens
  18. 20. currently topical: acne, etc. </li></ul><li>Other clinical applications </li><ul><li>AIDS, certain cancers, biodefense </li></ul></ul></ul>AmPs bacterial membrane + + - -
  19. 22. AmP sequences contain many repeated motifs, suggesting a linguistic model <ul><li>AmP amino acid sequences </li><ul><li>~1000 natural AmP sequences </li><ul><li>from many different species </li></ul><li>Numerous conserved motifs </li><ul><li>suggest “rules” for building AmPs
  20. 23. similar to grammar of languages </li></ul></ul></ul>cecropins cecropin motif <ul><li>The “language” of AmP sequences </li><ul><li>Can we find the underlying grammar of this language? </li><ul><li>Will this grammar capture the sequence/function relationships? </li></ul><li>Knowing the grammar, can we build novel AmPs? </li></ul></ul>
  21. 24. The AmP sequences were modeled using simple regular grammars <ul><li>Given a language, is there a regular grammar? </li><ul><li>Example: the cecropin sub-sequences </li></ul><li>Automated grammar induction: Teiresias </li><ul><li>Regular grammars of the form </li><ul><li>R: V i -> σ V j where σ  Σ (type A, aa) or σ = {Σ} (type B, wildcard)
  22. 25. Find all G for which a/b > w, and a+b>L
  23. 26. Subject to maximal |R| and maximal occurrences of G </li></ul></ul></ul>G = ( V , Σ, R, S ) where seq1: QSEAGWLKKLGK seq2: QSEAGWLRKAAK seq3: QTEAGGLKKFGK What grammar describes these sequences? V = non-terminal symbols Σ = amino acids R = set of replacement rules S = starting amino acid cecropin motif: Q.EAG.L.K..K
  24. 27. Our goal was to use this linguistic model to design novel AmPs <ul><li>Protein design space is combinatorially large </li><ul><li>20 N possible N amino acid sequences </li><ul><li>N = 18, number of stars in universe
  25. 28. N = 50, number of atoms in Earth
  26. 29. N = 100, number of electrons in universe </li></ul></ul><li>Why design novel AmPs? </li><ul><li>Concern over RamPs </li><ul><li>Cross-resistance </li></ul></ul><li>Other approaches </li><ul><li>Folding & thermodynamics
  27. 30. Combinatorial libraries </li></ul></ul>sequence space grammatical space natural AmPs “ true” AmPs
  28. 31. We used Teiresias to discover ~700 grammars defining the “language of AmPs” query: - grammar 1 grammar 2 - <ul><ul><li>These grammars were used to design novel AmPs </li><ul><li>No more than 5-in-a-row with natural AmPs
  29. 32. 12 million “grammatical” sequences </li></ul></ul></ul>
  30. 33. 40 novel AmPs were chosen for experimental validation <ul><li>Tested against B. subtilis & E. coli </li></ul>serial dilutions replicates 9 non-AmPs 9 natural AmPs Control 42 shuffled 42 motif-based Test N Y Expect Activity?
  31. 34. Our results show significant enrichment for activity in the designed set Expected Activity? Y N Test 42 motif-based 18 / 42 42 shuffled 2 / 42 Control 9 natural AmPs 6 / 9 9 non-AmPs 0 / 9
  32. 35. Optimized leads showed strong activity against anthrax and staph
  33. 37. Part 2: A generic motif discovery algorithm for diverse biomolecular data
  34. 38. Motif discovery is the automated search for similar regions in streams of data <ul><li>Un-sequential data </li><ul><li>No “ordering” </li></ul><li>Sequential data </li><ul><li>A natural ordering of the data </li><ul><li>Nucleotide and amino acid sequences
  36. 40. There are two classes of motif discovery tools commonly used for sequence analysis <ul><li>“Exhaustive” regular-expression based tools </li><ul><li>Teiresias
  37. 41. Pratt </li></ul><li>“Descriptive” position weight matrix-based tools </li><ul><li>Gibbs sampler
  38. 42. MEME
  41. 45. Gemoda proceeds in three steps: comparison, clustering, and convolution
  42. 46. The comparison stage is used to map the pairwise similarities between all windows in the data streams <ul><li>Creates an distance matrix </li><ul><li>Does an all-by-all comparison of windows in the data
  43. 47. Comparison function is context-specific </li></ul></ul>F(w 1 , w 2 )
  44. 48. The clustering phase is used to find groups of mutually similar windows <ul><li>Different clustering functions have different uses </li><ul><li>Clique-finding is provably exhaustive
  45. 49. K-means and other methods are faster </li></ul><li>Output clusters become “elementary motifs” which are convolved to make longer, maximal motifs </li></ul>
  46. 50. The convolution phase is used to “stitch” together the clusters into maximal motifs <ul><li>The motifs should be as long as possible, without decreasing the support </li></ul>elementary motifs (clusters) window ordering
  47. 51. Here we show a few representative ways in which Gemoda can be used Motif discovery in... <ul><li>Protein sequences </li><ul><li>(ppGpp)ase enzymes & finding known domains </li></ul><li>DNA sequences </li><ul><li>The LD-motif challenge problem </li></ul><li>Protein structures </li><ul><li>Conserved structures without conserved sequences </li></ul></ul>
  48. 52. Gemoda can be applied to amino acid sequences as well <ul><li>Example: (ppGpp)ase family from ENZYME database </li><ul><li>Guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase enzymes </li><ul><li>EC
  49. 53. Ave. length ~700 amino acids
  50. 54. 8 sequences from 8 species </li></ul><li>Searched using Gemoda </li><ul><li>Minimum length = 50 amino acids
  51. 55. Minimum Blosum62 bit score = 50 bits
  52. 56. Minimum support = 100% (8/8 sequences)
  53. 57. Clustering method = clique finding </li></ul></ul></ul>Can Gemoda find this known motif? How sensitive is Gemoda to “noise?”
  54. 58. (ppGpp)ase example: the comparison phase shows many regions of local similarity Dots indicate 50aa windows that are pairwise similar Streaks indicate regions that will probably be convolved into a maximal motif
  55. 59. (ppGpp)ase example: the clustering phase shows elementary motifs conserved between all 8 enzyme sequences
  56. 60. (ppGpp)ase example: the final motifs match the known rela_spot domain and the HD domain from NCBI's conserved domain database Maximal motif (one of three, ~100 aa in length) This particular cluster represents the first set of 8 50aa windows in the above motif. Results are insensitive to “noise”
  62. 66. Gemoda can also be applied to protein structures <ul><li>Treat protein structure as alpha-carbon trace </li><ul><li>Series of x,y,z coordinates </li></ul></ul><ul><li>Use a clustering function that compares x,y,z windows </li><ul><li>Root mean square deviation (RMSD)
  63. 67. unit-RMSD </li></ul></ul>x 1 y 1 z 1 x 2 y 2 z 2 x 3 y 3 z 3 ........................... x M y M z M
  64. 68. Protein structure example: human FIT vs. uridylyltransferase
  65. 69. fin
