Identification of a possible tumor suppressor microRNA in leukemia Kara A. Scheibner, PhD Center for Stem Cell Biology and...
Lab Objectives <ul><li>Identify the roles of microRNAs (miRNAs) in normal stages of hematopoietic differentiation </li></u...
microRNAs <ul><li>Endogenous, non-coding small RNAs that alter expression of their target genes </li></ul><ul><li>~22 nucl...
MicroRNA regulation (and deregulation) of hematopoiesis miR-17-92 cluster: expression decreases during monocyte developmen...
<ul><li>Measured 228 human microRNAs in CD34 +  HSPCs using Calin/Croce microarray chips </li></ul><ul><li>Intersection an...
<ul><li>Cluster members have a known role in hematopoiesis </li></ul><ul><li>miR-23a/b and miR-24 have reported tumor supp...
Low expression levels of miR-27a in leukemia cells compared to HSPCs…….a hint? miRNA microarray data qRT-PCR data Does the...
miR-27a as a tumor suppressor miRNA Decreased cell growth Increased death by apoptosis Increased cell death Altered cell c...
Target genes <ul><li>Plugging miR-27a into a target prediction database like Targetscan 5.0 yields what seem like infinite...
miR-27a binds in vitro to its predicted site in the 3’UTR of YWHAQ <ul><li>Interacts with multiple pro-apoptotic proteins,...
Other miR-27a predicted targets Wnt/ β -catenin pathway Wnt3a 3’UTR Wnt3a Frizzled 4/7 Dishevelled 2 LRP6
How could this in vitro data be relevant in a clinical setting? <ul><li>Does this data hold up in an in vivo model? </li><...
Need for clinical and non-clinical samples <ul><li>Comprehensive screen of leukemia cell lines </li></ul><ul><li>Primary s...
Upcoming SlideShare
Loading in...5
×

Scheibner

846

Published on

University of Maryland Baltimore
Experimental Therapeutics Symposium 2009

Published in: Education, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
846
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
0
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Transcript of "Scheibner"

  1. 1. Identification of a possible tumor suppressor microRNA in leukemia Kara A. Scheibner, PhD Center for Stem Cell Biology and Regenerative Medicine October 2, 2009 Experimental Therapeutics Retreat
  2. 2. Lab Objectives <ul><li>Identify the roles of microRNAs (miRNAs) in normal stages of hematopoietic differentiation </li></ul><ul><li>Examine the dysregulation of hematopoietic miRNAs and their involvement in leukemia </li></ul><ul><ul><li>oncomiRs (those miRNAs overexpressed in leukemia) </li></ul></ul><ul><ul><li>Tumor suppressor miRNAs (those miRNAs down-regulated or absent in leukemia) </li></ul></ul><ul><ul><li>Are these miRNAs specific to leukemia, or do they have a broader scope in cancer? </li></ul></ul><ul><li>Identify miRNAs or their targets as potential cancer therapeutics </li></ul><ul><ul><li>Can we deliver a miRNA as a drug? </li></ul></ul><ul><ul><li>Can we inhibit a specific miRNA in a therapeutic manner? </li></ul></ul><ul><ul><li>Can we develop small molecule drugs against a miRNA target gene? </li></ul></ul>
  3. 3. microRNAs <ul><li>Endogenous, non-coding small RNAs that alter expression of their target genes </li></ul><ul><li>~22 nucleotides in length </li></ul><ul><li>Highly conserved between species </li></ul><ul><li>>1,000 have been discovered so far in humans, possibly regulating >30% of all genes </li></ul><ul><ul><li>One miR can regulate multiple mRNAs </li></ul></ul><ul><ul><li>Multiple miRs can regulate one mRNA </li></ul></ul>
  4. 4. MicroRNA regulation (and deregulation) of hematopoiesis miR-17-92 cluster: expression decreases during monocyte development; highly expressed in pre B and T precursor cells and decreases after maturation miR-146: drives naïve T cells to become T1 helper cells over Th2 cells miR-223: expressed specifically in the granulocyte lineage; decreases as cells move from MEPs to erythrocytes miR-221/222: downregulated during erythropoiesis (Modified from Baltimore et al, 2008)
  5. 5. <ul><li>Measured 228 human microRNAs in CD34 + HSPCs using Calin/Croce microarray chips </li></ul><ul><li>Intersection analysis found 32 microRNAs expressed in CD34 + HSPCs from both BM and PBSC harvests </li></ul><ul><li>Compared the expression pattern of miRNAs in CD34+ cells to that of several leukemia cell lines </li></ul>MicroRNAs expressed in HSPCs Georgantas et al 2007 74 miRs expressed in CD34 + BM 35 miRs expressed in CD34 + mobilized blood 32 3 42
  6. 6. <ul><li>Cluster members have a known role in hematopoiesis </li></ul><ul><li>miR-23a/b and miR-24 have reported tumor suppressor roles, and are down regulated in cancers </li></ul>miR-27a, its cluster members, and paraglogs miR-23b miR-27b miR-24-1 C9orf3 FANCC TSS (-31Kb) Human chromosome 9q22.32 (9:96,742,096-97,033,095) (290999 bp) UUCACAGUGGCUAAGUUC U GC AUCACAUUGCCAGGGAUU A CC UGGCUCAGUUCAGCAGGAAACAG miR-23a miR-27a miR-24-2 ZSWIM4 NANOS3 C19orf57 Human chromosome 19p13.2 (19:13,769,268-13,875,567) (106,299 bp) TSS (-400-600bp) UUCACAGUGGCUAAGUUCCGC AUCACAUUGCCAGGGAUUUCC UGGCUCAGUUCAGCAGGAAACAG miR-181C miR-181D
  7. 7. Low expression levels of miR-27a in leukemia cells compared to HSPCs…….a hint? miRNA microarray data qRT-PCR data Does the fact that miR-27a expression is low or absent in multiple leukemia cell lines and patient samples mean anything in the etiology of the disease? 0 0.2 0.4 0.6 0.8 1 1.2 1.4 RQ value (normalized to CD34+ cells) CD34+ K562 TF-1 KOPN8 HEK293T ALL #1 ALL #2 miR-23a miR-23b miR-27a miR-27b 34,913 TF1 47,337 REH 38,099 K562 113,257 CD34+ (HSPCs) miR-27a expression Cell type
  8. 8. miR-27a as a tumor suppressor miRNA Decreased cell growth Increased death by apoptosis Increased cell death Altered cell cycle profile 0 50000 100000 150000 200000 250000 300000 350000 400000 450000 0 1 2 3 4 5 6 7 Days Cell number K562 FUGW miR-27 #1 miR-27 #5 miR-27 #6 miR-27 #11 0 5 10 15 20 25 30 35 40 Control #9 miR-27a #3 % total cell death Experiment 1 Experiment 2 0 5 10 15 20 25 30 35 % annexinV+/7AAD- GFP- Control #10 miR-27a #3 mirR-27a #4 miR-27a #7 0 10 20 30 40 50 60 70 80 G1 S G2 % cells GFP- miR-27a #1 miR-27a #2 miR-27a #3 miR-27a #4 miR-27a #5 miR-27a #6
  9. 9. Target genes <ul><li>Plugging miR-27a into a target prediction database like Targetscan 5.0 yields what seem like infinite possibilities </li></ul><ul><li>Do any of these genes correlate with our functional observations? </li></ul><ul><ul><li>Apoptosis </li></ul></ul><ul><ul><li>Cell cycle/growth </li></ul></ul><ul><ul><li>Drug resistance </li></ul></ul>921 conserved targets, with a total of 1004 conserved sites and 362 poorly conserved sites. Human | miR-27ab
  10. 10. miR-27a binds in vitro to its predicted site in the 3’UTR of YWHAQ <ul><li>Interacts with multiple pro-apoptotic proteins, inhibiting their function </li></ul><ul><ul><li>BAD </li></ul></ul><ul><ul><li>BAX </li></ul></ul><ul><ul><li>ASK1 (apoptosis signal regulating kinase 1); pro-apoptotic component of TNF α -, FAD-, and oxidative stress-induced death pathways </li></ul></ul><ul><ul><li>FOXO1 (sequesters it in the cytoplasm) </li></ul></ul><ul><li>Role in promoting proliferation </li></ul><ul><ul><li>Binds to the C-terminal region of Raf proteins; required for full catalytic activity; stabilization </li></ul></ul>0 2 4 6 8 10 12 14 16 18 20 pcDNA-Luc YWHAQ-27a YWHAQ-27a + miR-27a normalized luciferase counts HEK293T cells <ul><li>No (or little) miR-27a expression </li></ul><ul><li>Little to no inhibition of luciferase expression with the YWHAQ-27a plasmid alone </li></ul><ul><li>YWHAQ-27a plasmid + miR-27a (50 nM) yields a 32% decrease in luciferase expression </li></ul>
  11. 11. Other miR-27a predicted targets Wnt/ β -catenin pathway Wnt3a 3’UTR Wnt3a Frizzled 4/7 Dishevelled 2 LRP6
  12. 12. How could this in vitro data be relevant in a clinical setting? <ul><li>Does this data hold up in an in vivo model? </li></ul><ul><ul><li>Immunodeficient mouse xenograft model of leukemia </li></ul></ul><ul><ul><li>Will miR-27a-transduced primary human leukemia samples still engraft? </li></ul></ul><ul><ul><li>Time to engraftment; number of cells needed for engraftment </li></ul></ul><ul><li>miRNAs as drugs </li></ul><ul><ul><li>Currently, there are no clinically available methods of delivering miRNAs as drugs </li></ul></ul><ul><li>Can we target the targets??? </li></ul><ul><ul><li>Drugs targeting β -catenin pathway are being developed; inhibit transcription of β -catenin; small molecule inhibitors of the pathway that show decreased cell growth and potent induction of apoptosis (Avalon pharmaceuticals, Prolexys, molecule the binds to CBP preventing its interaction with β -catenin) </li></ul></ul><ul><ul><li>YWHAQ – disrupting 14-3-3/ligand association with a peptide-based antagonist induces significant apoptosis </li></ul></ul>
  13. 13. Need for clinical and non-clinical samples <ul><li>Comprehensive screen of leukemia cell lines </li></ul><ul><li>Primary samples of ALL, AML, acute pro-myelocytic leukemia, CML, and CLL </li></ul>

×