• Save
17 - From Gene to Protein
Upcoming SlideShare
Loading in...5
×
 

17 - From Gene to Protein

on

  • 1,929 views

 

Statistics

Views

Total Views
1,929
Views on SlideShare
1,922
Embed Views
7

Actions

Likes
7
Downloads
0
Comments
2

2 Embeds 7

http://www.pinterest.com 6
http://pinterest.com 1

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
  • yes please make this saveable
    Are you sure you want to
    Your message goes here
    Processing…
  • Please make this saveable!! i need it for a class to take notes!
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment
  • Figure 17.3 Overview: the roles of transcription and translation in the flow of genetic information.
  • Figure 17.4 The triplet code.
  • Figure 17.5 The codon table for mRNA.
  • Figure 17.6 Expression of genes from different species.
  • Figure 17.7 The stages of transcription: initiation, elongation, and termination.
  • Figure 17.8 The initiation of transcription at a eukaryotic promoter.
  • Figure 17.9 Transcription elongation.
  • Figure 17.10 RNA processing: Addition of the 5  cap and poly-A tail.
  • Figure 17.11 RNA processing: RNA splicing.
  • Figure 17.12 The roles of snRNPs and spliceosomes in pre-mRNA splicing.
  • Figure 17.13 Correspondence between exons and protein domains.
  • Figure 17.14 Translation: the basic concept.
  • For the Cell Biology Video A Stick and Ribbon Rendering of a tRNA, go to Animation and Video Files.
  • Figure 17.15 The structure of transfer RNA (tRNA).
  • Figure 17.16 An aminoacyl-tRNA synthetase joining a specific amino acid to a tRNA.
  • Figure 17.17 The anatomy of a functioning ribosome.
  • Figure 17.18 The initiation of translation.
  • Figure 17.19 The elongation cycle of translation.
  • Figure 17.20 The termination of translation.
  • Figure 17.21 Polyribosomes.
  • Figure 17.22 The signal mechanism for targeting proteins to the ER.
  • Figure 17.23 The molecular basis of sickle-cell disease: a point mutation.
  • Figure 17.24 Types of small-scale mutations that affect mRNA sequence.
  • Figure 17.26 A summary of transcription and translation in a eukaryotic cell.

17 - From Gene to Protein 17 - From Gene to Protein Presentation Transcript

  • LECTURE PRESENTATIONSFor CAMPBELL BIOLOGY, NINTH EDITIONJane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson© 2011 Pearson Education, Inc.Lectures byErin BarleyKathleen FitzpatrickFrom Gene to ProteinChapter 17
  • Overview: The Flow of Genetic Information• The information content of DNA is in the form ofspecific sequences of nucleotides• The DNA inherited by an organism leads tospecific traits by dictating the synthesis of proteins• Proteins are the links between genotype andphenotype• Gene expression, the process by which DNAdirects protein synthesis, includes two stages:transcription and translation© 2011 Pearson Education, Inc.
  • Basic Principles of Transcription andTranslation• RNA is the bridge between genes and theproteins for which they code• Transcription is the synthesis of RNA underthe direction of DNA• Transcription produces messenger RNA(mRNA)• Translation is the synthesis of a polypeptide,using information in the mRNA• Ribosomes are the sites of translation© 2011 Pearson Education, Inc.
  • • In prokaryotes, translation of mRNA can beginbefore transcription has finished• In a eukaryotic cell, the nuclear envelopeseparates transcription from translation• Eukaryotic RNA transcripts are modified throughRNA processing to yield finished mRNA• A primary transcript is the initial RNA transcriptfrom any gene prior to processing© 2011 Pearson Education, Inc.
  • Figure 17.3DNAmRNARibosomePolypeptideTRANSCRIPTIONTRANSLATIONTRANSCRIPTIONTRANSLATIONPolypeptideRibosomeDNAmRNAPre-mRNARNA PROCESSING(a) Bacterial cell (b) Eukaryotic cellNuclearenvelope
  • The Genetic Code• How are the instructions for assembling aminoacids into proteins encoded into DNA?• There are 20 amino acids, but there are only fournucleotide bases in DNA• How many nucleotides correspond to an aminoacid?© 2011 Pearson Education, Inc.
  • Codons: Triplets of Nucleotides• The flow of information from gene to protein isbased on a triplet code: a series ofnonoverlapping, three-nucleotide words• The words of a gene are transcribed intocomplementary nonoverlaping three-nucleotidewords of mRNA• These words are then translated into a chain ofamino acids, forming a polypeptide© 2011 Pearson Education, Inc.
  • Figure 17.4DNAtemplatestrandTRANSCRIPTIONmRNATRANSLATIONProteinAmino acidCodonTrp Phe Gly5′5′SerU U U U U3′3′5′3′GGG G C CTCAAAAAAAT T T TTGG G GC C C G GDNAmoleculeGene 1Gene 2Gene 3C C
  • • During transcription, one of the two DNA strands,called the template strand, provides a templatefor ordering the sequence of complementarynucleotides in an RNA transcript• The template strand is always the same strand fora given gene• During translation, the mRNA base triplets, calledcodons, are read in the 5′ to 3′ direction• Each codon specifies the amino acid (one of 20)to be placed at the corresponding position along apolypeptide© 2011 Pearson Education, Inc.
  • Cracking the Code• All 64 codons were deciphered by the mid-1960s• Of the 64 triplets, 61 code for amino acids; 3triplets are “stop” signals to end translation• The genetic code is redundant (more than onecodon may specify a particular amino acid) butnot ambiguous; no codon specifies more thanone amino acid• Codons must be read in the correct readingframe (correct groupings) in order for thespecified polypeptide to be produced© 2011 Pearson Education, Inc.
  • Figure 17.5Second mRNA baseFirstmRNAbase(5′endofcodon)ThirdmRNAbase(3′endofcodon)UUUUUCUUACUUCUCCUACUGPheLeuLeuIleUCUUCCUCAUCGSerCCUCCCCCACCGUAUUACTyrProThrUAA StopUAG StopUGA StopUGUUGCCysUGG TrpGCUUCAUUCCCAUAAAGGHisGlnAsnLysAspCAU CGUCACCAACAGCGCCGACGGGAUUAUCAUAACUACCACAAAUAACAAAAGUAGCAGAArgSerArgGlyACGAUG AAG AGGGUUGUCGUAGUGGCUGCCGCAGCGGAUGACGAAGAGVal AlaGGUGGCGGAGGGGluGlyGUCAMet orstartUUGG
  • Evolution of the Genetic Code• The genetic code is nearly universal, shared bythe simplest bacteria to the most complex animals• Genes can be transcribed and translated afterbeing transplanted from one species to another© 2011 Pearson Education, Inc.
  • Figure 17.6(a) Tobacco plant expressinga firefly gene gene(b) Pig expressing a jellyfish
  • 13-15
  • Molecular Components of Transcription• RNA synthesis is catalyzed by RNA polymerase,which pries the DNA strands apart and hookstogether the RNA nucleotides• The RNA is complementary to the DNA templatestrand• RNA synthesis follows the same base-pairingrules as DNA, except that uracil substitutes forthymine© 2011 Pearson Education, Inc.
  • • The DNA sequence where RNA polymeraseattaches is called the promoter; in bacteria, thesequence signaling the end of transcription iscalled the terminator• The stretch of DNA that is transcribed is called atranscription unit© 2011 Pearson Education, Inc.
  • Figure 17.7-4 PromoterRNA polymeraseStart pointDNA5′3′Transcription unit3′5′Elongation5′3′3′5′Nontemplate strand of DNATemplate strand of DNARNAtranscriptUnwoundDNA23′5′3′5′3′RewoundDNARNAtranscript5′Termination33′5′5′Completed RNA transcriptDirection of transcription (“downstream”)5′3′3′Initiation1
  • Synthesis of an RNA Transcript• The three stages of transcription– Initiation– Elongation– Termination© 2011 Pearson Education, Inc.
  • RNA Polymerase Binding and Initiation ofTranscription• Promoters signal the transcriptional start pointand usually extend several dozen nucleotide pairsupstream of the start point• Transcription factors mediate the binding ofRNA polymerase and the initiation of transcription• The completed assembly of transcription factorsand RNA polymerase II bound to a promoter iscalled a transcription initiation complex• A promoter called a TATA box is crucial informing the initiation complex in eukaryotes© 2011 Pearson Education, Inc.
  • Figure 17.8Transcription initiationcomplex forms3DNAPromoterNontemplate strand5′3′5′3′5′3′TranscriptionfactorsRNA polymerase IITranscription factors5′3′5′3′5′3′RNA transcriptTranscription initiation complex5′3′TATA boxTT T T T TA AA AAA ATSeveral transcriptionfactors bind to DNA2A eukaryotic promoter1Start point Template strand
  • Elongation of the RNA Strand• As RNA polymerase moves along the DNA, ituntwists the double helix, 10 to 20 bases at atime• Transcription progresses at a rate of 40nucleotides per second in eukaryotes• A gene can be transcribed simultaneously byseveral RNA polymerases• Nucleotides are added to the 3′ end of thegrowing RNA molecule© 2011 Pearson Education, Inc.
  • Nontemplatestrand of DNARNA nucleotidesRNApolymeraseTemplatestrand of DNA3′3′5′5′5′3′Newly madeRNADirection of transcriptionAA A AAAATTTTTTT GGGCC CCCGC CC A AAUUUendFigure 17.9
  • Termination of Transcription• The mechanisms of termination are different inbacteria and eukaryotes• In bacteria, the polymerase stops transcription atthe end of the terminator and the mRNA can betranslated without further modification• In eukaryotes, RNA polymerase II transcribes thepolyadenylation signal sequence that codes for apolyadenylation signal (AAUAAA); the RNAtranscript is cut free by proteins about 10–35nucleotides past this polyadenylation signal© 2011 Pearson Education, Inc.
  • Eukaryotic cells modify RNA aftertranscription• Enzymes in the eukaryotic nucleus modify pre-mRNA (RNA processing) before the geneticmessages are dispatched to the cytoplasm• During RNA processing, both ends of the primarytranscript are usually altered• Also, usually some interior parts of the moleculeare cut out, and the other parts spliced together© 2011 Pearson Education, Inc.
  • Alteration of mRNA Ends• Each end of a pre-mRNA molecule is modifiedin a particular way– The 5′ end receives a modified nucleotide 5′cap– The 3′ end gets a poly-A tail• These modifications share several functions– They seem to facilitate the export of mRNA– They protect mRNA from hydrolytic enzymes– They help ribosomes attach to the 5′ end© 2011 Pearson Education, Inc.
  • Figure 17.10Protein-codingsegmentPolyadenylationsignal5′ 3′3′5′ 5′Cap UTRStartcodonG P P PStopcodonUTRAAUAAAPoly-A tailAAA AAA…
  • Split Genes and RNA Splicing• Most eukaryotic genes and their RNA transcriptshave long noncoding stretches of nucleotides thatlie between coding regions• These noncoding regions are called interveningsequences, or introns• The other regions are called exons because theyare eventually expressed, usually translated intoamino acid sequences• RNA splicing removes introns and joins exons,creating an mRNA molecule with a continuouscoding sequence© 2011 Pearson Education, Inc.
  • Figure 17.115′ Exon Intron Exon5′ CapPre-mRNACodonnumbers1−30 31−104mRNA 5′Cap5′Intron Exon3′ UTRIntrons cut out andexons spliced together3′105−146Poly-A tailCodingsegmentPoly-A tailUTR1−146
  • • In some cases, RNA splicing is carried out byspliceosomes• Spliceosomes consist of a variety of proteinsand several small nuclear ribonucleoproteins(snRNPs) that recognize the splice sites© 2011 Pearson Education, Inc.
  • Figure 17.12-3RNA transcript (pre-mRNA)5′Exon 1ProteinsnRNAsnRNPsIntron Exon 2OtherproteinsSpliceosome5′SpliceosomecomponentsCut-outintronmRNA5′Exon 1 Exon 2
  • Ribozymes• Ribozymes are catalytic RNA molecules thatfunction as enzymes and can splice RNA• The discovery of ribozymes rendered obsoletethe belief that all biological catalysts wereproteins© 2011 Pearson Education, Inc.
  • • Three properties of RNA enable it to function asan enzyme– It can form a three-dimensional structure becauseof its ability to base-pair with itself– Some bases in RNA contain functional groupsthat may participate in catalysis– RNA may hydrogen-bond with other nucleic acidmolecules© 2011 Pearson Education, Inc.
  • The Functional and Evolutionary Importanceof Introns• Some introns contain sequences that mayregulate gene expression• Some genes can encode more than one kind ofpolypeptide, depending on which segments aretreated as exons during splicing• This is called alternative RNA splicing• Consequently, the number of different proteins anorganism can produce is much greater than itsnumber of genes© 2011 Pearson Education, Inc.
  • • Proteins often have a modular architectureconsisting of discrete regions called domains• In many cases, different exons code for thedifferent domains in a protein• Exon shuffling may result in the evolution of newproteins© 2011 Pearson Education, Inc.
  • GeneDNAExon 1 Exon 2 Exon 3Intron IntronTranscriptionRNA processingTranslationDomain 3Domain 2Domain 1PolypeptideFigure 17.13
  • Concept 17.4: Translation is the RNA-directed synthesis of a polypeptide: acloser look• Genetic information flows from mRNA to proteinthrough the process of translation© 2011 Pearson Education, Inc.
  • Molecular Components of Translation• A cell translates an mRNA message into proteinwith the help of transfer RNA (tRNA)• tRNAs transfer amino acids to the growingpolypeptide in a ribosome• Translation is a complex process in terms of itsbiochemistry and mechanics© 2011 Pearson Education, Inc.
  • Figure 17.14PolypeptideRibosomeTrpPhe GlytRNA withamino acidattachedAminoacidstRNAAnticodonCodonsU U U UG G G G CACCCCGA A ACGCG5′ 3′mRNA
  • The Structure and Function of Transfer RNA• Molecules of tRNA are not identical– Each carries a specific amino acid on one end– Each has an anticodon on the other end; theanticodon base-pairs with a complementarycodon on mRNA© 2011 Pearson Education, Inc.
  • • A tRNA molecule consists of a single RNAstrand that is only about 80 nucleotides long• Flattened into one plane to reveal its basepairing, a tRNA molecule looks like a cloverleaf• Because of hydrogen bonds, tRNA actuallytwists and folds into a three-dimensionalmolecule• tRNA is roughly L-shaped© 2011 Pearson Education, Inc.
  • Figure 17.15Amino acidattachmentsite3′5′HydrogenbondsAnticodon(a) Two-dimensional structure (b) Three-dimensional structure(c) Symbol usedin this bookAnticodon Anticodon3′ 5′HydrogenbondsAmino acidattachmentsite5′3′A A G
  • • Accurate translation requires two steps– First: a correct match between a tRNA and anamino acid, done by the enzyme aminoacyl-tRNAsynthetase– Second: a correct match between the tRNAanticodon and an mRNA codon• Flexible pairing at the third base of a codon iscalled wobble and allows some tRNAs to bind tomore than one codon© 2011 Pearson Education, Inc.
  • Aminoacyl-tRNAsynthetase (enzyme)Amino acidP P P AdenosineATPPPPPPiiiAdenosinetRNAAdenosinePtRNAAMPComputer modelAminoacidAminoacyl-tRNAsynthetaseAminoacyl tRNA(“charged tRNA”)Figure 17.16-4
  • Ribosomes• Ribosomes facilitate specific coupling of tRNAanticodons with mRNA codons in protein synthesis• The two ribosomal subunits (large and small) aremade of proteins and ribosomal RNA (rRNA)• Bacterial and eukaryotic ribosomes are somewhatsimilar but have significant differences: someantibiotic drugs specifically target bacterialribosomes without harming eukaryotic ribosomes© 2011 Pearson Education, Inc.
  • tRNAmoleculesGrowingpolypeptide Exit tunnelE PALargesubunitSmallsubunitmRNA5′3′(a) Computer model of functioning ribosomeExit tunnel Amino endA site (Aminoacyl-tRNA binding site)SmallsubunitLargesubunitE P AmRNAEP site (Peptidyl-tRNAbinding site)mRNAbinding site(b) Schematic model showing binding sitesE site(Exit site)(c) Schematic model with mRNA and tRNA5′ Codons3′tRNAGrowing polypeptideNext aminoacid to beadded topolypeptidechainFigure 17.17
  • • A ribosome has three binding sites for tRNA– The P site holds the tRNA that carries thegrowing polypeptide chain– The A site holds the tRNA that carries the nextamino acid to be added to the chain– The E site is the exit site, where dischargedtRNAs leave the ribosome© 2011 Pearson Education, Inc.
  • Building a Polypeptide• The three stages of translation– Initiation– Elongation– Termination• All three stages require protein “factors” that aid inthe translation process© 2011 Pearson Education, Inc.
  • Ribosome Association and Initiation ofTranslation• The initiation stage of translation brings togethermRNA, a tRNA with the first amino acid, and thetwo ribosomal subunits• First, a small ribosomal subunit binds with mRNAand a special initiator tRNA• Then the small subunit moves along the mRNAuntil it reaches the start codon (AUG)• Proteins called initiation factors bring in the largesubunit that completes the translation initiationcomplex© 2011 Pearson Education, Inc.
  • Figure 17.18InitiatortRNAmRNA5′5′3′Start codonSmallribosomalsubunitmRNA binding site3′Translation initiation complex5′ 3′3′ UUAA GCPP sitei+GTP GDPMet MetLargeribosomalsubunitE A5′
  • Elongation of the Polypeptide Chain• During the elongation stage, amino acids areadded one by one to the preceding amino acid atthe C-terminus of the growing chain• Each addition involves proteins called elongationfactors and occurs in three steps: codonrecognition, peptide bond formation, andtranslocation• Translation proceeds along the mRNA in a 5′ to 3′direction© 2011 Pearson Education, Inc.
  • Amino end ofpolypeptidemRNA5′EAsite3′EGTPGDP + P iP AEP AGTPGDP + P iP AERibosome ready fornext aminoacyl tRNAPsiteFigure 17.19-4
  • Termination of Translation• Termination occurs when a stop codon in themRNA reaches the A site of the ribosome• The A site accepts a protein called a releasefactor• The release factor causes the addition of awater molecule instead of an amino acid• This reaction releases the polypeptide, and thetranslation assembly then comes apart© 2011 Pearson Education, Inc.
  • Figure 17.20-3ReleasefactorStop codon(UAG, UAA, or UGA)3′5′3′5′Freepolypeptide2 GTP5′3′2 GDP + 2 iPWhen a ribosome reaches a stopcodon on mRNA, the A site of theribosome accepts a protein calleda release factor instead of tRNA.The release factor hydrolyzes thebond between the tRNA in theP site and the last amino acid of thepolypeptide chain. The polypeptideis thus freed from the ribosome.The two ribosomal subunitsand the other componentsof the assembly dissociate.
  • Polyribosomes• A number of ribosomes can translate a singlemRNA simultaneously, forming a polyribosome(or polysome)• Polyribosomes enable a cell to make many copiesof a polypeptide very quickly© 2011 Pearson Education, Inc.
  • Figure 17.21CompletedpolypeptideIncomingribosomalsubunitsStart ofmRNA(5′ end)End ofmRNA(3′ end)(a)PolyribosomeRibosomesmRNA(b)0.1 µmGrowingpolypeptides
  • Completing and Targeting the FunctionalProtein• Often translation is not sufficient to make afunctional protein• Polypeptide chains are modified after translationor targeted to specific sites in the cell© 2011 Pearson Education, Inc.
  • Protein Folding and Post-TranslationalModifications• During and after synthesis, a polypeptide chainspontaneously coils and folds into its three-dimensional shape• Proteins may also require post-translationalmodifications before doing their job• Some polypeptides are activated by enzymesthat cleave them• Other polypeptides come together to form thesubunits of a protein© 2011 Pearson Education, Inc.
  • Targeting Polypeptides to Specific Locations• Two populations of ribosomes are evident in cells:free ribsomes (in the cytosol) and boundribosomes (attached to the ER)• Free ribosomes mostly synthesize proteins thatfunction in the cytosol• Bound ribosomes make proteins of theendomembrane system and proteins that aresecreted from the cell• Ribosomes are identical and can switch from freeto bound© 2011 Pearson Education, Inc.
  • • Polypeptide synthesis always begins in thecytosol• Synthesis finishes in the cytosol unless thepolypeptide signals the ribosome to attach tothe ER• Polypeptides destined for the ER or forsecretion are marked by a signal peptide• A signal-recognition particle (SRP) binds tothe signal peptide• The SRP brings the signal peptide and itsribosome to the ER© 2011 Pearson Education, Inc.
  • Figure 17.22RibosomemRNASignalpeptideSRP1SRPreceptorproteinTranslocationcomplexERLUMEN23456SignalpeptideremovedCYTOSOLProteinERmembrane
  • Mutations of one or a few nucleotides canaffect protein structure and function• Mutations are changes in the genetic materialof a cell or virus• Point mutations are chemical changes in justone base pair of a gene• The change of a single nucleotide in a DNAtemplate strand can lead to the production of anabnormal protein© 2011 Pearson Education, Inc.
  • Figure 17.23Wild-type hemoglobinWild-type hemoglobin DNA3′3′3′5′5′ 3′3′5′5′5′5′3′mRNAA AGC T TA AGmRNANormal hemoglobinGluSickle-cell hemoglobinValAAAUGGTTSickle-cell hemoglobinMutant hemoglobin DNAC
  • Types of Small-Scale Mutations• Point mutations within a gene can be divided intotwo general categories– Nucleotide-pair substitutions– One or more nucleotide-pair insertions ordeletions© 2011 Pearson Education, Inc.
  • Substitutions• A nucleotide-pair substitution replaces onenucleotide and its partner with another pair ofnucleotides• Silent mutations have no effect on the aminoacid produced by a codon because ofredundancy in the genetic code• Missense mutations still code for an aminoacid, but not the correct amino acid• Nonsense mutations change an amino acidcodon into a stop codon, nearly always leadingto a nonfunctional protein© 2011 Pearson Education, Inc.
  • Insertions and Deletions• Insertions and deletions are additions or lossesof nucleotide pairs in a gene• These mutations have a disastrous effect on theresulting protein more often than substitutions do• Insertion or deletion of nucleotides may alter thereading frame, producing a frameshift mutation© 2011 Pearson Education, Inc.
  • Wild typeDNA template strandmRNA5′5′3′ProteinAmino endA instead of G(a) Nucleotide-pair substitution3′3′5′Met Lys Phe Gly StopCarboxyl endT T T T TTTTTTA A A A AAAAACCCCAA A A A AG G G GGC CG GGU U U U UG(b) Nucleotide-pair insertion or deletionExtra A3′5′5′3′Extra U5′ 3′T T T TT T T TAA A AAAT G G G GGAAAACCCCC AT3′5′5′ 3′5′T T T T TAAAACCA AC CTTTTTA A A A ATG G G GU instead of CStopUA A A A AG GGU U U U UGMetLys Phe GlySilent (no effect on amino acid sequence)T instead of CT T T T TAAAACCA GT CT A T T TAAAACCA GC CA instead of GCA A A A AG AGU U U U UG UA A A AG GGU U U G ACAA U U A AU UGU G G C UAGA U A U AA UGU G U U CGMet Lys Phe SerStopStop Met LysmissingmissingFrameshift causing immediate nonsense(1 nucleotide-pair insertion)Frameshift causing extensive missense(1 nucleotide-pair deletion)missingT T T T TTCAACCA AC GAGTTTA A A A ATG G G CLeu AlaMissenseA instead of TTTTTTA A A A ACG G A GACA U A A AG GGU U U U UGTTTTTA T A A ACG G G GMetNonsenseStopU instead of A3′5′3′5′5′3′3′5′5′3′3′5′ 3′Met Phe GlyNo frameshift, but one amino acid missing(3 nucleotide-pair deletion)missing3′5′5′3′5′ 3′UT CA AA CA TTAC GTA G T T T G G A ATCT T CA A GMet3′TAStop3′5′5′3′5′ 3′Figure 17.24
  • Mutagens• Spontaneous mutations can occur during DNAreplication, recombination, or repair• Mutagens are physical or chemical agents thatcan cause mutations© 2011 Pearson Education, Inc.
  • What Is a Gene? Revisiting the Question• The idea of the gene has evolved through thehistory of genetics• We have considered a gene as– A discrete unit of inheritance– A region of specific nucleotide sequence in achromosome– A DNA sequence that codes for a specificpolypeptide chain© 2011 Pearson Education, Inc.
  • Figure 17.26TRANSCRIPTIONDNARNApolymeraseExonRNAtranscriptRNAPROCESSINGNUCLEUSIntronRNA transcript(pre-mRNA)Poly-APoly-AAminoacyl-tRNA synthetaseAMINO ACIDACTIVATIONAminoacidtRNA5′CapPoly-A3′GrowingpolypeptidemRNAAminoacyl(charged)tRNAAnticodonRibosomalsubunitsAAETRANSLATION5′ CapCYTOPLASMPECodonRibosome5′3′
  • • In summary, a gene can be defined as a region ofDNA that can be expressed to produce a finalfunctional product, either a polypeptide or anRNA molecule© 2011 Pearson Education, Inc.© 2011 Pearson Education, Inc.