Seahorse

  • 434 views
Uploaded on

 

More in: Technology
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to like this
No Downloads

Views

Total Views
434
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
5
Comments
1
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. GENETIC DIVERGENCE STUDIES IN SEAHORSEBASED ON MITOCHONDRIAL DNA & MICROSATELLITE SEQUENCING Karan Veer Singh
  • 2. OBJECTIVES: 1. Morphological & molecular identification of Seahorse fishspecies from India using traditional and molecular approaches.(16srDNA, Cyt b and Co I gene segments).2. Development of microsatellite markers in Seahorse species. a. Identification of microsatellite loci in H. kuda, H. trimaculatus,through cross species amplification. b. Sequencing of identified microsatellite loci to confirm repeats. 3. Population genetics of seahorse- Genotyping of individuals fromnatural populations withi. identified microsatellite markers and ii. mitochondrial DNAmarkers. NBFGR
  • 3. NBFGR
  • 4. NBFGR
  • 5. Out Comes & Out Put :Clear species identification will make it easier:- • To develop marking systems to distinguish aquacultured seahorses from wild-caught specimens. • To modify fishing practices appropriately, • Design protective marine reserves, & To assess captive breeding potential for seahorses. • Genetic studies provide valuable information for baseline management decision. • Identifying remnant population and determining the extent to which native genetic pools are being changed by hybridization. • The population structure of threatened or endangered species. NBFGR
  • 6. Present StatusGovernment of India has banned the collection (fishing) of seahorses sinceJuly 2001,Under Schedule – I of the Wildlife Protection Act 1972.Seahorse characteristics of low fecundity, limited mobility,structured mating patterns and site fidelity, make them particularlyvulnerable to heavy fishing pressure. NBFGR
  • 7. Present StatusS.no Scientific Name Complex of Place Species1 H. borboniensis Kochi / Palk *2 H. fuscus -- Palk3 H. histrix 4 Expected4 H. kuda 10 Kochi / Palk5 H. trimaculatus 2 Kochi / Palk6 H. spinosissimus Palk Not well described7 H. kelloggi Expected8 H. mohnikei NBFGR New 2007
  • 8. TaxonomyPhylum ChordataSubphylum PiscesSuperclasss GnathostomataClass OsteichthyesSubclass TeleosteiOrder Syngnathiformes (syn:Together, with + gnathos: Jaw)Super Family SyngnathoideaFamily Syngnathidae & SolenostomideaSub Family Hippocampus & Syngnathinae (pipefishes)Genus Hippocampus (hippo:Horse + campus:Sea animal) includes pipefishes, pipehorses and seadragons Families Pegasidae Tube Mouths / Sea mouths Aulostomidae Trumpet Fishes Fistularidae Cornet Fishes NBFGR Centriscidae Shrimp Fishes
  • 9. NBFGR
  • 10. NBFGR
  • 11. RESEARCH METHODOLOGY: 2.Sample acquisition and identification •Indian Ocean along the eastern and western side. 2.DNA extraction, PCR amplification, and sequencing •Sample preparation using fin clippings and or tail region for DNA extraction. •(Taggart et al., (1992) and Cenis et al., (1993) with minor modifications) •Seahorse Species specific primers development. •PCR amplification based on standard protocols for selected Microsatellite & Mt DNA. •Sequencing of the sample on DNA sequencer. 2.Molecular Data Analysis using Genetic software •Sequence editing /Processing/ Submission •Molecular data analysis (EditSeq, MegaBACE, CLUSTALW,BIOEDIT, MEGA 4, Arlequin) •Phylogenetic analysis (PAUP,MOLPHY,MEGA,AMOVA) NBFGR
  • 12. Sample Collection:•Thondi, Mullimunai and Pamban Palk Bay.•Mandapam, Tuticorin (Vellipatti, Thirespuram & Tiruchendur)Gulf of Mannar (east coast of India).•Vizhinjam near Trivandrum, Shakthikulangara and Cochinalong Kerala Coast.•Karwar, Kumta in Karnataka; & Panjim and Goa estuary. NBFGR
  • 13. Sites of occurrences NBFGR
  • 14. NBFGR
  • 15. GENETIC POPULATION STRUCTURE OF TWO CLOSELY RELATED SPECIESHippocampus kuda and Hippocampus trimaculatus USING MtDNA SEQUENCES Mitochondrial DNA PCR primers used for Hippocampus spp. S.no Primer Name Sequence 5’ – 3’ References 1 L2510 F:CGCCTGTTTATCAAAAACAT 16 s Palumbi et al.,1991 2 H3058 R:CCGGTCTGAACTCAGATCACGT 3 COI F1 F:TCAACCAACCACAAAGACATTGGCAC 4 R:TAGACTTCTGGGTGGCCAAAGAATCA COI Ward R.D et al., 2005 COI R1 5 Shf 2 F:TTGCAACCGCATTTTCTTCAG 6 R:CGGAAGGTGAGTCCTCGTTG Cyt b Lourie S.A. et al., 2005 Shr 2 7 1027 R R:ACAGGTATTCCCCCAATTC NBFGR
  • 16. Genetic variability of Mitochondrial Markers(COI, 16S rRNA & Cyt b) in H.kuda and H. trimaculatus COI 16S rRNA Cyt b H. kuda H. trimaculatus H. kuda H. trimaculatus H. kuda H. trimaculatus No. of 655 655 592 586 704 677 Nucleotides Variable Sites 1.71 1.62 0.76 0.68 2.13 2.05 Ti/Tv Ratio 2.47 2.27 1.92 1.80 3.46 3.30 Haplotypes 0.53 0.48 0.61 0.59 0.78 0.70 Diversity Nucleotide 1.29 1.13 0.59 0.52 0.95 0.87 Diversity Mean Genetic 0.57 0.60 0.47 0.41 0.70 0.68 Divergence NBFGR
  • 17. Variable nucleotide positions of 16S rRNA haplotypes, nucleotide and haplotype diversities in different populations of Hippocampus kuda. Hippocampus kuda, 16S rRNA 592 bp Haplotypes and Nucleotide Diversities Ha plot 3 4 5 5 Numbers of Number of Haplotype Nucleotide ype 5 1 9 9 Populations Haplotypes Sequences diversity (h) diversity (π) s 1 5 1 2 and Number H1 T C T C Palk Bay 6 2 (H1,H2) 0.59 0.003 H2 C . . . Gulf of Mannar 7 2 (H1,H2) 0.41 0.004 H3 . . C G Kerala Coast 12 2 (H3,H4) 0.38 0.004 H4 . T C G H5 . . . G Goa 5 1 (H5) 1.00 0.000 Overall 30 5 0.595 0.003 NBFGR
  • 18. Variable nucleotide positions of COI haplotypes, nucleotide and haplotype diversity in Hippocampus kuda 655 bp NBFGR
  • 19. Variable nucleotide positions of Cyt b haplotypes, nucleotide and haplotype diversity in Hippocampus kuda 704 bp Hippocampus kuda, Cyt bHa Haplotypes and Nucleotide Diversitiesplo 1 2 3 3 3 3 3 4 4 5 6 Number Haplotype Nucleotide Haplotypes andtyp 4 6 8 5 6 7 8 9 1 2 8 9 Populations of diversity diversity numberes 1 3 4 2 6 8 5 0 0 6 7 8 Sequences (h) (π)H1 A C T C C T A T C C G G 8 6 0.51 0.006H2 - - - - T - - - - T - - Palk Bay (H1,H2,H3,H4H3 - - - - T C - - - - - A ,H5,H6)H4 - - - - T - - C - - - A Gulf of 6 (H1,H2,H3,H4,H5 - - - - T - - - - - - A Mannar 6 0.59 0.005 H5,H6)H6 - - - - T - - - - - - -H7 G - C T T - G - T - A - Kerala coast 8 1(H7) 1.00 0.00H8 G T - - T - G - T - A - Goa 8 1(H8) 1.00 0.00 Overall 30 8 0.78 0.003 NBFGR
  • 20. Evolutionary relationship of H kuda population based on 16S rRNA, COI & Cyt b sequence data (Neighbor-Joining method) 65 H5 65 H4 46 H3 H2 H1 Fistularia petimba 0.02 3 Clusters 51 H1 High Boot strap 46 H2 97 H3 MP similar TREE H4 62 H5 H6 99 H7 84 H8 Fistularia petimba 0.05 H1 95 H2 H3 H4 H5 H6 H7 49 H8 Syngnathoides biaculeatus 0.12 0.10 0.08 0.06 0.04 0.02 0.00 NBFGRAbsence of common haplotype indicates the distinct genetic structure among four population
  • 21. Variable nucleotide positions of 16S rRNA haplotypes, nucleotideand haplotype diversity in Hippocampus trimaculatus 586 bp NBFGR
  • 22. Variable nucleotide positions of COI haplotypes, nucleotideand haplotype diversity in Hippocampus trimaculatus 655 bp Common Haplotype H5 NBFGR
  • 23. Variable nucleotide positions of Cyt b haplotypes, nucleotideand haplotype diversity in Hippocampus trimaculatus 677 bp NBFGR
  • 24. Evolutionary relationship of Hippocampus trimaculatus population NJ & MP Tree 16s 2 Clusters High Boot StrapCOI Cyt b Significant pair-wise comparison of ФST & AMOVA values indicates distinct genetic structure among east & west coast population NBFGR
  • 25. HIGH RESULATION ANALYSIS OF POPULATION STRUCTURE USING MICROSATELLITE MARKERS Development of single locus microsatellite primer through cross species sequences amplification • PCR Amplification • PAGE & Visualisation • Calculation of Molecular weight • Image Master ID Elite, Marker (pBR322 DNA / MspI digest) • Final Selection • Sequencing PCR • Automated Genotyping • Analysis of Microsatellites Data NBFGR
  • 26. Characteristics of 12 polymorphic microsatellite loci in H. kuda and H. trimaculatus3 Species- 15 Loci80% Polymorphic lociNumber of repeats varied5-6 Brown trout3-5 Northern Pike16-32 Red Seabream Clear discreet band …Not as Ladder NBFGR
  • 27. Observed number (na) of alleles for each population and overall populations Palk Gulf of Kerala Goa OverallLocus Bay Mannar Coast PopulationsHan03 5 5 4 4 6Han05 5 5 4 4 6Han06 3 3 4 4 5Han15 4 4 3 3 4Hca08 5 5 5 6 6Hca10 3 3 4 4 5Hca11 3 3 6 4 6 Range 3 – 6Hca25 5 5 4 4 5 Average 4Hca27 4 4 4 4 4Hca28 4 4 4 4 6Hca34 4 4 4 4 5Hca38 6 6 6 6 6Total 51 51 52 51 64Mean 4.2500 4.2500 4.3333 4.2500 5.334± S.D. 1.531 1.3093 1.2118 1.3025 0.9815 NBFGR
  • 28. Total 23 alleles No Gene Flow Genetic Tags Stock specific Markers Partitioning of Breeding PopulationNBFGR Limitation in Migration
  • 29. Observed and expected heterozygosity for each and overall population Populations (n=40 each) Locus Palk Bay Gulf of Mannar Kerala Coast Goa H obs. H exp. H obs. H exp. H obs. H exp. H obs. H exp. Han03 0.3571 0.3976 0.5310 0.5811 0.5501 0.5308 0.4502 0.4307 Han05 0.5943 0.5652 0.6927 0.6479 0.6571 0.6404 0.3344 0.2680 Han06 0.3336 0.3261 0.1731 0.1667 0.2571 0.2743 0.2663 0.2789 Han15 0.7098 0.6894 0.7857 0.7539 0.8037 0.7571 0.7571 0.7037 Hca08 0.5857 0.5291 0.4180 0.4168 0.4286 0.4221 0.3826 0.3322 Hca10 0.7429 0.6871 0.7387 0.7236 0.5014 0.5644 0.6017 0.6643 Hca11 0.6143 0.5949 0.1931 0.1867 0.6079 0.6068 0.6857 0.6539 Hca25 0.6271 0.6200 0.5857 0.5682 0.3714 0.3636 0.5271 0.5219 Hca27 0.6143 0.6949 0.4802 0.5674 0.6071 0.6698 0.6177 0.6000 Hca28 0.6143 0.5949 0.5802 0.5674 0.6171 0.6098 0.8718 0.8041 Hca34 0.6333 0.5987 0.4802 0.4674 0.6654 0.6598 0.3244 0.3077 Hca38 0.6283 0.6049 0.5802 0.5774 0.5555 0.5498 0.2148 0.2014 Mean Overall 0.5148 0.5067 0.6130 0.5996 0.5239 0.5019 0.3965 0.3871 LociNo significant association indicative of Linkage Disequilibriumbetween any pair of Loci for any population NBFGR
  • 30. Genetic identity (above diagonal) & Genetic distance (below diagonal)using microsatellite markers in Hippocampus kuda Populations Palk Bay Gulf of Mannar Kerala Coast Goa Palk Bay ---- 0.9998 0.8259 0.7885 Gulf of Mannar 0.0023 ---- 0.9003 0.8201 Kerala Coast 0.1764 0.1085 ---- 0.9137 Goa 0.2165 0.1813 0.0863 ---- Nei’s Genetic Identity Long Geographical Distances between population AMOVA indicated significant genetic differentiation (FST 0.6511; P<0.0001) Among population 65% Within Population 34.89% NBFGR
  • 31. Pair-wise Fisher’s FST (θ) (above diagonal) and RST (below diagonal)between populations of Hippocampus kuda using microsatellite markers. Populations Gulf of Palk Bay Kerala Coast Goa Mannar Palk Bay ---- 0.00230 NS 0.08881*** 0.10638*** Gulf of Mannar 0.00121NS ----- 0.08202*** 0.08990*** Kerala Coast 0.09915*** 0.08126*** ---- 0.06105*** Goa 0.11913*** 0.09740*** 0.06892*** ---- *** Significant after Bonferroni adjustment (P<0.0001) Pair wise RST values between population differ significantly except GofM & Palk Bay Pair wise & overall RST values were similar to FST NBFGR
  • 32. Observed number (na) of alleles for each population and overall populationsLocus Palk Bay Gulf of Mannar Kerala Coast Overall PopulationsHan03 6 (0.5333) 6 (0.4375) 6 (0.0123) 7Han05 5 5 5 6Han06 3 3 4 4Han15 4 4 3 4Hca08 4 4 5 5Hca10 3 3 4 5Hca11 3 3 3 4Hca25 5 5 5 5Hca27 4 4 4 4Hca28 5 5 5 5Hca34 4 4 4 (0.4895) 4Hca38 5 (0.0104) 5 (0.0095) 5 5Total 51 51 53 58Mean 4.2500 4.2500 4.4167 4.834± S.D. 1.1612 1.3564 1.2304 1.2493 Allele frequency NBFGR
  • 33. Total 11 Private Alleles No Mixing of Gene Pool * Stock- Specific markers * Genetic TAGs for selection programsNull allele frequency was not significant (P<.05) at all 3 tested Loci NBFGR
  • 34. Observed and expected heterozygosity for each and overall population Populations (n=40 each) Locus Palk Bay Gulf of Mannar Kerala Coast H obs. H exp. H obs. H exp. H obs. H exp. Han03 0.4352 0.4077 0.6524 0.6310 0.2378 0.2304 Han05 0.2439 0.2365 0.3100 0.2479 0.3826 0.3322 Han06 0.6309 0.6264 0.2735 0.2664 0.3984 0.4164 Han15 0.6378 0.6233 0.4861 0.4564 0.8069 0.7754 Hca08 0.5271 0.5219 0.4288 0.4100 0.4286 0.4221 Hca10 0.3298 0.3068 0.3391 0.3022 0.6079 0.6068 Hca11 0.6001 0.5978 0.4932 0.4865 0.6178 0.6644 Hca25 0.7234 0.7001 0.5857 0.5682 0.4432 0.4363 Hca27 0.6478 0.6233 0.5344 0.5199 0.5857 0.5491 Hca28 0.6667 0.7045 0.3398 0.3447 0.4358 0.4046 Hca34 0.6161 0.5911 0.5814 0.5696 0.4455 0.4641 Hca38 0.4081 0.4059 0.3826 0.3322 0.5718 0.5141 Mean Overall 0.4264 0.4067 0.5363 0.5451 0.4087 0.4032 Loci No significant association indicative of Linkage Disequilibrium between any pair of Loci for any population NBFGR
  • 35. Genetic identity (above diagonal) and Genetic distance (below diagonal)using microsatellite markers in Hippocampus trimaculatus Populations Palk Bay Gulf of Mannar Kerala Coast Palk Bay ---- 0.9972 0.8781 Gulf of Mannar 0.0019 ---- 0.8905 Kerala Coast 0.1302 0.1111 ---- AMOVA indicated significant genetic differentiation (FST 0.6353; P<0.0001) Among population 63.53% Within Population 36.47% NBFGR
  • 36. Pair-wise Fisher’s FST (θ) (above diagonal) and RST (below diagonal)between populations of Hippocampus trimaculatus using microsatellite markers. Populations Palk Bay Gulf of Mannar Kerala Coast Palk Bay ---- 0.00266 NS 0.09997*** Gulf of Mannar 0.00201NS ----- 0.09005*** Kerala Coast 0.10445*** 0.098734*** ---- *** Significant after Bonferroni adjustment (P<0.0001) Pair wise & overall RST values were similar to FST NBFGR
  • 37. Summary & conclusion‫ ٭‬Microsatellite genotyping and mitochondrial DNA sequence information have provided a clear evidence for the existence of strong population differentiation.‫ ٭‬Haplotype Diversity very high as compared to the Nucleotide diversity in both species.‫ ٭‬Distinct population of East & West coast / Reduced or No Gene flow.‫ ٭‬Along the west coast, two distinct populations of H. kuda indicate the absence of gene flow between Kerala and Goa localities.‫ ٭‬Lack of Sub-structuring of H.trimaculatus between Kerala & TN. Range expansion from India To Java.‫ ٭‬High Genetic diversity in South East India (PB & GOM) may be the result of long-term stable environment condition.‫ ٭‬Coastal cold-water upwelling events characteristics of western India (Genetic Bottleneck) can be reason for the presence of comparatively few Haplotypes.‫ ٭‬However, significant number of common/shared haplotypes and the non-significant FST value between two east coast populations of both the species suggests that some degree of gene flow exists between populations within these areas.‫ ٭‬All the classes of markers revealed high level of genetic variation in populations of this species as evinced from values of heterozygosity, Fst and genetic distance. The study points out the need for stock-specific, propagation assisted rehabilitation programme for this species. NBFGR
  • 38. NBFGR
  • 39. NBFGR
  • 40. NBFGR X-Agricultural Science Congress 2011
  • 41. NBFGR Annual Report 2007 - 2008NBFGR News July – December 2008 Genetic Diversity analysis in Indian seahorse, P 35-36Molecular Genetic divergence studies in Indianseahorse NBFGR
  • 42. NBFGR
  • 43. Thanks The Improbable seahorses,National Geography 1994NBFGR