• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Scheibner
 

Scheibner

on

  • 1,210 views

University of Maryland Baltimore

University of Maryland Baltimore
Experimental Therapeutics Symposium 2009

Statistics

Views

Total Views
1,210
Views on SlideShare
1,208
Embed Views
2

Actions

Likes
0
Downloads
0
Comments
0

1 Embed 2

http://www.slideshare.net 2

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Scheibner Scheibner Presentation Transcript

    • Identification of a possible tumor suppressor microRNA in leukemia Kara A. Scheibner, PhD Center for Stem Cell Biology and Regenerative Medicine October 2, 2009 Experimental Therapeutics Retreat
    • Lab Objectives
      • Identify the roles of microRNAs (miRNAs) in normal stages of hematopoietic differentiation
      • Examine the dysregulation of hematopoietic miRNAs and their involvement in leukemia
        • oncomiRs (those miRNAs overexpressed in leukemia)
        • Tumor suppressor miRNAs (those miRNAs down-regulated or absent in leukemia)
        • Are these miRNAs specific to leukemia, or do they have a broader scope in cancer?
      • Identify miRNAs or their targets as potential cancer therapeutics
        • Can we deliver a miRNA as a drug?
        • Can we inhibit a specific miRNA in a therapeutic manner?
        • Can we develop small molecule drugs against a miRNA target gene?
    • microRNAs
      • Endogenous, non-coding small RNAs that alter expression of their target genes
      • ~22 nucleotides in length
      • Highly conserved between species
      • >1,000 have been discovered so far in humans, possibly regulating >30% of all genes
        • One miR can regulate multiple mRNAs
        • Multiple miRs can regulate one mRNA
    • MicroRNA regulation (and deregulation) of hematopoiesis miR-17-92 cluster: expression decreases during monocyte development; highly expressed in pre B and T precursor cells and decreases after maturation miR-146: drives naïve T cells to become T1 helper cells over Th2 cells miR-223: expressed specifically in the granulocyte lineage; decreases as cells move from MEPs to erythrocytes miR-221/222: downregulated during erythropoiesis (Modified from Baltimore et al, 2008)
      • Measured 228 human microRNAs in CD34 + HSPCs using Calin/Croce microarray chips
      • Intersection analysis found 32 microRNAs expressed in CD34 + HSPCs from both BM and PBSC harvests
      • Compared the expression pattern of miRNAs in CD34+ cells to that of several leukemia cell lines
      MicroRNAs expressed in HSPCs Georgantas et al 2007 74 miRs expressed in CD34 + BM 35 miRs expressed in CD34 + mobilized blood 32 3 42
      • Cluster members have a known role in hematopoiesis
      • miR-23a/b and miR-24 have reported tumor suppressor roles, and are down regulated in cancers
      miR-27a, its cluster members, and paraglogs miR-23b miR-27b miR-24-1 C9orf3 FANCC TSS (-31Kb) Human chromosome 9q22.32 (9:96,742,096-97,033,095) (290999 bp) UUCACAGUGGCUAAGUUC U GC AUCACAUUGCCAGGGAUU A CC UGGCUCAGUUCAGCAGGAAACAG miR-23a miR-27a miR-24-2 ZSWIM4 NANOS3 C19orf57 Human chromosome 19p13.2 (19:13,769,268-13,875,567) (106,299 bp) TSS (-400-600bp) UUCACAGUGGCUAAGUUCCGC AUCACAUUGCCAGGGAUUUCC UGGCUCAGUUCAGCAGGAAACAG miR-181C miR-181D
    • Low expression levels of miR-27a in leukemia cells compared to HSPCs…….a hint? miRNA microarray data qRT-PCR data Does the fact that miR-27a expression is low or absent in multiple leukemia cell lines and patient samples mean anything in the etiology of the disease? 0 0.2 0.4 0.6 0.8 1 1.2 1.4 RQ value (normalized to CD34+ cells) CD34+ K562 TF-1 KOPN8 HEK293T ALL #1 ALL #2 miR-23a miR-23b miR-27a miR-27b 34,913 TF1 47,337 REH 38,099 K562 113,257 CD34+ (HSPCs) miR-27a expression Cell type
    • miR-27a as a tumor suppressor miRNA Decreased cell growth Increased death by apoptosis Increased cell death Altered cell cycle profile 0 50000 100000 150000 200000 250000 300000 350000 400000 450000 0 1 2 3 4 5 6 7 Days Cell number K562 FUGW miR-27 #1 miR-27 #5 miR-27 #6 miR-27 #11 0 5 10 15 20 25 30 35 40 Control #9 miR-27a #3 % total cell death Experiment 1 Experiment 2 0 5 10 15 20 25 30 35 % annexinV+/7AAD- GFP- Control #10 miR-27a #3 mirR-27a #4 miR-27a #7 0 10 20 30 40 50 60 70 80 G1 S G2 % cells GFP- miR-27a #1 miR-27a #2 miR-27a #3 miR-27a #4 miR-27a #5 miR-27a #6
    • Target genes
      • Plugging miR-27a into a target prediction database like Targetscan 5.0 yields what seem like infinite possibilities
      • Do any of these genes correlate with our functional observations?
        • Apoptosis
        • Cell cycle/growth
        • Drug resistance
      921 conserved targets, with a total of 1004 conserved sites and 362 poorly conserved sites. Human | miR-27ab
    • miR-27a binds in vitro to its predicted site in the 3’UTR of YWHAQ
      • Interacts with multiple pro-apoptotic proteins, inhibiting their function
        • BAD
        • BAX
        • ASK1 (apoptosis signal regulating kinase 1); pro-apoptotic component of TNF α -, FAD-, and oxidative stress-induced death pathways
        • FOXO1 (sequesters it in the cytoplasm)
      • Role in promoting proliferation
        • Binds to the C-terminal region of Raf proteins; required for full catalytic activity; stabilization
      0 2 4 6 8 10 12 14 16 18 20 pcDNA-Luc YWHAQ-27a YWHAQ-27a + miR-27a normalized luciferase counts HEK293T cells
      • No (or little) miR-27a expression
      • Little to no inhibition of luciferase expression with the YWHAQ-27a plasmid alone
      • YWHAQ-27a plasmid + miR-27a (50 nM) yields a 32% decrease in luciferase expression
    • Other miR-27a predicted targets Wnt/ β -catenin pathway Wnt3a 3’UTR Wnt3a Frizzled 4/7 Dishevelled 2 LRP6
    • How could this in vitro data be relevant in a clinical setting?
      • Does this data hold up in an in vivo model?
        • Immunodeficient mouse xenograft model of leukemia
        • Will miR-27a-transduced primary human leukemia samples still engraft?
        • Time to engraftment; number of cells needed for engraftment
      • miRNAs as drugs
        • Currently, there are no clinically available methods of delivering miRNAs as drugs
      • Can we target the targets???
        • Drugs targeting β -catenin pathway are being developed; inhibit transcription of β -catenin; small molecule inhibitors of the pathway that show decreased cell growth and potent induction of apoptosis (Avalon pharmaceuticals, Prolexys, molecule the binds to CBP preventing its interaction with β -catenin)
        • YWHAQ – disrupting 14-3-3/ligand association with a peptide-based antagonist induces significant apoptosis
    • Need for clinical and non-clinical samples
      • Comprehensive screen of leukemia cell lines
      • Primary samples of ALL, AML, acute pro-myelocytic leukemia, CML, and CLL