• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Caat box of rabbit with the tata box of cattle,buffalo camel and rat
 

Caat box of rabbit with the tata box of cattle,buffalo camel and rat

on

  • 431 views

 

Statistics

Views

Total Views
431
Views on SlideShare
431
Embed Views
0

Actions

Likes
0
Downloads
0
Comments
0

0 Embeds 0

No embeds

Accessibility

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Caat box of rabbit with the tata box of cattle,buffalo camel and rat Caat box of rabbit with the tata box of cattle,buffalo camel and rat Document Transcript

    • Indian Journal of Biotechnology Vol. 7, October 2008, pp 478-481 The PCR amplification, sequencing and computer-aided analysis of ovine αS1-casein gene promoter S K Bhure* and B Sharma1 *Project Directorate on Animal Disease Monitoring And Aurveillance, IVRI Campus, Hebbal, Bangalore 560 024, India 1 Indian Veterinary Research Institute, Izatnagar 243 122, India Received 12 October 2006; revised 13 February 2008 ; accepted 15 April 2008 The paper reports 5'-flanking sequences of ovine αS1-CSNGP (casein gene promoter) of 2185 bp. It has shown many deletions, substitutions and a 12 bp addition compared to bovine sequence. The comparative study showed 2136 bp of 5′-flanking region and 49 bp exon I sequence. The exon I sequence contained two ribosomal binding sites. The computational analysis showed presence of core promoter elements, viz., TATA box, CAAT box and initiator sequence. However, no typical GC box was found. Of five known mammary gland specific sequences, three sequences, viz., milk box, Groenen structure and Yu Lee 6, were found. The 220 bp Groenen structure contained other milk protein gene specific sequences (MGF, MPBF, Yu Lee 2, 4 and 5, and Oka box C) and hormone responsive elements (PRE, PRL-RE). Other HREs (GRE, CRE, GHRE and IRE) and ubiquitous transcription factor binding sites were also present. These milk protein gene specific regulatory sequences and HREs are responsible for tissue specific and multi-hormone regulation of the ovine αS1-CSNG. Keywords: Ovine αS1-caseine gene promoter, gene regulation, transcription factor binding sites, hormone responsive elements Introduction The production of transgenic animals, expressing the foreign DNA sequence introduced into their genome, is a powerful technique for both biological research and bio-industry. The promoters of milk protein genes have been used to produce human proteins in mammary glands that are essential for the treatment of many diseases1,2. The elements which regulate tissue specific expression have to be present in the promoter region for production of heterologous protein of interest. So far, the studies utilizing bovine αS1-casein gene (αS1-CSNG) promoter demonstrated high level of expression in the milk of transgenic animals3,4. The characterization of transcript regulatory sequences in the promoter regions of any gene is an important prerequisite for understanding the interplay of various regulatory/hormone interactions which control their expression. However, this kind of study requires a mammary gland specific cell lines which are capable of expressing heterologous protein gene consistently. The computer-aided search of milk protein gene promoters for various cis-acting DNA elements and trans-acting _________________ *Author for correspondence: Tel: 91-80-23419576; Fax: 91-80-23415329 E-mail: sdbhure@rediffmail.com factors will simplify the transcription regulation studies to a greater extent. The promoter of αS1-CSNG gene of sheep has not been characterized. Therefore, the promoter region was cloned and sequenced. The sequence was then submitted to GenBank database of the National Center for Biotechnology Information (NCBI, acc. no. AJ784891). Materials and Methods The genomic DNA was isolated from 5 mL of sheep blood as per the method described by Sambrook and Russel5. The DNA isolated from polymorph nuclear leucocytes was used as template for PCR. A set of primers was designed from the conserved regions of heterologous sequences of αS1-CSNG available on NCBI, GenBank. The Hotstart PCR conditions were standardized by using gradient PCR with varied concentration of MgCl2. The PCR mixture contained 25 pM of each primer (Forward Primer, 5′-CCA GAT GGG CAT GAA AAA GGA-3′ and Reverse Primer, 5′-AAC CCA AGA CTG GGA AGA AG-3′), 200 M of each dNTP and 1.5 U of XT-Taq DNA polymerase (Banglore Genei, India) in a final volume of 50 µL. The Hotstart PCR was performed as follows: denaturation at 94°C for 60 sec; annealing at 65°C for 60 sec;
    • BHURE & SHARMA: OVINE α S1 CASEIN GENE PROMOTER extension at 72°C for 2 min in 35 cycles. The PCR product was gel purified by using GenTM Elute Gel extraction kit (Sigma, USA) as per the manufacturer’s protocol and cloned in pGEMT-Easy cloning vector (Promega, USA). Two recombinant clones were sequenced completely for both strands (ABI Prism 310). All the related milk protein gene sequences were down loaded from GenBank, NCBI. The sequences were edited for 5′-flanking regions and checked for sequence homology with ovine αS1-CSNGP using MegAlign of DNAstar molecular biology software. Homology map of 5′-flanking regions was constructed between ovine αS1-CSNGP and different casein genes of sheep, goat, cattle, buffalo, yak, rabbit and rat. Computer analysis of putative cis- and transregulatory sequences in the promoter region of ovine αS1-CSNG was carried out by Gene Tool Lite and DNASIS molecular biology software. Separate database was prepared in DNASIS for various milk protein associated consensus transcription factorbinding sequences available in the literature. Results and Discussion The full-length cloned fragment was 2185 bp. The comparison of 3′-end sequence of cloned 2185 bp fragment with that of 5′-end 45 bp ovine αS1-CSNG mRNA showed absolute homology. This 49 bp region is exon I sequence, which is conserved across rat α-, β-, γ-casein and bovine αS1-casein gene6. This exon I sequence was edited from the ovine DNA fragment to get 5′-flanking region of the ovine αS1CSNG. The sequence had shown 91.2% homology with goat (GenBank acc. no. AJ504712), 91.7% with cattle (GenBank acc. no. X59856), 81.9% with yak (GenBank acc. no. AF194983), 89.9% with bovine αS1-CSN (GenBank acc. no. AF529305 segment 1). Thus, comparison showed significant homology with 479 closely related species (bovine, goat, buffalo and yak) and low/insignificant homology was observed with camel, rabbit and rat αS1-casein gene. The highest homology was with bovine and caprine αS1-CSNG 5′-flanking regions. Since the complete 5′-flanking sequence of bovine αS1-CSNG was available and had shown significant homology with ovine amplicon. The bovine sequence (GenBank acc. no. X59856) was considered for further analysis and also because of close evolutionary relationship and presumably unmodified transcription factor binding site preferences. The ovine promoter region had shown additional sequences at -1005 to -992, -240 to -237 and -221 to 218. A 12 bp additional sequence was also noted whose role, if any, in influencing promoter activity requires further study. On the basis of sequence comparison with bovine αS1-casein gene promoter6, we predicted a putative transcription start site CCA+1TCA, which has the same sequence as that of initiator consensus YYA+1(T/A)YY. The exon I showed two ribosomal binding sites CCTTGATCA, centered at +5/+13 and GCTGCTTC at +26/+336-8. The amplified ovine αS1CSNGP contained complete non-coding exon I except for last four nucleotides, CAAG. The comparison with known consensus sequences of both ubiquitous and specific transcription factor motifs described for milk protein gene promoters showed several motifs common to different milk protein gene promoters as described previously9-13. The data of consensus sequences showing stringent homology are arranged as milk protein specific sequences (Table 1) and hormone receptor consensus sequences (Table 2). The motifs are distributed throughout the ovine αS1-casein 5′-flanking region. However, most of the milk gene promoter specific motifs are clustered between transcription initiation Table 1 —Mammary gland-specific-transcription factors and consensus sequences analysed in ovine αS1-CSNGP. Abbreviation Mammary specific factor Consensus Position MAF Mammary cell activating factor GRRGSAAGK -757 MPBF/MGF/STAT 5 Mammary gland specific nuclear factor Yin and Yang factor 1 RNTTCYTRGAAYY -98, -1937 CCATNT -196, -1420, -1514, -1712 MCYYAGAATYT TTCTTAGAATT RAAACCACARAATTAGCAT RGTWTAWATAG AAACCACAAAATTAGCATTTTA -155 -98 -64 -31 -63 YY 1 Yu-Lee 2 Yu-Lee 4 Yu-Lee 5 Yu-Lee 6 Oka box C Mammary gland specific sequences
    • 480 INDIAN J BIOTECHNOL, OCTOBER 2008 Table 2—Hormone-receptor-consensus sequence in ovine αS1-CSNGP Abbreviation Hormone response element Consensus Position GRE PRE CRE GH-RE1 GH-RE2 PRL IRE Glucocorticoid responsive element Progesterone responsive element Cyclic AMP responsive element Growth hormone unit TGTYCT ATTTCCGATGT TGA[TC][GC]TCA TAAATTA AATAAAT CTGATTA GCCATCTG -1602, -1351, -278 -116 -1768 -1333, -216 -1335, -499, -419 -40 -1421 Rat prolactin unit, IRE1 factor, rat insulin 1 unit, MAMM system site and -155, except for MAF and an upstream MGF site. The sequence was also searched for basal promoter elements, viz., transcription start site/initiator sequence, TATA signal, GC box and CAAT box. The ovine αS1-CSNGP contains a sequence TTTAAATA at -29, which showed homology with the TATA box of cattle, buffalo, camel, rat αS1-CSNG and γ-CSN gene of rat. A sequence, CAAAAT resembling CAAT box of rabbit β-casein gene promoter was found at -57 (Gen Bank acc. no. X 15735). An MGF/MPBF STAT5 sequence were located at -98 and -193711-15. MGF is a transcription factor discovered initially in the mammary epithelial cells of lactating animals and is a novel member of the cytokine-regulated transcription factor gene family and known to mediate prolactin responsiveness of milk protein gene expression. The MGF/MPBF/STAT5 site found in ovine αS1-CSNGP may be presumed to confer prolactin hormone induction. In ovine αS1-CSNGP, the DNA segment between -240 to -20 showed 96% homology to the “Groenen structure” consensus sequence11. This 220 bp DNA segment contains MGF/MPBF, Yu Lee 2, 4, 5 and 6, Oka box C, PRE, PRL-RE, and γ- and βinterferon responsive elements. There are four sequences showing 65-70% homology to the consensus milk box sequence as described by Laird et al10. Five mammary gland specific sequences associated with milk protein genes have been reported, viz., milk box, Groenen structure, Yu Lee sequence 1 and 6, and Oka box A16; three of them are present in the ovine sequence. The presence of these mammary gland specific sequences contributes to the tissue specificity of the promoter (Table 1). Milk protein gene expression is regulated by a combination of steroid and polypeptide hormones, viz., prolactin, insulin, glucocorticoids and estrogens being the most important positive and progesterone the main negative regulator of gene expression17. The hexanucleotide, TGTYCT is a part of a number of glucocorticoid receptor binding sites18, which is located at -278, -1351 and -1602. A sequence, ATTTCCGATGT at -116 had shown homology to rabbit progesterone receptor binding sequence at -110 19. A sequence, CTGATTA at -40 showed resemblance to rat prolactin unit20 but is present in inverted position relative to the orientation of gene. The sequence, GCCATCTG at -1421 showed homology to rat insulin unit21 and TGACATCA at -1748 to human promoter CRE element22; they were found in ovine αS1-CSNGP. These results agree well with experimental data showing that the expression of milk protein genes is subject to hormone regulation by glucocorticoids, progesterone, prolactin and insulin17. The milk protein gene expression is also regulated by mammary tissue specific transcription factors11. The other ubiquitous transcription factor binding sites found in the promoter region include AP 1, AP 2, AP 3, W-element, TTS and possible two types of enhancer elements found were PEA 3-CS. However, the ubiquitously expressed Oct 1 transcription factor, which is involved in the regulation of expression of many tissue specific and housekeeping genes, was not found in the ovine αS1-CSNGP23. The temporal and tissue-specific expression of milk protein genes are controlled by a distinct class of cooperating and antagonistic class of transcription factors, which are associated with multiple, sometimes clustered, binding sites. The number and position of potential binding sites can play a decisive role in the outcome of these synergistic and antagonistic interactions. The general theme is that common consensus sequences are present in all but their different spatial arrangements exist in the promoters from different species, which also holds true for ovine αS1-CSNGP. The promoter with deletion of tissue specific regulatory sequences and certain negative regulatory elements can make it useful for the construction an inducible eukaryotic
    • BHURE & SHARMA: OVINE α S1 CASEIN GENE PROMOTER expression vector. The computational analysis showed the presence of mammary gland specific regulatory elements, which can make ovine αS1CSNGP useful for transgenic vector construction. Acknowledgement Authors sincerely thank the Director, Indian Veterinary Research Institute, Izatnagar and Indian Council of Agricultural Research, New Delhi for providing the necessary facilities and financial support during the research work. References 1 Wilmut I, Archibald A L, McClenaghan, M, Simons J P, Whitelaw C B et al, Production of pharmaceutical proteins in milk, Experientia, 47 (1991) 905-912. 2 Houdebine L M, Production of pharmaceutical proteins from transgenic animals, J Biotechnol, 34 (1994) 269-287. 3 Toman P D, Pieper F, Sakai N, Karatzas C, Platenburg E et al, Expression of HBsAg gene in transgenic goats under direction of bovine α-S1 casein control sequence, Transgenic Res, 8 (1999) 415-427. 4 Tan X H, Cheng X, Zhou J, Chen H X, Un F Y et al, Bovine α-S1-casein gene sequences direct expression of a variant of human tissue plasminogen activator in the milk of transgenic mice, Yi-Chuan-Xue-Bao, 28 (2001) 405-410. 5 Sambrook J & Russel D W, Molecular cloningA laboratory manual, 3rd edn (Cold Spring Harbor, New York) 2001, 6.4-6.12. 6 Koczan D, Hobom G & Seyfert H M, Genomic organization of the bovine α-S1-casein gene, Nucleic Acids Res, 19 (1991) 5591-5596. 7 Mercier J C, Gaye P, Soulier S, Hue-Delahaie D & Villotte J L, Construction and identification of recombinant plasmids carrying cDNAs coding for ovine αS1-, αS2-, β-, κ-casein and β-lactoglobulin. Nucleotide sequence of αS1-casein cDNA, Biochemie, 67 (1985) 959-971. 8 Yu-Lee L Y, Richter-Mann L, Couch C H, Stewart A F, Mackinlay AG et al, Evolution of the casein multigene family: Conserved sequences in the 5’-flanking and exon regions, Nucleic Acids Res, 14 (1986)1883-1902. 9 Hall L, Emery D C, Davies M S, Parker D & Craig R K, Organization and sequence of human α-lactalbumin gene, Biochem J, 242 (1987) 735-742. 481 10 Laird J E, Jack L, Hall L, Boulton A P & Parker D, Structure and expression of the guinea-pig α-lactalbumin gene, Biochem J, 254 (1988) 85-94. 11 Groenen M A M, Dijkhof R J, van der Poel J J, van Diggelen R & Verstege E, Multiple octamer binding sites in the promoter region of bovine αS2-casein gene, Nucleic Acids Res, 20 (1992) 4311-4318. 12 Yoshimura M & Oka T, Isolation and structural analysis of mouse β-casein gene, Gene, 78 (1989) 267-275. 13 Watson C J, Gordon K E, Robertson M & Clark A J, Interaction of DNA-binding proteins with milk protein gene promoter in vitro: Identification of mammary gland specific factor, Nucleic Acids Res, 19 (1991) 6603-6610. 14 Schmitt-Ney M, Doppler W, Ball R K & Groner B, β-Casein gene promoter activity is regulated by hormone-mediated relief of transcriptional repression and a mammary glandspecific nuclear factor, Mol Cell Biol, 7 (1991) 3745-3755. 15 Wakao H, Gouilleux F & Groner B, Mammary gland factor (MGF) is a novel member of the cytokine regulated transcription factor gene family and confers the prolactin response, Eur Mol Biol Organ J, 13 (1994) 2182-2191. 16 Malewski T & Zwierzchowski L, Computer-aided analysis of potential transcription-factor binding sites in rabbit β-casein gene promoter, BioSystems, 36 (1995) 109-119. 17 Vonderhaar B K & Ziska S E, Hormonal regulation of milk protein gene expression, Annu Rev Physiol, 51 (1989) 641-652. 18 Scheidereit C, Geisse S, Westphal H M & Beato M, The glucocorticoid receptor binds to defined nucleotide sequences near the promoter of mouse mammary tumor virus, Nature (Lond), 304 (1983) 749-752. 19 von der Ahe D, Janich S, Sceidereist C, Renkawitz R, Schutz G et al, Glucocorticoid and progesterone receptors bind to the same sites in two hormonally regulated promoters, Nature (Lond), 313 (1985) 706-709. 20 Schuster W A, Treacy M N & Martin F, Tissue specific trans-acting factor interaction with proximal rat prolactin gene promoter sequences, EMBO J, 6 (1988) 1721-33. 21 Ohlasson H, Karlsson O & Edlund T, A beta specific protein binds to two major regulatory sequences of insulin gene enhancer, PNAS J, 85 (1988) 4228-31. 22 Lichtenheld M G & Podack E R, Structure of human perforin gene. A simple gene organization with interesting potential regulatory sequences, J Immunol, 143 (1989) 4267-4274. 23 Zhao F Q, Zheng Y, Dong B & Oka T, Cloning, genomic organization, expression, and effect on β-casein promoter activity of a novel isoform of the mouse Oct-1 transcription factor, Gene, 326 (2004) 175-187.