Internship presentation

114 views
70 views

Published on

summary of research completed at Martinlab in 2013.

Published in: Science, Technology, Business
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
114
On SlideShare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
1
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Internship presentation

  1. 1. Preservation of mRNAs in Torpor for Brown Adipose Tissue Activity During Arousal JORDAN SPALDING BIOLOGY 3939 UNIVERSITY OF COLORADO DENVER AIMEE BERNARD, PhD Ictidomys tridecemlineatus Spalding Jordan, Grabek Katie, Martin Sandy
  2. 2. Main points • Squirrels, hibernation and BAT • Increase in abundance of transcripts • Is it transcription or preservation?
  3. 3. 13 Lined Ground Squirrels (Ictidomys tridecemlineatus) [1] Squirrels and Hibernation*
  4. 4. Hibernation Heterothermy in Winter
  5. 5. Non-Shivering Thermogenesis Torpor/Arousal Cycles Hindle, A. (2013) Martinlab.
  6. 6. [iv]
  7. 7. Jastroch et al., Essays Biochem. (2010) 47: 53–67
  8. 8. Transcriptome Analysis [2] Increase in Abundance of Transcripts* Grabek, K. (2013). MartinLab -1.5 -1 -0.5 0 0.5 1 1.5 2 2.5 InterBout Arousal Late Torpor Early Arousal Spring Warm RelativeFoldChange 0 5 10 15 20 25 30 35 40 InterBout Arousal Late Torpor Early Arousal Spring Warm BotyTemp.ºC
  9. 9. How does transcript abundance increase in torpor?
  10. 10. Enriched for BAT activity Cluster Enrichment Score No. of Genes Mitochondrion 4.04 27 Neutral Lipid Biosynthetic Process 2.74 4 Lipid Catabolic Process 2.33 11 Adipocytokine Signaling Pathway 2.17 9 Glycerolipid Metabolic Process 2.14 12 Generation Of Precursor Metabolites And Energy 2.08 13 Tricarboxylic Acid Cycle 2.03 5 Lipid Droplet 1.93 3 Fatty Acid Metabolism 1.38 7 Grabek, K. (2013). MartinLabFurness, D. (2013) Keele University
  11. 11. Stabilized Transcription in torpor How can transcript abundance increase? [3] Is it transcription or preservation?*
  12. 12. The experimental approach Total RNA Design Primers qPCR total RNA Hybridize Oligo(dT)Make cDNA Clone Sequence Standard Curve Elute low salt Elute high salt qPCR long Poly(A) qPCR short poly(A) Compare + Analyze Compare to genome
  13. 13. Isolation and Sequencing JH393516.1 137554 to 137652 (+) [LIPE (intron)] TGGTGTCAAGCAGCCACAAA [LIPE_I8B_FOR primer] (aligned) AAGTTGGCCGAGCCTCCTGCTGTGGTCCAGGAGACAGCTGGAACAGGGCACCAAGCAT GGCAATAAAGCCTCATGCTGA [LIPE_I8B_REV primer] (aligned) GSR LIPE QRSL1 BTG2 Snora STAP2 CIDEC GAPDH Scarna OGDH
  14. 14. qPCR Lipe I8B cDNA
  15. 15. Results GSR LIPE QRSL1 BTG2 Snora STAP2 CIDEC GAPDH Scarna OGDH Transcripts with long Poly(A) tails are stable during torpor Transcripts lacking/with short poly(A) tails decrease in torpor Polyadenylation confers stability for select transcripts Lipe STAP2Snora44 scaRNA 9
  16. 16. 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 IBA LT E-Ar SpW STAP2 Percent of Total RNA Signal transduction 0 10 20 30 40 InterBout Arousal Late Torpor Early Arousal Spring Warm BotyTemp.ºC 0 10 20 30 40 InterBout Arousal Late Torpor Early Arousal Spring Warm BotyTemp.ºC Total RNA Long Actual Abundance Long 0 5 10 15 20 25 30 35 IBA LT E-Ar SpW PercentofTotalRNA(recovered)
  17. 17. Conclusion • Transcripts ‘increased’ in torpor by stabilization • Most transcripts degraded in torpor • Steady state decreases
  18. 18. Acknowledgements • I acknowledge support from the APS’s Integrative Organismal System Physiology Fellowship • Thank you to Sandy Martin for being an hands-on lab PI and persistent in developing my knowledge • Thank you to Katie Grabek for providing technical support and walking me through procedures • Thanks to Allyson Hindle for help with concepts and troubleshooting • Thanks to Greg Florant for administrative and technical support • Thanks to Vishnu Raman, Ross McNeill, Kelsi Grogan and Nico Roberts for being there for my ‘stupid’ questions.
  19. 19. Bibliography i. AMREI JÄNICKE, JOHN VANCUYLENBERG, PETER R. BOAG, ANA TRAVEN, and TRAUDE H. BEILHARZ. ePAT: A simple method to tag adenylated RNA to measure poly(A)-tail length and other 39 RACE applications. RNA. 2012; (18)6.p1-7. ii. Da Wei Huang,, Brad T Sherman, & Richard A Lempicki. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols. 2009; (4)1.p44-57 iii. Hedda A. Meijer, Martin Bushell, Kirsti Hill, Timothy W. Gant, Anne E. Willis, Peter Jones and Cornelia H. de Moor. A novel method for poly(A) fractionation reveals a large population of mRNAs with a short poly(A)tail in mammalian cells. Nucleic Acids Research. 2007;(35)19.p.1- 13. iv. Martin, Sandy. (2013) Research Strategy. p.1-17. v. michael a. frohman, michael k. dush, and gail r. martin. Rapid production of full-length cDNAs from rare transcripts: Amplificationusingasinglegene-specificoligonucleotideprimer. Proc. Nati.Acad. Sci. USA. 1988; (85) p8998-9002.

×