Your SlideShare is downloading. ×
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Enfermedades geneticas
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Enfermedades geneticas

4,327

Published on

0 Comments
7 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
4,327
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
291
Comments
0
Likes
7
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Enfermedades genéticas, congénitasy hereditarias¿Qué son y como se diferencian?
  • 2. Una enfermedad genética
  • 3. Una enfermedad genéticaO trastorno genético es una condición patológica establecida por el efecto biológico consecuente a una alteración del genoma.
  • 4. Genética es distinto de hereditariaUna enfermedad genética puede ser hereditaria o no; si el gen alterado está presente en las células germinales (óvulos y espermatozoides) será hereditaria (pasará de generación en generación), por el contrario si sólo afecta a las células somáticas, no será heredada.
  • 5. Aspectos generales Los 46 cromosomas humanos (22 pares de autosomas y 1 par de cromosomas sexuales) entre los que albergan casi 3.000 millones de pares de bases de ADN que contienen alrededor de 80.000 genes que codifican proteínas. Las regiones que codifican ocupan menos del 5 % del genoma (la función del resto del ADN permanece desconocida), teniendo algunos cromosomas mayor densidad de genes que otros.
  • 6. Aspectos generales Uno de los mayores problemas es encontrar cómo los genes contribuyen en el complejo patrón de la herencia de una enfermedad, como ejemplo el caso de la diabetes, asma, cáncer y enfermedades mentales. En todos estos casos, ningún gen tiene el potencial para determinar si una persona padecerá o no la enfermedad.
  • 7. Aspectos generales Poco a poco se van conociendo algunas enfermedades cuya causa es la alteración o mutación) de todo o alguna región de un gen. Estas enfermedades afectan generalmente a todas las células corporales.
  • 8. Etiología: causas posibles Puede estar causada por una mutación, como muchos cánceres. Hay trastornos genéticos causados por duplicación de cromosomas, como en el síndrome de Down, o duplicación repetida de una parte del cromosoma, como en el síndrome de cromosoma X frágil.
  • 9. Etiología: causas posibles Hay trastornos genéticos causados por la deleción de una región de un cromosoma, como en el síndrome deleción 22q13, en que el extremo del brazo largo del cromosoma 22 está ausente. El defecto en los genes posible que se herede de los padres. En este caso el trastorno se llama enfermedad hereditaria. Puede pasar a menudo de padres sanos, si son portadores de un defecto recesivo, aunque también ocurre en casos con defectos genéticos recesivo.
  • 10. Tipos de Variaciones Genéticas Cuando se comparan las secuencias de ADN de dos seres humanos cualesquiera, se encuentra que a lo menos el 99.9% de éstas son idénticas. Dado al gran tamaño de nuestro genoma, que se encuentra constituido por 3000 millones de letras, la variación máxima que puede ocurrir entre los genomas de dos seres humanos será de alrededor de 3 millones de letras (el 0.1% de 3000 millones de letras). Por supuesto que estas diferencias se reducen substancialmente y son por lo tanto mucho menores en el caso de comparar los genomas de dos familiares cercanos.
  • 11. Tipos de Variaciones Genéticas Cuando se comparan las secuencias de varios seres humanos en forma simultánea se pueden identificar claramente aquellas posiciones con una alta variación de aquellas posiciones que son extremadamente conservadas. En el proyecto genoma humano se secuenció (o leyó) el genoma completo de 40 seres humanos que eran representativos de ambos sexos y de las diversas razas, obteniéndose así las regiones de la secuencia que son conservadas y aquellas que presentan variación. La existencia de estas últimas (las zonas variables) introdujo la necesidad de definir los tipos posibles de variaciones que pueden ocurrir entre una secuencia y el genoma consenso obtenido como producto del proyecto genoma humano.
  • 12. Mutación puntual: Definición: Sustitución de un nucléotido por otro que se observa con una frecuencia inferior al 1% en la población. Descripción: Las mutaciones puntuales son variaciones de una letra en el ADN que se observan raramente en la población. Estas ocurren casi exclusivamente dentro de las zonas conservadas del genoma humano y en general conllevan una alteración de la función de la proteína que codifican.
  • 13. Mutación puntual:Existen 3 tipos de mutaciones puntuales: mutación silenciosa o sinónima, mutación con pérdida de sentido, mutación sin sentido.Las mutaciones puntuales pueden no tener ninguna consecuencia fenotípica como pueden también ser letales para quien las porta.Pese a que una mutación puntual producirá un cambio en la secuencia de un gen, éste no necesariamente se traduce en una variación en la secuencia proteica que dicho gen codifica.
  • 14. Mutación puntual: Esto es debido a que el código genético es degenerado, existiendo múltiples tripletes o codones diferentes que codifican para el mismo aminoácido. Si el cambio a nivel de ADN no se traduce en un cambio de aminoácido, la mutación será denominada silenciosa o sinónima y generalmente no conlleva ninguna consecuencia fenotípica en la persona que la porta
  • 15. Mutación puntual: En el caso de las mutaciones con pérdida de sentido, el cambio a nivel de ADN conlleva un cambio en un aminoácido de la proteína que se codifica, lo cual puede tener variadas consecuencias en la funcionalidad de la proteína. Las mutaciones sin sentido en general conllevan una pérdida de funcionalidad, ya que involucran la producción de proteínas truncadas o incompletas debido a que la mutación genera la aparición hipertricosis prematura de una señal de término en la secuencia de la proteína. Secuencia normal: AACTGGGTCAAA Mutación: AACTGAGTCAAA
  • 16. Deleción, traslocación, inserción
  • 17. Deleción / Inserción: Definición: Una secuencia de ADN, que varía en el rango de una sola base a toda una región del cromosoma, se pierde o inserta. Descripción: Las duplicaciones o deleciones generalmente se producen en el proceso de meiosis en la generación de las células sexuales. En esta etapa, el proceso de aparamiento cromosomal (crossing over) produce intercambios desiguales entre dos cromosomas, produciéndose copias que tienen un mayor y un menor contenido de material genético.
  • 18. Deleción / Inserción:Implicancias y consecuencias: Las inserciones y deleciones pueden tener un gran impacto funcional, dependiendo tanto de su magnitud como del lugar en el genoma donde éstas se producen. Ejemplos extremos incluyen aquellos casos donde cromosomas completos se encuentran duplicados o ausentes. Secuencia normal: Un niño llamado Ali Sol, nació en Amman de GGT......................GGCACATCC Jordania sin brazos por la deleción congénita de ATTTC los genes. Actualmente ya aprende usar los pies para hacer las activas diarias, por ejemplo comer, jugar el ordenador etc. Los médicos dijeron que la Inserción: posibilidad de perder los brazos por la deleción congénita de los genes es muy pequeña. GGTAAATGTTTTTGGCACATC CATTTC
  • 19. SNPs: Sustitución normalmente binaria de un nucléotido Definición: Sustitución normalmente binaria de un nucléotido por otro que se observa con una frecuencia superior al 10% en la población. Descripción: Los SNPs son variaciones binarias (oscilan sólo entre 2 nucleótidos) de una posición en el ADN y definen alelos que se observan con una alta frecuencia en la población. Por ejemplo, un SNP puede oscilar entre C y T en una determinada posición, o entre A y T, entre C y T, etc, etc.
  • 20. SNPs: Sustitución normalmente binaria de un nucléotido Los SNPs son generalmente los responsables de las diferencias fenotípicas observadas entre dos personas. En general, actuando de manera coordinada, un conjunto de varios SNPs en diferentes regiones del genoma define la predisposición o riesgo que una persona puede tener frente a diversas enfermedades. A diferencia de las mutaciones, los SNPs en general no son causa directa de la manifestación de una enfermedad. Es decir, estos no definen la existencia o aparición de la enfermedad con una penetrancia elevada, como es el caso de las mutaciones. Secuencia normal: AACTG(C/T)GTCAAA Secuencia normal: AACTG(A/G)GTCAAA
  • 21. Secuencias de cortas repeticiones (STRs): Definición: Sequencias de alrededor de 3 nucleótidos que se encuentran repetidas múltiples veces. Descripción: Las secuencias de cortas repeticiones o STRs (short tandem repeats) se forman porque una corta secuencia de ADN se encuentra repetida secuencialmente múltiples veces. Dentro de estas se encuentran las denominadas expansiones de tripletes.
  • 22. Secuencias de cortas repeticiones (STRs): Implicancias y consecuencias: Algunas secuencias de cortas repeticiones no tienen ninguna consecuencia funcional conocida, mientras que otras son claramente patológicas manifestándose con la aparición de una enfermedad en el mediano o largo plazo. En algunos de los casos patológicos, el número de repeticiones correlaciona directamente con la edad a la cual se manifiesta la enfermedad. Secuencia normal: TGGGTACT(GAA)3TTTTAGT Secuencia normal: TGGGTACTGAAGAAGAATTTTAGT Expansión de triplete: TGGGTACT(GAA)6TTTTAGT Expansión de triplete: TGGGTACTGAAGAAGAAGAAGAAGAATTTTAGT
  • 23. Alteración Mutación Cromosoma CariotipoSíndrome de Angelman DCP 15Daltonismo P XSíndrome de Down C 21Síndrome de Edwards C 18Espina bífida P 1Fenilcetonuria PFibrosis quística P 7Hemofilia P XSíndrome de Ehlers-Danlos y P 15Síndrome de Hiperlaxitud articularSíndrome de JoubertSíndrome de Klinefelter C X 47 XXYNeurofibromatosisEnfermedad de Pelizaeus-MerzbacherSíndrome de Patau C 13Síndrome de Prader-Willi DC 15Enfermedad de Tay-Sachs P 15Síndrome de Turner C X
  • 24. Algunas enfermedades genéticas Síndrome de Holt-Oram(sho): malformaciones de miembros superiores. Síndrome de Turner : causado por la ausencia de uno de los cromosomas X. Klinefelter : es una alteración cromosómica, que se presenta en aproximadamente 1 de cada 1000 varones. Talla corta : es un signo clínico en un paciente. Sus causas son múltiples y siempre hay un componente genético en su determinación. Puede ser parte de un cuadro complejo, o presentarse aisladamente. Para tratar un paciente con talla corta es indispensable conocer el porqué de esta característica. Sordera: es un trastorno relativamente común, que puede empezar en cualquier época de la vida y tener muchas causas. Fisura labiopalatina: es una falla en la formación del labio superior ocurrida durante la vida embrionaria.
  • 25. Algunas enfermedades genéticas Acondroplasia: es un cuadro genético de talla corta caracterizado por crecimiento inadecuado debido a una alteración en los huesos Autismo: es un trastorno del desarrollo caracterizado por un patrón anormal en la manera de relacionarse con otras personas y con el entorno, por alteraciones de lenguaje y comunicación y por la existencia de intereses muy circunscritos Enfermedad de Huntington: afectan al sistema nervioso. Ataxias espinocerebelosas: problemas neurologicos.
  • 26. Las enfermedades hereditarias Son aquel conjunto de enfermedades genéticas cuya característica principal es su supervivencia de generación en generación, transmitiéndose de padres a hijos y así sucesivamente.
  • 27. Enfermedades mono génicas Son enfermedades hereditarias monogénicas las producidas por la mutación o alteración en la secuencia de ADN de un solo gen. También se llaman enfermedades hereditarias mendelianas, por transmitirse en la descendencia según las leyes de Mendel. Se conocen más de 6.000 enfermedades hereditarias monogénicas, con una prevalencia de un caso por cada 200 nacimientos. Aún así, son menos que las enfermedades poligénicas. Niño que presenta Síndrome Las enfermedades monogénicas se Peutz-Jeghers, observe múltiples manchas café en transmiten según los patrones hereditarios labio inferior. mendelianos como:
  • 28. Enfermedad autosómica recesiva. Para que la enfermedad se manifieste, se necesitan dos copias del gen mutado en el genoma de la persona afectada, cuyos padres normalmente no padecen la enfermedad, pero portan cada uno una sola copia del gen mutado, por lo que pueden transmitirlo a la descendencia. Se transmite por los cromosomas no sexuales (autosomas). La probabilidad de tener un hijo afectado por una enfermedad autosómica recesiva entre dos personas portadoras de una sola copia del gen mutado (que no manifiestan la enfermedad) es de un 25%.
  • 29. Características El gen defectuoso puede ser heredado tanto del padre como de la madre La probabilidad de heredar el gen defectuoso es independiente del sexo de la persona Un niño tiene un 50% de probabilidad de heredar la enfermedad si uno de sus padres es heterocigoto para la enfermedad
  • 30. Enfermedad autosómica recesiva.
  • 31. Enfermedad autosómica dominante. Sólo se necesita una copia mutada del gen para que la persona esté afectada por una enfermedad autosómica dominante. Normalmente uno de los dos progenitores de una persona afectada padece la enfermedad y estos progenitores tienen un 50% de probabilidad de transmitir el gen mutado a su descendencia, que padecerá la enfermedad.
  • 32. Características El gen defectuoso puede ser heredado tanto del padre como de la madre La probabilidad de heredar el gen defectuoso es independiente del sexo de la persona Si una persona tiene sólo una copia del gen defectuoso se denomina portador. Esta persona no manifestará la enfermedad, pero es capaz de entregar el gen defectuoso a su descendencia. Un portador tiene un 50% de probabilidad de entregar un gen defectuoso a sus hijos. Si dos portadores tienen un hijo, existe un 25% de probabilidad de que éste sea sano (ninguna copia defectuosa), un 25% de que éste sea enfermo (dos copias del gen defectuoso), y un 50% de probabilidad de que éste sea portador (una copia del gen defectuoso). Todos los hijos de una persona afectada van a ser portadores de la enfermedad
  • 33. Patrón de dominancia
  • 34. Enfermedad ligada al cromosoma X El gen mutado se localiza en el cromosoma X. Estas enfermedades pueden transmitirse a su vez de forma dominante o recesiva.
  • 35. Herencia dominante ligada al sexo: Una enfermedad genética cuyo gen defectuoso se localiza en el cromosoma X (que forma parte del par de cromosomas que dictan el sexo), tiene un patrón de herencia ligado al cromosoma X o al sexo. Dado que la enfermedad presenta un patrón de herencia dominante, tanto los varones como las mujeres pueden padecer la enfermedad. Características: Los hijos (independiente del sexo) de una mujer afectada heterocigota tienen un 50% de probabilidad de heredar la mutación y por lo tanto tener hijos afectados Todas las hijas mujeres de un hombre afectado presentarán la enfermedad Ningún hijo hombre de un hombre afectado presentará la enfermedad.
  • 36. Herencia dominante ligada al sexo:
  • 37. Herencia recesiva ligada al sexo: Una enfermedad genética cuyo gen defectuoso se localiza en el cromosoma X (que forma parte del par de cromosomas que dictan el sexo), tiene un patrón de herencia ligado al cromosoma X o al sexo. Dado que la enfermedad presenta un patrón de herencia recesivo, sólo los hombres podrán padecer de la enfermedad, mientras que las mujeres sólo podrán llegar a ser portadores (sin síntomas).
  • 38. Herencia recesiva ligada al sexo:Características: Los hijos hombres de un madre portadora tienen un 50% de probabilidad de presentar la enfermedad Las hijas mujeres de una mujer portadora tendrán un 50% de probabilidad de ser a su vez portadoras de la enfermedad. Todos los hijos de un hombre afectado serán sanos Todas las hijas de un hombre afectado heredarán el gen defectuoso y serán portadoras Todos los hombres que tengan una mutación en el cromosoma X estarán afectados • Mujeres con un cromosoma X mutado serán portadoras y no manifestarán los síntomas.
  • 39. Herencia recesiva ligada al sexo:
  • 40. Algunas enfermedades monogénicas son: Anemia falciforme (cromosoma 11) - autosómica recesiva Fibrosis quística (cromosoma 7, básicamente) - autosómica recesiva Fenilcetonuria (cromosoma 12, básicamente) - autosómica recesiva Enfermedad de Batten (cromosoma 16) - autosómica recesiva Hemocromatosis (cromosoma 6 la forma clásica) - autosómica recesiva Deficiencia de alfa-1 antitripsina (cromosoma 14) - autosómica recesiva Enfermedad de Huntington (cromosoma 4) - autosómica dominante Enfermedad de Marfan (cromosoma 15, básicamente) - autosómica dominante Distrofia muscular de Duchenne (cromosoma X) - ligada al sexo recesiva Síndrome de cromosoma X frágil (cromosoma X) - ligada al sexo recesiva Hemofilia A (cromosoma X) - ligada al sexo recesiva
  • 41. Insensibilidad Congénita al Dolor Frecuencia: 100 casos documentados en Estados Unidos. Se desconoce la frecuencia en otras áreas y no se suele diagnosticar al pasar desapercibida. Causa: Descubierta recientemente. Se debe a una mutación en un gen encargado de la síntesis de un tipo de canal de sodio que se encuentra principalmente en neuronas encargadas de recibir y transmitir el estímulo doloroso. Descripción: Son individuos totalmente normales en el tacto y la sensibilidad al frío, al calor, presión y cosquilleos. Sin embargo, ante cualquier acto que en personas normales provocaría dolor (como clavar una aguja) no provoca ninguna sensación dolorosa en aquellos que poseen esta insensibilidad. Como consecuencia de esto, suelen morir más jóvenes por traumatismos y lesiones varias al no sentir ningún daño. Deben estar bajo supervisión en edades tempranas para que no se lesionen ellos mismos.
  • 42. Síndrome de MoebiusFrecuencia: Alrededor de 80 casos documentados en España, 200 en Inglaterra… En Europa, aparecen en torno a 300 niños con este síndrome al año. Causa: Desconocida. Ni siquiera se sabe si son los nervios, el tronco del encéfalo o los músculos los que están afectados en el origen de la enfermedad. Existen muchas y variadas hipótesis pero sin pruebas que las respalden. Descripción: Debido a que no se desarrollan algunos nervios faciales, las personas que nacen con este síndrome carecen de expresión facial. No pueden sonreír, ni fruncir el ceño, etc. Tampoco pueden mover lateralmente los ojos ni controlar el parpadeo. A menudo se les puede encontrar durmiendo con los ojos abiertos. Tienen grandes dificultades en succionar, tragar, hablar y cualquier actividad en la que estén implicados los músculos de la cara.
  • 43. Hermafroditismo Verdadero Frecuencia: Alrededor de 500 casos documentados en todo el mundo. Se desconoce la frecuencia real en la población. Causa: La persona hermafrodita es una quimera. Se produce por la fusión de dos zigotos de distinto sexo. Es decir, primero un espermatozoide fecundaría a un óvulo y después otro espermatozoide fecundaría a otro óvulo más. Los cigotos que se formarían y que estaban destinados a ser mellizos, se acaban fusionando y volviéndose un único individuo que, genéticamente, es mujer y hombre al mismo tiempo. Se desconoce por qué se produce esta fusión de los zigotos. Descripción: Los hermafroditas tienen tanto tejido ovárico como tejido testicular. Estos dos pueden encontrarse mezclados, lo que se llama ovotestis o encontrarse por un lado un testículo y por otro un ovario. Los genitales externos son ambiguos y poseen componentes de ambos sexos. Las personas hermafroditas pueden tener apariencia femenina o masculina.
  • 44. Fibrodisplasia osificante progresiva Frecuencia: 200-300 casos documentados en todo el mundo. Los pocos conocimientos que tienen los médicos de ella hacen que muchas veces no se diagnostique. Se estima que aparece un caso por cada dos millones de nacimientos. Causa: Desconocida. Es una enfermedad de herencia autosómica dominante. Se piensa que están implicados varios genes encargados de sintetizar factores de crecimiento óseo. Descripción: En esta enfermedad se dan episodios repetidos de inflamación de los tejidos blandos y el desarrollo de tumores subcutáneos y en los músculos. Estas lesiones provocan la formación de hueso en sitios donde nunca debería producirse, como ligamentos, músculos, tendones, cápsulas articulares… Los traumatismos también desencadenan y hacen avanzar la osificación de los tejidos blandos. Progresivamente, el individuo irá perdiendo cada vez más movilidad hasta que, por imposibilidad de mover la musculatura encargada de la respiración (por estar osificada), mueran por asfixia.
  • 45. Maldición de Ondina (Hipoventilación alveolar primaria) Frecuencia: Entre 200-300 casos conocidos en todo el mundo. Por ser causa de muerte súbita se piensa que los casos conocidos son sólo el pico del iceberg y que en realidad 1 bebé de cada 200.000 que nacen podría tener esta enfermedad. Causa: Parcialmente conocida. La principal causa es una mutación o varios del gen PHOX2B, de herencia autosómica dominante. Los mecanismos de la respiración involuntaria no funcionan adecuadamente. Al dormir, los receptores químicos que reciben señales (bajada de oxígeno o aumento de dióxido de carbono en sangre) no llegan a transmitir las señales nerviosas necesarias para que se dé la respiración. Descripción: En las formas más leves de la maldición de Ondina, el sujeto podrá seguir viviendo, pero debido a que el sueño no es reparador por la falta de oxígeno, durante el día estará somnoliento, se fatigará fácilmente, tendrá dolores de cabeza, aumento del nivel de glóbulos rojos y un largo etc.… En las formas más graves, en las que dormir significa una muerte segura, suele aparecer desde el nacimiento, y la mayoría de neonatos mueren sin que muchas veces se llegue a saber la causa. Sin embargo, en aquellas personas en que la enfermedad ha empeorado progresivamente y llegan a arriesgar la vida cada vez que duermen, suele tratarse con ventilación asistida durante la noche. Aún así, a pesar de todos esos tratamientos, cualquier descuido de quedarse dormido sin la oxigenoterapia indicada, significará la muerte.
  • 46. Síndrome de ProteusFrecuencia: 200 casos documentados en todo el mundo actualmente. Se estima que aparece un caso por más de un millón de nacimientos. Causa: Desconocida. Unos autores defienden que probablemente sea debido a un mosaicismo somático de un gen dominante letal. Otros autores sugieren que se deba a una recombinación en el embrión dando lugar a tres tipos de células: Células normales, células de crecimiento mínimo y células de crecimiento excesivo. Descripción: Existen una gran cantidad de malformaciones cutáneas y subcutáneas, con hiperpigmentación, malformaciones vasculares y crecimiento irregular de los huesos. Se produce el gigantismo parcial de los miembros o el crecimiento excesivo de los dedos mientras que algunas zonas del cuerpo crecen menos de lo que deberían. Todo esto provoca una desfiguración extrema de la persona que suele estigmatizarla socialmente. Josep Merrick, el famoso “Hombre Elefante”, sufría de este síndrome.
  • 47. Progeria (Síndrome Hutchinson-Gilford)Frecuencia: Alrededor de 100 casos documentados. Se estima que aparece un caso de progeria por cada 8 millones de nacimientos, aunque podría ser mayor ya que muchas veces no llega a diagnosticarse. Causa: Parcialmente conocida. La mayoría de los casos de progeria se producen por mutaciones de herencia autonómica dominante en el gen LMNA. Este gen participa en el mantenimiento de la estabilidad nuclear y la organización de la cromatina. También podría intervenir en la regulación de la expresión genética, la síntesis y reparación del ADN. Descripción: Los individuos con progeria envejecen muy rápidamente desde la niñez. Al nacimiento tienen una apariencia totalmente normal pero van creciendo cada vez más lentamente que los otros niños y desarrollan una expresión facial muy característica. Pierden el pelo, adquieren arrugas y padecen un daño severo de las arterias (aterosclerosis) que les lleva a la muerte en los primeros años de la adolescencia.
  • 48. Cola Humana Verdadera (Cola Vestigial) Frecuencia: Alrededor de 100 casos documentados en todo el mundo. Causa: No se conoce en profundidad. Se cree que se produce por la mutación de los genes encargados de producir la muerte celular programa de las células que estaban destinadas a formar una cola. Descripción: Se observa la presencia de una cola vestigial en la zona final del sacro, a nivel cóccix. Esta cola está compuesta de tejido conectivo, músculos, vasos sanguíneos, nervios, piel, vértebras y cartílago.
  • 49. Gemelo Parásito (Fetus in Fetus) Frecuencia: Alrededor de 100 casos documentados en todo el mundo. Causa: Es una exageración del caso de los siameses. Dos gemelos no llegan a separarse completamente cuando son zigotos y quedan unidos por alguna zona. Uno de estos gemelos crece sano mientras que el otro se atrofia quedando en el interior del gemelo sano y dependiendo completamente de él. Se desconoce por qué los gemelos no se separan correctamente. Descripción: Cuando el feto hospedador consigue sobrevivir al parto, éste puede mostrar un abombamiento en la zona donde se sitúe el feto parásito. El 80% de las veces se encuentra en la región abdominal, pero también puede encontrarse en el cráneo, zona sacra, escroto…. También puede pasar desapercibido al principio. Más tarde, conforme la persona va creciendo también lo hace el feto parásito. Al realizar pruebas de imagen se observan órganos en lugares donde no deberían existir aunque también pueden verse unas diminutas piernas, brazos, dedos, pelo o cualquier otro elemento del feto que haya desarrollado. No hay dos casos iguales de fetus in fetus, puesto que los fetos parásitos pueden situarse en zonas muy distintas del feto hospedador y, por tanto, también será diferente el grado de crecimiento y elementos que haya llegado a desarrollar. Hay fetus parásitos muy desarrollados y otros que sólo poseen un número escaso de órganos.
  • 50. Síndrome Hombre Lobo (Hipertricosis Lanuginosa Congénita) Frecuencia: 40-50 Casos documentados en todo el mundo desde su descubrimiento. La incidencia natural (sin contar los casos en familias) se estima en un caso entre mil millones o uno por 10 mil millones de habitantes. Causa: Desconocida. Se piensa que es una mutación que sigue una herencia autonómica dominante. La mayoría es de herencia familiar y, muy raramente, la mutación se da de forma espontánea. Descripción: Las personas que lo padecen están completamente cubiertas por un vello lanugo largo excepto en las palmas de las manos y de los pies. La longitud a la cual puede llegar el vello es de 25 centímetros. El lanugo es el pelo fino y blanquecino (como si fuera pelusilla) que aparece en los recién nacidos en hombros y brazos y que desaparece normalmente tras el primer mes desde el nacimiento. En los que padecen esta forma de hipertricosis el lanugo persiste y puede crecer durante toda la vida o desaparecer con los años.
  • 51. Enfermedades multifactoriales También llamadas poligénicas, son producidas por la combinación de múltiples factores ambientales y mutaciones en varios genes, generalmente de diferentes cromosomas. No siguen un patrón de herencia mendeliano, y a veces cuando es un gen principal el responsable de la enfermedad se comporta como herencia dominante con penetrancia incompleta, como en el caso del cáncer de mama hereditario (genes BRCA1 y BRCA2).
  • 52. Enfermedades multifactoriales Algunas de las enfermedades crónicas más frecuentes son poligénicas, como por ejemplo: Hipertensión arterial, Enfermedad de Alzheimer, Diabetes mellitus, varios tipos de cáncer, incluso la obesidad. La herencia poligénica también se asocia a rasgos hereditarios tales como los patrones de la huella digital, altura, color de los ojos y color de la piel. Posiblemente la mayoría de las enfermedades son enfermedades multifactoriales, producidas por la combinación de trastornos genéticos que predisponen a una determinada susceptibilidad ante los agentes ambientales.
  • 53. Enfermedades cromosómicas Son debidas a alteraciones en la estructura de los cromosomas, como pérdida o deleción cromosómica, aumento del número de cromosomas o translocaciones cromosómicas. Algunos tipos importantes de enfermedades cromosómicas se pueden detectar en el examen microscópico. La trisomía 21 o síndrome de Down es un trastorno frecuente que sucede cuando una persona tiene tres copias del cromosoma 21 (entre un 3 y un 4% de los casos son hereditarios; el resto son congénitos).
  • 54. Enfermedad mitocondrial Este tipo de enfermedad hereditaria es relativamente infrecuente. Es causada por mutaciones en el ADN mitocondrial, no cromosómico. La enfermedad mitocondrial tiene diferentes síntomas que pueden afectar a diferentes partes del cuerpo. Las mitocondrias tienen su propio ADN.
  • 55. Enfermedad mitocondrial En los últimos años se ha demostrado que más de 20 trastornos hereditarios resultan de las mutaciones en el ADN de las mitocondrias. Dado que las mitocondrias provienen sólo del óvulo son heredadas El S. MELAS es un trastorno progresivo. Debido a que las células musculares y nerviosas tienen exclusivamente de la madre. necesidades especialmente altas de energía, los problemas musculares y neurológicos son Una persona con un trastorno características comunes de las enfermedades mitocóndricas. mitocondrial puede presentar patrones de herencia materna (solo los individuos Los pacientes con MELAS pueden ser normales en los primeros años de la vida, pero poco a poco relacionados por un pariente materno presentan retraso motor y de las etapas del desarrollo intelectual. Las fundamentales están en riesgo). manifestaciones clínicas asociadas se dan entre los 5 y los 15 años de edad, y son: talla baja, vómitos, Los hombres no transmiten la convulsiones por epilepsia focal o generalizada y finalmente episodios de hemiparesia (parálisis leve enfermedad a sus hijos. o incompleta de un lado del cuerpo) aguda que puede afectar a uno u otro lado de forma alternante.
  • 56. Algunas causas Las exposiciones a productos químicos en el medio ambiente pueden perjudicar la función reproductiva humana de muchas maneras. Los sistemas reproductivos masculinos y femeninos son importantes sistemas de órganos, los cuales son sensibles a numerosos agentes químicos y físicos. La amplia gama de resultados reproductivos adversos incluye una reducción en la fertilidad, abortos espontáneos, bajo peso al nacer, malformaciones y deficiencias del desarrollo.
  • 57. Una enfermedad congénita Es aquella que se manifiesta desde el nacimiento, ya sea producida por un trastorno durante el desarrollo embrionario, durante el parto, o como consecuencia de un defecto hereditario.

×