2009 11 09 UCLA Bioinformatics Talk

Blasting mold with the data ﬁrehose: Comparative and evolutionary genomics of ﬁlamentous fungi with next generation sequencing. Jason Stajich Plant Pathology and Microbiology University of California, Riverside

Blasting mold with the data ﬁrehose: Comparative and evolutionary genomics of ﬁlamentous fungi with next generation sequencing. second Jason Stajich Plant Pathology and Microbiology University of California, Riverside

Fungi have diverse forms, ecology, and associations Cryptococcus neoformans X. Lin Coprinopsis cinerea Ellison & Stajich Aspergillus niger. N Read Glomus sp. Univ Sydney Rozella allomycis. James et al Puccinia graminis J. F. Hennen Batrachochytrium dendrobatidis Laccaria bicolor Martin et al. Neurospora crassa. Hickey & Reed Phycomyces blakesleansus T. Ootaki J. Longcore Ustilago maydis Kai Hirdes Amanita phalloides. M Wood Xanthoria elegans. Botany POtD Rhizopus stolonifera. Blastocadiela simplex Stajich & Taylor

<:,./,7 40(78(6(, 31(,.(6(, $7/,6(, $%&'()*('%+%, ,-./$ !"#$%%& 312/'%+%(02&(/, C:,)/(&:,+%(02&(/, $=:/%&7::=:,'FI%/1F $=&('(02&(/%., +%GG7'7./%,/7+F/%))=7) -./(0(*1/1('(02&(/%., >((*,5(02&(/%., E())F(GFG:,57::=0 ?%&@A7::(02&(/%., ;:(07'(02&(/, $%/(/%&F)*(',.5%, <=&&%.%(02&(/%., !"#$%$&'()&*" /(F0%/(/%&F&(.%+%,F 9)/%:,5%.(02&(/%., H75=:,'F)7*/, 45,'%&(02&(/%., D,*1'%.(02&(/%., +#)&'()&*" $7%(/%&F)*(',.5%,F/(F B,&&1,'(02&(/%., 7A/7'.,:F07%()*('7) <76%6(02&(/%., !"## !### "## # Stajich et al, Current Biology, 2009 $%::%(.)F(GF27,')

Genome samples from fungi Dictyostelium Monosiga Choanoflagellida Caenorhabditis Metazoa Drosophila Homo Batrachochytrium ‘Chytrid’ Chytrid 5 Spiromyces Zygomycota Opisthokont ‘Chytrid’ Olpidium Rhizopus Mucormycotina Muromycotina 3 Fungi Glomus Glomeromycota Glomeromycota (1) Puccinia Cryptococcus Basidiomycota Basidiomycota >30 Coprinopsis Schizosaccharomyces Taphrinomycotina Taphrinomycotina 4 Yarrowia Saccharomyces Saccharomycotina Saccharomycotina > 20 Ascomycota Candida Morchella Cochliobolus Cladonia Pezizomycotina Aspergillus Coccidioides Magnaporthe Pezizomycotina >60 100+ Genomes Neurospora Fusarium Tree Based on James TY et al. 2006. Botryotinia Nature. http://fungalgenomes.org/wiki/Fungal_Genome_Links

Gradschool xkcd.org

Tools for comparative genomics • Need organized data - databases with integrated information and capability to grow and add additional species or experiments • Community interactive resources - Web-based often the best mix of interactive and easily available • Genome Browsers to see genomic context information, important for visualizing high density data like 2nd-generation sequencing (RNA-Seq, ChIP-Seq) • Summaries of Analyses -- “Gene Pages” with detailed information for each locus • Other things that are needed: Community annotation and collection of information to make sense of these comparisons • Repository of annotations and comparative analyses: synteny, orthologs, gene families

Genome Browser data integration - Gbrowse Ncra_OR74A_chrIV_contig7.20 300k 310k 320k 330k DNA_GCContent % gc NCBI genes (Broad called) NCU04433 NCU04430 NCU04426 sulfate permease II CYS-14 related to aminopeptidase Y precursor; vacuolar related to cyclin-supressing protein kinase NCU04432 NCU04429 NCU04425 hypothetical protein conserved hypothetical protein putative protein NCU04431 NCU04428 NCU04424 related to endo-1; 3-beta-glucanase related to spindle assembly checkpoint protein related to regulator of chromatin NCU04427 conserved hypothetical protein PASA updated NCBI/Broad genes NCU04433 NCU04432 [pasa:asmbl_9429,status:12],[pasa:asmbl_9430,status:12] [pasa:asmbl_9440,status:12],[pasa:asmbl_9441,status:12],[pasa:asmbl_9442,status:12] [pasa:asmbl_9431,status:12],[pasa:asmbl_9432,status:12] [pasa:asmbl_9443,status:12],[pasa:asmbl_9444,status:12] [pasa:asmbl_9433,status:12],[pasa:asmbl_9434,status:12],[pasa:asmbl_9435,status:12] [pasa:asmbl_9436,status:12],[pasa:asmbl_9437,status:12],[pasa:asmbl_9438,status:12],[pasa:asmbl_9439,statu [pasa:asmbl_9445,status:12],[pasa:asmbl_9446,status:12 NCU04424 Named Genes (Radford laboratory) cys-14 gh16-3 tRNA{phe}-9 miRNA Solexa histogram miRNA K4dime ChIP-Seq histogram (SOAP) K4dime_Solexa Stajich et al, unpublished K9met3 ChIP-Seq histogram (SOAP) Smith, Freitag, et al unpublished K9met3

fungalgenomes.org/genomes

Fungal evolution at different time scales • Deep divergences of fungi • How did multicellular fungi evolve? What molecular changes allowed the transition from aquatic to terrestrial life in fungi? • Closer comparisons • What are lineage speciﬁc changes that inﬂuenced evolution of animal and plant pathogenic fungi? How are

Coccidioides evolution • Can your genome can tell where you live, who you meet, and what you eat?

Human pathogen Coccidioides • Coccidioides (Valley fever) • Is a primary human pathogen - infects healthy people - most human pathogenic fungi are opportunistic. • Endemic in US Southwest, Mexico • Requires laboratory BSL3 and is a Select Agent • Difﬁcult to reliably collect from nature. Comparative analyses of Coccidoides spp to learn more about dispersal. • Can we identify potential pathogenicity genes based on molecular signatures?

Human pathogen Coccidioides Development S/ Hypha Spherule Endospores

Coccidioides life cycle Short Life Granuloma D octorfungus. com M. McGinnis Spherule Endospores Long Life

<:,./,7 40(78(6(, 31(,.(6(, $7/,6(, $%&'()*('%+%, ,-./$ !"#$%%& 312/'%+%(02&(/, C:,)/(&:,+%(02&(/, $=:/%&7::=:,'FI%/1F $=&('(02&(/%., +%GG7'7./%,/7+F/%))=7) -./(0(*1/1('(02&(/%., >((*,5(02&(/%., E())F(GFG:,57::=0 ?%&@A7::(02&(/%., ;:(07'(02&(/, $%/(/%&F)*(',.5%, <=&&%.%(02&(/%., !"#$%$&'()&*" /(F0%/(/%&F&(.%+%,F 9)/%:,5%.(02&(/%., H75=:,'F)7*/, 45,'%&(02&(/%., D,*1'%.(02&(/%., +#)&'()&*" $7%(/%&F)*(',.5%,F/(F B,&&1,'(02&(/%., 7A/7'.,:F07%()*('7) <76%6(02&(/%., !"## !### "## # $%::%(.)F(GF27,')

Aspergillus clavatus Aspergillus fumigatus Aspergillus flavus Animal Pathogen Aspergillus oryzae (Opportunistic) Aspergillus terreus Eurotiales Aspergillus niger Animal Pathogen Aspergillus nidulans (Primary) Penicillium marneffei Eurotiomycetes Blastomyces dermatitidis Plant Pathogen Histoplasma capsulatum 186AR Histoplasma capsulatum 217B Histoplasma capsulatum WU24 Paracoccidioides brasiliensis Onygenales Coccidioides immitis Coccidioides posadasii Uncinocarpus reesii Fusarium graminearum Sclerotinia sclerotiorum 200 100 0 Mya

Population Genomics • 20 strains sequenced, 10 from each spp. 13 via Sanger sequencing, 7 via Solexa/Illumina resequencing • 680 000 ﬁltered SNPs across genomes (~28Mb genome). • What can we learn from these data? • Hybridization and Migration inferred from population statistics (FST) • (Effective) population size (Ne) • Testing for selective sweeps in region of the genome

Two species of Coccidioides C.immitis C.posadasii EVOLUTION Fisher et al, 2000

Chrom I • FST: 1 is complete separation, 0 is no separation • Applied to whole genome can estimate when regions diverged and if there has been recent hybridization (migration of alleles). Neafsey, Barker, et al. In prep FST across the chromosomes (CU Evidence for hybridization between Ci and Cp

Ci Cp Fig. 1. Neighbor-joining tree of pairwise allele-sharing genetic distances calculated with the program MICROSAT. Tree construction was performed in the PHYLIP package (36). The isolate marked with an asterisk signiﬁes a patient who was diagnosed in Texas but was subsequently found to ha infection in California (42). The tree is mid-point rooted, and the scale bar signiﬁes 0.1 changes. CA, Californian; non-CA, non-Californian. DYE terminators (Applied Biosystems) were used with the that isolates occur within one of two major clad following primer combinations: deoxygenase, DO7 GAGAA- studies of multilocus gene genealogies have resu GATCCTCGGATTCCA, DO10 GCCCTGAAGTTGCCCGC; clades being recognized as the CA and non-CA serine proteinase, SP3 CCAGGCACCGACAAGCAGTA, SP6 species (23, 26). We have previously estimated TAGCGTGTCCACCTTCATCG; and chitinase, CT31 CTC- genetic isolation between these two groups as 12.8 CAAACTCTTGTCCAGGC, CT4 TCAGCGAATTTCTTC- (SEM 8.0 million years; refs. 18 and 23). Fig. 1 sh CTGCC. The sequences were aligned with the CLUSTAL V and non-CA are largely allopatric, except in southe sequence alignment algorithm (24). Distance analyses were and Mexico where regions of sympatry occur. Wi performed by neighbor-joining in PAUP* 4.0b2a (25). Because of non-CA, there is a strong tendency for isolate the closely related nature of these sequences, correcting for according to where they were isolated, showing th multiple hits was not necessary and an uncorrected p distance ically distinct populations occur. The deepest diver measure used. Stability of the individual branches was assessed CA clade corresponds to a geographical division by 1,000 bootstrap replicates of the data. Central Valley and the rest of southern California, d the Tehachapi mountain range. Here, ( )2 is Results greater than zero, demonstrating that genetic drift North American Microsatellite Diversity. Allele distributions at the between these populations. A similar pattern of di nine microsatellite loci were sampled from eight geographical is seen for the non-CA species. Arizona isolates populations. From this data set of 1,424 alleles, DAS was used to pendently from Mexico, and South American isolate group isolates phylogenetically (Fig. 1). The resulting tree shows those from Texas in a subclade, as had been prev Fisher et al. PNAS April 10, 2001 vol. 98 Ne of 2.25 x 106 in C. immitis and 4.82 x 106 in C. posadasii - Cp has 2.15- Effective Population Size fold larger effective population size. Neafsey, Barker, et al. In prep

Coccidioides population genomics • C. immitis is endemic to Central and Southern California, mountain ranges likely block its migration into Arizona. • Smaller effective population size consistent with smaller geographic range or perhaps the ﬁssion of the population due to introduced geographic barrier. • There is evidence of inter-species hybridization events (introgression) and bidirectional exchange of alleles. • Some evidence for selective sweeps as well based on populations, ongoing work to verify and validate these observations.

Evolution of a pathogen • Comparing sequences from two Coccidioides species, closely related outgroup, and many related species. • Are there genes with signatures of positive selection that may distinguish pathogen from non-pathogen? • Are there differences in presence-absence of genes or sizes of gene families that suggest differences in pathogen?

Blastomyces dermatitidis Histoplasma capsulatum 186AR Histoplasma capsulatum 217B Histoplasma capsulatum WU24 Paracoccidioides brasiliensis Coccidioides immitis dN/dS Coccidioides posadasii Relative Protein Uncinocarpus reesii Rates Fusarium graminearum Sclerotinia sclerotiorum 200 100 0 Mya

Gene family changes • Another mechanism for adaptation may be changes in copy number of a gene family • Gene duplication is a source of novelty allowing for changes in the function of one copy if the other maintains original function • Expansions of copy number may also be an easy way to get more protein for a particular process • How important is copy number change in adaptation?

Aspergillus clavatus Aspergillus fumigatus Aspergillus flavus Animal Pathogen Aspergillus oryzae (Opportunistic) Aspergillus terreus Eurotiales Aspergillus niger Animal Pathogen Aspergillus nidulans (Primary) Penicillium marneffei Eurotiomycetes Blastomyces dermatitidis Plant Pathogen Histoplasma capsulatum 186AR Histoplasma capsulatum 217B Histoplasma capsulatum WU24 Paracoccidioides brasiliensis Onygenales Coccidioides immitis Coccidioides posadasii Uncinocarpus reesii Fusarium graminearum Sclerotinia sclerotiorum 200 100 0 Mya

Animal Pathogen Coccidioides expansions (Opportunistic) Peptidase_M35 Peptidase_M36 Peptidase_S8 Pec_lyase_C Subtilisin_N Cellulase Cutinase Tannase CBM_1 Animal Pathogen NPP1 APH (Primary) Anid 6 6 6 2 4 13 2 3 3 0 9 Plant Pathogen Afum 17 5 5 2 5 10 2 5 2 1 9 Ater 15 6 6 2 8 13 2 6 2 1 29 Hcap 0 0 0 0 2 2 2 6 1 0 20 Uree 0 0 0 0 1 2 15 19 4 2 33 Cimm 0 0 0 0 1 1 13 16 7 2 38 Cpos 0 0 0 0 1 1 14 16 7 2 32 Ncra 18 1 1 4 3 6 3 6 2 0 6 Fgra 12 7 9 9 12 8 11 24 1 1 15 Sharpton, Stajich, et al, Genome Res. 2009

Keratinases in Onygenales SignalP Subtilisin_N • Onygenales are Keratinophilic • Domains: Peptidase S8, Subtilisin domains • Large expansion of putative keratinases in Onygenales

Peptidase S8 expansion I in Onygenales 14 copies in Coccidioides 1 in Histoplasma II III

Onygenales contractions Animal Pathogen Loss of plant Peptidase_M35 Peptidase_M36 (Opportunistic) Peptidase_S8 Pec_lyase_C Subtilisin_N saprophytic Cellulase Cutinase Tannase CBM_1 NPP1 enzymes APH Animal Pathogen (Primary) Anid 6 6 6 2 4 13 2 3 3 0 9 Plant Pathogen Afum 17 5 5 2 5 10 2 5 2 1 9 Ater 15 6 6 2 8 13 2 6 2 1 29 Hcap 0 0 0 0 2 2 2 6 1 0 20 Uree 0 0 0 0 1 2 15 19 4 2 33 Cimm 0 0 0 0 1 1 13 16 7 2 38 Cpos 0 0 0 0 1 1 14 16 7 2 32 Ncra 18 1 1 4 3 6 3 6 2 0 6 Sharpton, Stajich, et al, Genome Fgra 12 7 9 9 12 8 11 24 1 1 15 Res. 2009

Towards identifying genes underlying adaptation

Towards identifying genes underlying adaptation • Coccidioides is found in desert soil and associated with animals - long term animal association

Towards identifying genes underlying adaptation • Coccidioides is found in desert soil and associated with animals - long term animal association • Genes under positive selection may play a role Cocci-speciﬁc developmental stages (Spherule and Endospore) and some (as of yet) unknown processes

Towards identifying genes underlying adaptation • Coccidioides is found in desert soil and associated with animals - long term animal association • Genes under positive selection may play a role Cocci-speciﬁc developmental stages (Spherule and Endospore) and some (as of yet) unknown processes • Loss of genes involved in plant product metabolism suggests nutritional shift in Onygenales from relatives in Eurotiales

Towards identifying genes underlying adaptation • Coccidioides is found in desert soil and associated with animals - long term animal association • Genes under positive selection may play a role Cocci-speciﬁc developmental stages (Spherule and Endospore) and some (as of yet) unknown processes • Loss of genes involved in plant product metabolism suggests nutritional shift in Onygenales from relatives in Eurotiales • Expansion of a few gene families, may be involved in metabolism - none are Coccidioides speciﬁc though.

Towards identifying genes underlying adaptation • Coccidioides is found in desert soil and associated with animals - long term animal association • Genes under positive selection may play a role Cocci-speciﬁc developmental stages (Spherule and Endospore) and some (as of yet) unknown processes • Loss of genes involved in plant product metabolism suggests nutritional shift in Onygenales from relatives in Eurotiales • Expansion of a few gene families, may be involved in metabolism - none are Coccidioides speciﬁc though. • Sampling of a closer non-pathogenic outgroup can help polarize recent changes. Expression analyses may help assign function to some of genes with positive selection signatures

Neurospora genomics • Improving the annotation and identiﬁcation of functional elements with NGS • Transcriptional proﬁling and describing the transcriptome

CV10 Papua New Guinea CV80 Gabon CV56 Haiti CV57 Haiti N. sitophila CV98 Indonesia CV93 Mexico CV88 Hawaii CV82 Gabon CV43 Truk D123 Nigeria 0.89 D72 Ivory Coast D147 New Mexico 86 D10 Karnataka D53 Thailand D124 Virginia 1.00 D63 Haiti CV79 Gabon 89 D78 Congo N. perkinsi (PS3) D77 Congo D74 Congo D82 Congo D75 Congo D100 Tamil Nadu D106 Tamil Nadu D103 Tamil Nadu D105 Tamil Nadu D107 Tamil Nadu D42 Tamil Nadu D99 Tamil Nadu D98 Tamil Nadu D11 Karnataka D12 Karnataka D70 Ivory Coast 1.00 D110 Louisiana D114 Louisiana 68 D117 Louisiana D115 Louisiana D144 Panama D60 Haiti D24 Florida D94 Yucatan D61 Haiti N. crassa D69 Ivory Coast D111 Louisiana D112 Louisiana D118 Louisiana D119 Louisiana D116 Louisiana D143 Louisiana D19 Florida D30 Florida D23 Florida D59 Haiti D29 Florida D90 Yucatan D88 Yucatan D62 Haiti D85 Yucatan D56 Haiti D27 Florida D28 Florida D140 Ivory Coast D91 Yucatan D96 Ivory Coast D113 Louisiana 1.00 D68 Ivory Coast N. tetrasperma D13 Louisiana 91 D14 Hawaii D15 Hawaii 1.00 D145 Unknown CV55 Haiti N. hispaniola (PS1) 89 D55 Haiti D57 Haiti D58 Haiti CV119 Haiti CV156 Mexico CV152 Mexico CV155 Mexico CV91 Mexico CV89 Mexico CV148 Mexico N. metzenbergi (PS2) CV90 Mexico CV153 Mexico CV154 Mexico 1.00 D86 Yucatan D89 Yucatan 96 D93 Yucatan D92 Yucatan D87 Yucatan D120 Madagascar D121 Madagascar D1 Taiwan D2 Taiwan D3 Philippines D102 Thailand D18 Queensland D4 Philippines D31 Anhui D6 Taiwan D8 Java D80 Congo D9 Java D33 Papua New Guinea D84 Hawaii D101 Tamil Nadu D50 Tamil Nadu D45 Tamil Nadu D38 Tamil Nadu D129 Karnataka D132 Karnataka D135 Karnataka D44 Tamil Nadu D46 Tamil Nadu D48 Tamil Nadu D49 Tamil Nadu D47 Tamil Nadu D134 Karnataka D137 Karnataka D139 Karnataka D128 Karnataka N. intermedia D122 Honduras D22 Florida 1.00 D64 Haiti D21 Florida 84 D25 Florida D26 Florida D65 Ivory Coast D73 Ivory Coast D66 Ivory Coast D141 Liberia D16 Texas D142 Fiji D7 Java D95 Ivory Coast D83 Gabon D76 Congo D79 Congo D81 Congo D34 Papua New Guinea D51 Malaysia D52 Thailand D127 Karnataka D130 Karnataka D97 Tamil Nadu D131 Karnataka D41 Tamil Nadu D43 Tamil Nadu D126 Karnataka D136 Karnataka D125 Karnataka D108 Tamil Nadu D40 Tamil Nadu D109 Tamil Nadu D39 Tamil Nadu D133 Karnataka Villalta et al, Mycologia 2009 D32 Anhui D35 Papua New Guinea D36 Tahiti D146 New Mexico D71 Ivory Coast 1.00 D37 Karnataka N. discreta D54 Thailand 96 D5 Papua New Guinea D67 Ivory Coast Dettman et al, Evolution 2003 D17 Texas 5 changes D20 Florida Neurospora as a model for Phylogenetic and Biological species evolutionary biology tests

Updated annotation using ESTs 5'UTR 5,311 genes 3'UTR 55%66732(8 !"#$%&'()*%"+#,%"-./01(23 66732A8 66732N8 667)8 667)268 667)278 667)238 667)2)8 667)298 667)2@8 667)2(8 667)2A8 667)2N8 66798 6,275 MF1" =$!B>CC(?:%?: A@M genes 6)M 65% $CGF#H%?%)#3G'(+9#<+""%9; !:;<7633 5B4C#-D0ECFE05=B/$5CFG:BHI.JFK&LH6 2!-!#&*9+:%9#$CGFIG'(+9#H%?%) $+/%9#>%?%)#3@+9A('9#"+0('+:('1; 5-EH6 2D+):C(?)#3:'+?)<'E*:7F?:'(?; 4+$5/"-.5 6 <29 < !""#$%&'()*('+#,-.)#!))%/0"1#2!-!#34556758754#&*9+:%;#<=$! $5=>?%6@7A

Alternative splicing ~80 candidates loci with exon skipping or alternative inclusion from the ESTs (PASA) *+,-./0.-123-1//12456718+29-.,02:; !"#$%$$ !"#$#$$ !"#!$$$ !"#!!$$ !"#!'$$ !"#!&$$ !"#!E$$ !"#!"$$ !"#!($$ !"#!<$$ 5!( )F83 #') '$) !"#$%&' *BC$""'' ())$!*+,-'.-,/$012'$3(1($45!( 1/=>?2!&##' 1/=>?2!&##& 6*7*8/,9:3(1($+.&/;*& G01/1H1/=>?2!&##'I/A1A,/H!&J 3</';"-7'$=;,/7'4,>.;?%7;,-7@ 0@1/A3.6/ ! $D" $

%1234+543*/63*++*/789$*:1/;3425/<< Overlapping Genes !"!)$ !"!>$ !"!#$ !"!?$ !"!"$ A#$ AB:6 ")A I"A #5=0;3% %&'(#"() %&'(#"(@ $>>0#'1+6%26+*0?/@%0.$/$08A#$ *+,-./)0)) *+,-./)0)> *+,-./)0)? *+,-./)0)# &'(')*+,-.$/$0123*!'3 C5*+*D*+,-./)0))E+F*F2+D!@GEC5*+*D*+,-./)0)>E+F*F2+D!IG C5*+*D*+,-./)0)#E+F*F2+D!@GEC5*+*D*+,-./)0)?E+F*F2+D!@G !"#$% .4*%!56(%07!+*(%8+92!:;(!+6(< 5H*+F649+ ! (=> ( ~200 convergently transcribed genes overlap, mostly in 3' UTR

Next generation sequencing in Neurospora crassa • Solexa/Illumina libraries of 35-45 bp read length, 8-12 M reads per library • RNA-Seq from hyphal tip (Hall, Glass, Kasuga) and a cross (C. Ellison) - ongoing project from R. Brem, J. Taylor, NL Glass to generate~100 RNA-Seq in N.crassa • Small RNA-Seq from a pooled library of cross, vegetative growth • ChIP-Seq from methylated (meDIP), Histone H3K4 & H3K9 methylation, and centromeric proteins (CenPC, CenH3) (K.Smith & M. Freitag)

RNASeq support for exons !"#$%&'()*%"+#,%"-./01(23 66732(8 66732A8 66732N8 667)8 667)268 667)278 667)238 667)2)8 667)298 667)2@8 667)2(8 667)2A8 667)2N8 66798 =$!B>CC(?:%?: MF1" A@M 6)M $CGF#H%?%)#3G'(+9#<+""%9; !:;<7633 5B4C#-D0ECFE05=B/$5CFG:BHI.JFK&LH6 2!-!#&*9+:%9#$CGFIG'(+9#H%?%) $+/%9#>%?%)#3@+9A('9#"+0('+:('1; 5-EH6 )/+""@$!-%J 3< 69 < 2D+):C(?)#3:'+?)<'E*:7F?:'(?; 4+$5/"-.5 6 <29 < !""#$%&'()*('+#,-.)#!))%/0"1#2!-!#34556758754#&*9+:%;#<=$! $5=>?%6@7A @$!7-%J#K1*D+"#.E*#3-L!2; '!*KCO 3< 69 < Exon support

A GG G small RNA Sequencing C G Map to A C GG A T A T Genome GT GC A T Extract C A G Ncra_OR74A_chrV_contig7.11 A CG 595.4k 595.5k 595.6k 595.7k 595.8k 595.9k 596k 596.1k 596.2k 596.3k DNA_GCContent A T % gc 99% G T RNA 19% NCBI genes (Broad called) GC NCU03749 A T ~5M 36bp probable hydroxyacylglutathione hydrolase PASA updated NCBI/Broad genes [pasa:asmbl_11557,status:12] A T C Named Genes (Radford laboratory) A GG miRNA Solexa histogram A miRNA 50 C A sequences 25 T G miRNA predictions 0 T A "sRNAwindow sRNAClus128021_w4; StemLength 57" T A 1. Look for highly N.crassa PASA cDNA T A Solexa (Illumina) asmbl_4339 GC CG GC expressed CG Sequencing GC A A C A G T Identify conserved CG RNA ladder T A T G T GC secondary structure CG G T 30 CG T A 26 >n_crassa G T 22 CACGUGGGAUCGGGCACCCAUAAAGGGUCCGGACCCCCCGUCGUGGGCCAAAGCGGGGAACG T G T A 18 (((((((..((((((.((......)))))))).))((((((..((...))..)))))).))) CG >n_tetrasperma_2508 CG T 14 CACGUGGGAUCGGGCACCCAUAAAGGGUCCGGACCCCCCGUCGUGGGCCAAAGCGGGGAACG A T (((((((..((((((.((......)))))))).))((((((..((...))..)))))).))) GC TG >n_discreta_8579 C CACGUGGGAUCGGGCGCCCAAAAAAGGUCCGGGUCCCCCGUCGUGGGCCAAAGCGGGGAACG T G T G C RNA cloning ((((.((((..((....)).....((.((((.((.((((((..((...))..)))))).)). A T >consensus A T T G CACGUGGGAUCGGGCACCCAUAAAGGGUCCGGACCCCCCGUCGUGGGCCAAAGCGGGGAACG CG protocol ((((.(((.((.((.((((.....)))))).))..)))...))))...((..((((.(.((( T C A G G

mRNASeq coverage of gene regions mRNASeq Coverage 1 mRNASeq Coverage 2 mRNASeq Coverage 5 mRNASeq Coverage 10 90% 68% bases 45% 23% 0% 5'UTR CDS 3'UTR NONE Coverage stringency

mRNASeq coverage of gene regions mRNASeq Coverage 1 mRNASeq Coverage 2 mRNASeq Coverage 5 mRNASeq Coverage 10 90% 4.15 68% % 1.6 bases 45% Mb 23% 0% 5'UTR CDS 3'UTR NONE Coverage stringency

SmallRNA seq also covers lots of genic regions smallRNA-Seq Coverage 1 smallRNA-Seq Coverage 2 mRNASeq Coverage 1 mRNASeq Coverage 2 90% 68% bases 45% 23% 0% 5'UTR CDS 3'UTR NONE

SmallRNA seq also covers lots of genic regions smallRNA-Seq Coverage 1 smallRNA-Seq Coverage 2 mRNASeq Coverage 1 mRNASeq Coverage 2 4.15 90% % 68% 1.6 2.8 % Mb bases 45% 5.9% Mb 1.2 2.3 Mb 23% 0% 5'UTR CDS 3'UTR NONE

SmallRNA seq also covers lots of genic regions smallRNA-Seq Coverage 1 smallRNA-Seq Coverage 2 mRNASeq Coverage 1 mRNASeq Coverage 2 4.15 90% % 68% 1.6 2.8 % Mb bases 45% 5.9% Mb 1.2 2.3 Mb 23% 0% 5'UTR CDS 3'UTR NONE ~20% of reads match tRNAs

Size classes of sequenced smallRNA reads N.crassa smallRNA Solexa Reads 5' base N.crassa smallRNA Solexa Reads 5' base 1.0 1.0 T T G G C C 0.8 A 0.8 A 0.6 0.6 Freq of reads Freq of reads Enrichment of 20-22 with 5' T 0.4 0.4 0.2 0.2 0.0 0.0 17 19 21 23 17 25 19 27 21 29 23 31 25 33 27 35 29 31 33 35 Read Size Read Size

3' UTR, small RNAs, and Folding !"#$%&'()*%"+#,%"-./01(23 66732(8 66732A8 66732N8 667)8 667)268 667)278 667)238 667)2)8 667)298 667)2@8 667)2(8 667)2A8 667)2N8 66798 =$!B>CC(?:%?: MF1" A@M 6)M $CGF#H%?%)#3G'(+9#<+""%9; !:;<7633 5B4C#-D0ECFE05=B/$5CFG:BHI.JFK&LH6 2!-!#&*9+:%9#$CGFIG'(+9#H%?%) $+/%9#>%?%)#3@+9A('9#"+0('+:('1; 5-EH6 )/+""@$!-%J 3< 69 < 2D+):C(?)#3:'+?)<'E*:7F?:'(?; 4+$5/"-.5 6 <29 < !""#$%&'()*('+#,-.)#!))%/0"1#2!-!#34556758754#&*9+:%;#<=$! $5=>?%6@7A @$!7-%J#K1*D+"#.E*#3-L!2; '!*KCO 3< 69 <

3' UTR, small RNAs, and Folding !"#$%&'()*%"+#,%"-./01(23 66732(8 66732A8 66732N8 667)8 667)268 667)278 667)238 667)2)8 667)298 667)2@8 667)2(8 667)2A8 667)2N8 66798 UU A A CC =$!B>CC(?:%?: U U G G A C MF1" A@M A C C G G A 6)M U A C C $CGF#H%?%)#3G'(+9#<+""%9; U C A A !:;<7633 GC A AU A AAA 5B4C#-D0ECFE05=B/$5CFG:BHI.JFK&LH6 CG G UA 2!-!#&*9+:%9#$CGFIG'(+9#H%?%) G A U A CGU A GU $+/%9#>%?%)#3@+9A('9#"+0('+:('1; A GC 5-EH6 U A G A A U AA U )/+""@$!-%J 3< U AA U G UA 69 CG GC < UG UA GC 2D+):C(?)#3:'+?)<'E*:7F?:'(?; UG 4+$5/"-.5 UA A 6 GCA <29 AU < CG U U U !""#$%&'()*('+#,-.)#!))%/0"1#2!-!#34556758754#&*9+:%;#<=$! A U G $5=>?%6@7A C UC U G G A U U 0 1 U A @$!7-%J#K1*D+"#.E*#3-L!2; U A A C A '!*KCO A G 3< U A 69 G C U C < GA

3' UTR, small RNAs, and Folding Ncra_OR74A_chrIII_contig7.1 117.5k 117.6k 117.7k 117.8k 117.9k 118k 118.1k 118.2k 118.3k 118.4k 118.5k 118.6k DNA_GCContent % gc 85% 8% NCBI genes (Broad called) NCU00031 putative protein PASA updated NCBI/Broad genes NCU00031 miRNA Solexa histogram miRNA 50 25 0 miRNA predictions N.crassa PASA cDNA asmbl_2474 asmbl_2475

3' UTR, small RNAs, and Folding Ncra_OR74A_chrIII_contig7.1 117.5k 117.6k 117.7k 117.8k 117.9k 118k 118.1k 118.2k 118.3k 118.4k 118.5k 118.6k DNA_GCContent % gc 85% 8% NCBI genes (Broad called) NCU00031 putative protein PASA updated NCBI/Broad genes NCU00031 A A G G AU UA AU miRNA Solexa histogram GC A UG miRNA A G C G A UA GA GC G UA A GC GC GC GC GC UA AU CUA GC G U GU U U U C A C G G G G C G A UG C UGA A A G C U UA A U GC G A U A G A U GU UG CC GGG C U G G A C A A C C A C CA A U C U UG U G U U A GA A A C G CG U UA A UA C A U GA C GU G A C U A G G G C G AU A C CG C AU U GG A A G GU AGA C A G G U CG A AC A G U G AA A UU G G G A C A AG C C GU U C G G G AAAG C G G A A A A A A G AG AGUUCG UGG G U G A A U GA G A UU UG CCUC G G G C A G A A AC AG GUA GC U CG A A UU C A U AC G A AU GA A G U UU G G G A AG G G G A G A GGC C GU U C AA AU A UC U C GU U AG G U AG CG A G U U UG A G A U U G UA U C GC 50 G U A G A A C G CG U U G A U A U A A A G U C A C G CG U U UA G G 25 U GU GU G UC G G GA U C U U G 0 U AA U G U miRNA predictions CU C G U U A A G UC C U UC N.crassa PASA cDNA asmbl_2474 0 1 asmbl_2475

Candidate region >;3@:(&:@'-A@'(('-BCDE'F;-!@:3&-G 67660.7 6766067 67660/7 6766007 6766057 6766087 67660H7 @!1 ""$ # # # !$ $ !!$ $ # !$ $ ""$ !""!# $ "$ # # # $ # # "# # !"# # "$ # # !# ""$ "$ "# # !"!"!"""# !!!!# !!# $ $ $ "# # ""# # $ "# # !!# "!!"$ # !# $ $ $ # $ $ !$ $ "!$ $ !# $ $ "$ !!# !# !$ $ "!"!"!!!$ """"$ !"#$%&' 1==$!)3-7'47-,$>2?'$0121$9@!1 '(*+,-../// '(*+,-..//0 '(*+,-..//5 '(*+,-..//8 '(*+,-..//H ()*)+,-./0121$34&,5)& %&'(')'(*+,-..//01(2'23().04 'B,==A!1$82C10$*7-)4),5$*75-:B$BBD< 9:,;<'-(*',,=>$ 07 67 7 5A!1' 06,'5"7*'$85-,*'9-:45;%*5-7*< &I'(2A:D( Probe . 7?5 7 Kristina Smith

Conﬁrmation by Northern blots er er T l-2 dd WT l-2 dd W dc er la dc la d l-2 er la d T c d T d W l-2 W d la dc well 281nt 281nt 24nt 21nt 24nt 21nt +strand -strand Ethidium staining Intergenic #80 Kristina Smith

Small RNA &:;<=.>=<-18<-..-1?@A$-7:1B<=;>1CD +!"$ +,"$ ++"$ 1$! 6#78 *56 37/#7>E%JK#5*!L.*:L!*5L:*. ++6 hotspot Not RIPed , !9"3 "9! $5D#7E) &'("4"*, &'("))*5 &'("))*) &'("4"*! &'("4"3) &'("4"*" !""#$%&'()*('+#,-.)#/!-!#01$! -./%01!+233 -./%01!+234 -./%01!+235 No ESTs -./%01!+23* -./%01!+23) -./%01!+2*" 3$!-%4#FG*B+".?* 2" 9968 more highly expressed ," " from RNASeq 3$!-%4#5,63768! +" !3 " )2+""3$!-%4 High smallRNA expression 2" ," " @82%A#5B7/C-%4 +" !3 " Region absent in strain from @H2%I#5B7/C-%4 ," K4 ChIP-Seq !" " 2%17/#5B7/C-%4 ," !" " Methylated region 9:-5;;<<#=%>(2%#'%)%4&%>0?>= !"#$% +" !3 " Missing in Tamil Nadu strain

Discussion & Future work • mRNA • Most of the known genes have expression, a few novel ones to be found • Alternative splicing rarity in this fungus, but is this typical? • Small RNAs • Small RNA hotspot is a putative transposon with siRNAs • How is it recognized? Either from meiotic silencing process (MSUD) • Additional developmental stage proﬁling will help uncover this • Comparative analyses to ﬁnd new ncRNAs

A B C D Deep divergences E F G Phylogenetic proﬁling to H study history of genes in the early diverging fungi I J

<:,./,7 40(78(6(, 31(,.(6(, $7/,6(, $%&'()*('%+%, ,-./$ !"#$%%& 312/'%+%(02&(/, C:,)/(&:,+%(02&(/, $=:/%&7::=:,'FI%/1F $=&('(02&(/%., +%GG7'7./%,/7+F/%))=7) -./(0(*1/1('(02&(/%., >((*,5(02&(/%., E())F(GFG:,57::=0 ?%&@A7::(02&(/%., ;:(07'(02&(/, $%/(/%&F)*(',.5%, <=&&%.%(02&(/%., !"#$%$&'()&*" /(F0%/(/%&F&(.%+%,F 9)/%:,5%.(02&(/%., H75=:,'F)7*/, 45,'%&(02&(/%., D,*1'%.(02&(/%., +#)&'()&*" $7%(/%&F)*(',.5%,F/(F B,&&1,'(02&(/%., 7A/7'.,:F07%()*('7) <76%6(02&(/%., !"## !### "## # Stajich et al, Current Biology, 2009 $%::%(.)F(GF27,')

Zoospore Young sporangia Sporangia discharging zoospores Batrachochytrium dendrobatidis (Bd) Amphibian Pathogen 2 sequenced strains JEL423 (Sierras, USA) and JAM81 (Panama) ~24 Mb genome, ~8800 genes

Host-independent Zoospores Sporangia Encysted releasing zoospore zoospores Developing Sporangia sporangia forming zoospores Host-dependent Gene expression of two Bd developmental stages Rosenblum et al. PNAS 2008

Higher Expression in Higher Expression in Invariant Expression in Sporangia Sample Zoospore Sample Both Samples biological process biological process biological process metabolic process metabolic process metabolic process biological regulation celluluar process celluluar process celluluar process gene expression alcohol, carbohydrate, phosphorylation post-translational DNA transcription, monosaccharide, p<0.001 protein modification modification, regulation of hexose, glucose p<0.001 alykylation, gene expression catabolic process methylation, p<0.01 p<0.001 integration p<0.01 molecular function molecular function molecular function binding catalytic binding catalytic catalytic activity activity activity nucleotide binding metalloexopeptidase zinc phosphoric ester serine-type p=0.010 activity ion binding hydrolase activity peptidase activity p=0.024 p=0.017 p=0.003 p<0.001 Rosenblum et al. PNAS 2008

Putative A) GLEANP3 001910 B) 1 GLEANP3 010940 Keratinase GLEANP3 058130 0.8 GLEANP3 058330 (fungalysin GLEANP3 058280 GLEANP3 038010 0.6 GLEANP3 035340 GLEANP3 045390 0.4 M36) GLEANP3 016580 GLEANP3 040970 GLEANP3 030000 0.2 up in sporangia GLEANP3 068250 GLEANP3 037130 0 zoospore sporangia no expression GLEANP3 027740 GLEANP3 075460 diff GLEANP3 019170 1 up in zoospore GLEANP3 075190 GLEANP3 066500 0.8 GLEANP3 075130 GLEANP3 041170 0.6 GLEANP3 035280 GLEANP3 018720 GLEANP3 048430 0.4 GLEANP3 046850 Aspergillus fumigatus outgroup 0.2 Rhizopus oryzae outgroup GLEANP3 078890 0 0.1 zoospore sporangia Rosenblum et al. PNAS 2008

Exploring deep divergences with phylogenetic proﬁling • Classiﬁcation of gene content • For each gene in a genome • Identify which other species have a homlog (BLAST search). • Consolidate this per Clade (i.e. Animals, Plants, Ascomycetes, etc) • For Chytrid comparison: Compare 7 Clades across 40 genomes • Interact with results via Web Browser

B.dendrobatidis Phylogenetic Proﬁle

Dikarya + Zygomycota only genes

Differences between animal-like and fungal Microtubule attachment points • Transition from flagellated cells with centrioles microtuble Microtuble • Spindle pole bodies in non- flagellated fungi attachment point • How did this transition occur? • Loss of flagellum coupled with transition in basal bodies? http://remf.dartmouth.edu/ Thomas H. Gidding Yeast spindle-pole body Animal centriole

Differences between animal-like and fungal Microtubule attachment points • Transition from flagellated cells with centrioles microtuble Microtuble • Spindle pole bodies in non- flagellated fungi attachment point • How did this transition occur? • Loss of flagellum coupled with transition in basal bodies? http://remf.dartmouth.edu/ Thomas H. Gidding Chytrid centriole Yeast spindle-pole body Animal centriole

Chytrid genome is missing some chromosome segregation and mitosis related genes • Missing genes in the B. dendrobatidis genome • KAR1 for nuclear membrane fusion during karyogamy and Spindle- body duplication SPC42 - central plaque component of spindle pole bodies CEP3 - essential kinetochore protein CIN2 - Tubulin folding protein REC8 for sister chromatid cohesion DASH Complex for kinetochores coupling during mitosis (10 genes) • Present genes in B. dendrobatidis genome (some overlap with ﬂagellum genes) • Sas-4, Ift20, Cep192

Taking S.cerevisiae cell wall as model Yeast Cell Wall Selitrennikoff CP, AEM 2001

Cell wall changes from Early fungi • Identiﬁed series of genes missing in Bd including major components of the β(1,3) glucan biosynthesis pathway (FKS1) and many of the KTH transporters • Bd is much less sensitive to Enchinocandin drugs (MIC 4-8) which target FKS1 • Allomyces (Blastocladiomycota) does have a FKS1 ortholog, Speizellomyces (Chytridiomycota) does not. • Does gain of genes to make β(1,3)-glucan and/or loss of cellulose represent one of the major transitions from aquatic to terrestrial lifestyles for fungi?

B. dendrobatidis cell wall biochemical analysis Cellulose β (1,3)- β(1,6)- α(1,3)- β(1,4)- Chitin glucan glucan glucan glucan X X X ✓ ✓ Currently No cellulose synthase gene found in genome based on genes deﬁned in bacteria, oomyctes, or plants. with JP Latgé

1,3 Beta-Glucan synthesis enzyme (presence of FKS1?) <:,./,7 ✓ (related enzyme) 40(78(6(, ✗ 31(,.(6(, ✗ $7/,6(, ✗ $%&'()*('%+%, ✗ ,-./$ !"#$%%& 312/'%+%(02&(/, ✗ C:,)/(&:,+%(02&(/, ✓ $=:/%&7::=:,'FI%/1F +%GG7'7./%,/7+F/%))=7) $=&('(02&(/%., ✓ -./(0(*1/1('(02&(/%., >((*,5(02&(/%., E())F(GFG:,57::=0 ?%&@A7::(02&(/%., ;:(07'(02&(/, $%/(/%&F)*(',.5%, <=&&%.%(02&(/%., !"#$%$&'()&*" /(F0%/(/%&F&(.%+%,F 9)/%:,5%.(02&(/%., ✓ H75=:,'F)7*/, 45,'%&(02&(/%., D,*1'%.(02&(/%., +#)&'()&*" $7%(/%&F)*(',.5%,F/(F 7A/7'.,:F07%()*('7) B,&&1,'(02&(/%., <76%6(02&(/%., ✓ !"## !### "## # $%::%(.)F(GF27,')

Identifying an ancient photoreceptor • Fungi have some light sensing molecules but no known rhodopsins have been cloned. • Rhodopsin molecule implicated in zoospore phototaxis in Allomyces (by comparing wavelengths where cells responsed) • Sequence similarity identiﬁes a candidate 7-transmembrane protein, but has insertion found in both Bd and Allomyces (draft genome). insertion? Peak response at ~536 nm (green light)

<:,./,7 40(78(6(, 31(,.(6(, AFTER CHYTRID SPLIT $7/,6(, Loss of: $%&'()*('%+%, ,-./$ • Flagella, centrioles !"#$%%& • 1,4 Beta-glucan 312/'%+%(02&(/, synthesis? Gain of: C:,)/(&:,+%(02&(/, $=:/%&7::=:,'FI%/1F • STE50 adaptor +%GG7'7./%,/7+F/%))=7) $=&('(02&(/%., • Some glucan synthase and -./(0(*1/1('(02&(/%., transferases + 1,3 >((*,5(02&(/%., • Rhodopsin-like 7TM E())F(GFG:,57::=0 Beta- glucan ?%&@A7::(02&(/%., IN DIKARYA, Gain of: synthesis ;:(07'(02&(/, • Spindle-pole bodies <=&&%.%(02&(/%., !"#$%$&'()&*" • Thiamine biosynthesis $%/(/%&F)*(',.5%, /(F0%/(/%&F&(.%+%,F • STE3 pheremone receptor 9)/%:,5%.(02&(/%., • DASH complex H75=:,'F)7*/, 45,'%&(02&(/%., • KTR mannosylphosphate D,*1'%.(02&(/%., +#)&'()&*" family $7%(/%&F)*(',.5%,F/(F B,&&1,'(02&(/%., Loss of: 7A/7'.,:F07%()*('7) • Chitosanase <76%6(02&(/%., !"## !### "## # $%::%(.)F(GF27,')

Connecting molecules to evolutionary transitions • Nuclear division changes • Basal body, centriole loss coupled with loss of flagellum • What happened first? Where did spindle-pole body genes evolve from - duplication or novel gene creation? Did some of flagellum & basal body genes evolve new functions? • Cell wall changes • β (1,3) glucan and β (1,6) glucan synthesis evolved before the Blastocladiomycota divergence, but after the Chytridiomycota divergence. • Where did this gene come from? Highly similar among all fungi who have a copy (78% similar along 1600+ amino acids from S.cer-Zygos) • Connect to Multicellular development • Septation, and signaling (Notch pathway (?), Presenilin, Tetraspanin)

Genome evolution in Basidiomycete mushrooms • Coprinopsis cinerea (Coprinus cinereus) • Studies of multicellular development Fully assembled chromosomes • Uniquely fungal kinase FunK1 greatly expanded (130 members) in Ccin and also only found in multicellular fungi (Agaricales, Peziomycotina) • Independent expansions of other families: hydrophobin, P450 • Microarray comparing monokaryon and dikaryon identiﬁed some genes that deﬁne different cell types. Stajich et al. submitted

Conclusions • Population genomics of a fungal pathogen helps uncover dispersal patterns, history of introgression • NGS on N. crassa to proﬁle the the transcriptome • Early evolutionary steps of the fungi through comparative genomics

Acknowledgements Bd Neurospora Christina Cuomo, Broad Inst Chris Ellison, Tom Sharpton, John Taylor Erica Rosenblum, U Idaho Charles Hall, Louise Glass, UC Berkeley JP Latge, Pasteur Inst News about fungi, genomes, genome browsers, and community wiki Coccidioides http://fungalgenomes.org Dan Neafsey - Broad Institute Bridget Barker, Steve Rounsley - U Arizona Tom Sharpton, John Taylor- UC Berkeley JGI Broad Institute

New research lab starting at UC Riverside • Interested in research in fungal genomics? • Fungal cell evolution in early diverging chytrid and ‘zygomycete’ fungi using molecular and genomics approaches • Evolution of multicellularity in Fungi • Post-transcriptional gene regulation and small RNAs in ﬁlamentous fungi (Neurospora, Aspergillus) • Bioinformatics and genome informatics of fungal comparative genomics and application of next generation sequencing

http://lab.stajich.org	31
http://stajichlab.fungalgenomes.org	10
http://logbook.tommyau.hk	6
http://bongsoo.egloos.com	2

2009 11 09 UCLA Bioinformatics Talk

by Jason Stajich on Nov 16, 2009

Accessibility

Categories

Tags

Upload Details

Usage Rights

4 Embeds 49

Statistics

2009 11 09 UCLA Bioinformatics Talk — Presentation Transcript