PCR Primer desining
Upcoming SlideShare
Loading in...5
×
 

PCR Primer desining

on

  • 3,752 views

Primer desing tutorial,primer cane be desinged using web sources,details properties of PCR primers etc

Primer desing tutorial,primer cane be desinged using web sources,details properties of PCR primers etc

Statistics

Views

Total Views
3,752
Views on SlideShare
3,752
Embed Views
0

Actions

Likes
0
Downloads
70
Comments
1

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
  • I read your article on primer design.Its good and i think it going to be very helpful for the designers.I'll look forward to it.
    http://store.fluoresentric.com
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

PCR Primer desining PCR Primer desining Presentation Transcript

  • PCR & Primer DesigningKaran Veer Singh NBFGR
  • What is a primer? A primer is a short synthetic oligonucleotide which is used in many molecular techniques. These primers are designed to have a sequence which is the reverse compliment a region of template or target DNA to which we wish the primer to anneal. 3’ 5’ TGACCTGAAAAGAC Primer GATGGACTGATTACCGATGACTGGACTTTTCTG Template 5’ 3’ 3’ 5’ TGACCTGAAAAGAC :: ::: : : : : : : : : GATGGACTGATTACCGATGACTGGACTTTTCTG Annealing 5’ 3’ 05/15/12 NBFGR karan veer singh
  • 05/15/12 NBFGR karan veer singh
  • Diagram for PCR PrimerDesign Sequence from which to choose primers Results of search, PCR reaction including suggested parameters Primer annealing temperatures Design shown in list Primer Selection RulesPrimer design is an art when done by human beings, and a farbetter done by machines. machines
  • Primer Design Criteria• Primer uniqueness• Primer length• Melting temperature• GC content range• 3-clamp properties (terminal residue,CG-content)• Avoid hairpins in primers• Length of amplified region• Avoid primer-primer interaction• Melting temperature compatability 05/15/12 NBFGR karan veer singh
  • A simple set of rules for primer sequence design is as follows‫٭‬Primers should be 17-28 bases in length;¼ chance (4ˉ¹) of finding an A, G, C or T in any given DNA sequence;1/16 chance (4ˉ²) of finding any dinucleotide sequence (eg. AG);1/256 chance of finding a given 4-base sequence.Thus, a sixteen base sequence will statistically be present only once in every4¹6 bases (=4 294 967 296, or 4 billion) about the size of the human or maizegenome 05/15/12 NBFGR karan veer singh
  • ‫٭‬Base composition should be 50-60% (G+C); ‫٭‬Primers should end (3) in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming; ‫٭‬Tms between 55-80ºC are preferred; Tm = 4(G + C) + 2(A + T) ºC.05/15/12 NBFGR karan veer singh
  • Common problems in primer design‫٭‬Runs of three or more Cs or Gs at the 3-ends of primersmay promote mispriming at G or C-rich sequences (becauseof stability of annealing), and should be avoided;‫-3٭‬ends of primers should not be complementary‫٭‬Primer self-complementarity (ability to form 2º structuressuch as hairpins) should be avoided. 05/15/12 NBFGR karan veer singh
  • 05/15/12 NBFGR karan veer singh
  • Hairpin formation 05/15/12 NBFGR karan veer singh
  • 05/15/12 NBFGR karan veer singh
  • When is a “PRIMER” a Primer? 05/15/12 NBFGR karan veer singh
  • Designing Degenerative Oligonucleotide  A group of degenerate oligonucleotides contain related sequences with differences at specific locations.  One common use of degenerative oligonucletides is when the amino acid sequences of a protein is known. One can reverse translate this sequence to determine all of the possible nucleotide sequences that could encode that amino acid sequence. A set of degenerate oligonucleotides would then be produce matching those DNA sequences . http:// cvmbs.colostate.edu/molkit/rtranslate/ AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA C G C CT CAGC C C T C C C G A A A A A G G G G G 05/15/12 NBFGR karan veer singh
  • Related Bioinformatics Programs: ‫٭‬Primer3 http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi ‫٭‬Web Primer http://seq.yeastgenome.org/cgi-bin/web-primer ‫٭‬Gene Fisher (http://bibiserv.techfak.uni-bielefeld.de/genefisher/) ‫٭‬GeneWalker (http://www.cybergene.se/primerdesign/) ‫٭‬CODEHOP (http://www.blocks.fhcrc.org/codehop.html) ‫٭‬Net Primer (http://www.premierbiosoft.com/netprimer/netprlaunch/netprlaunch.html ) …….and many others 05/15/12 NBFGR karan veer singh
  • PCR Mastermix Box Titration Calculator- http://www.attotron.com/pub/pcrtitr.htmPCR Optimization Program Helper –http://www.molbiol.ru/eng/scripts/01_14.html‫٭‬MGH-PGA Proteomic Tools PCR Primer design forpeptide sequences‫٭‬Oligo Calculator -- to calculate Tm, GC%, etc for agiven oligo. 05/15/12 NBFGR karan veer singh
  • Primer Bankhttp://pga.mgh.harvard.edu/primerbank/index.htmlPCR Primers for Gene Expression Detection and Quantification 05/15/12 NBFGR karan veer singh
  • Other Primer Databases: RTPrimerDB - Real Time PCR Primer and Probe Database (submitted by researchers). Real Time PCR Primer Sets Real time PCR primers (submitted by researchers). The Quantitative PCR Primer Database (QPPD) provides information about primers and probes that can be used for human and mouse real time RT–PCR assays (published articles) IMGT/PRIMER-DB, the IMGT database for primers of the immunoglobulins (IG), T cell receptors (TR) and related proteins of the immune system (RPI). 05/15/12 NBFGR karan veer singh
  • Components Volume Per Concentration sample reactionDDW 38.8 µl -Buffer 5.00 µl 1XdNTP’s 1.00 µl (0.25 µl 200 μM each each)Primer F 0.04 µl 5-10 p molesPrimer R 0.04 µl 5-10 p molesMgCl2 2.00 µl -Taq Polymerase 0.04 µl 1.5 UTotal Volume 48.00 µl - 05/15/12 NBFGR karan veer singh
  • Buffer: 1X, usually comes as 10X stock. For 25µL reactions, this means 2.5µL. 05/15/12 NBFGR karan veer singh
  • dNTP’s: •a 2mM stock of dNTPs means that the final concentration of EACH dNTP (dATP, dCTP, dGTP, and dTTP) is 2mM -- NOT that all dNTPs together make 2mM. •dNTPs come as 100mM stocks -- thaw and add 10µL of each dNTP to 460µL of ddH20 to make 2mM. Store at -20°C. 05/15/12 NBFGR karan veer singh
  • Primers:A good place to start with primerconcentration is 50pmol of each primerper reaction.If you don’t get your desired product, youcan increase to 75pmol or 100pmol. Thisusually does the trick. 05/15/12 NBFGR karan veer singh
  • MgCl2 Concentration. •Mg2+ ions form complexes with dNTPs, primers and DNA templates, the optimal concentration of MgCl2 has to be selected for each experiment. Too few Mg2+ ions result in a low yield of PCR product, and too many increase the yield of non-specific products and promote misincorporation. Lower Mg2+ concentrations are desirable when fidelity of DNA synthesis is critical. 05/15/12 NBFGR karan veer singh
  • Taq DNA Polymerase:Usually 1-1.5u of Taq DNA Polymerase are used in 50µl ofreaction mix. Higher Taq DNA Polymerase concentrationsmay cause synthesis of nonspecific products.However, if inhibitors are present in the reaction mix (e.g., ifthe template DNA used is not highly purified), higheramounts of Taq DNA Polymerase (2-3u) may be necessary toobtain a better yield of amplification products. 05/15/12 NBFGR karan veer singh
  • Template: It’s not usually necessary to be incredibly fastidious about how much template you add to a reaction. You can get product with incredibly small amounts of starting DNA. 05/15/12 NBFGR karan veer singh
  • Steps Temperature (°C) Time CycleInitial denaturation 950 120 sec 1 CycleDenaturation 940 30 secAnnealing 540 30 sec 35 CycleExtension 720 60 secElongated extended 720 600 sec 1 cycle Storage 40 Forever - 05/15/12 NBFGR karan veer singh