DNA-based methods for bioaerosol analysis
Upcoming SlideShare
Loading in...5
×
 

DNA-based methods for bioaerosol analysis

on

  • 263 views

Information for producing phylogenetic/taxonomic libraries of airborne bacteria and fungi. Includes fundamental background information, approaches for sequencing and data analysis, two case studies, ...

Information for producing phylogenetic/taxonomic libraries of airborne bacteria and fungi. Includes fundamental background information, approaches for sequencing and data analysis, two case studies, and a review of sampling methods

Statistics

Views

Total Views
263
Views on SlideShare
261
Embed Views
2

Actions

Likes
0
Downloads
5
Comments
0

1 Embed 2

http://www.slideee.com 2

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

DNA-based methods for bioaerosol analysis DNA-based methods for bioaerosol analysis Presentation Transcript

  • Molecular  Biology-­‐Based  Bioaerosol   Analysis                                    Jordan  Peccia   Yale  University   Chemical  and     Environmental  Engineering   Jordan.Peccia@yale.edu   1  
  • General  Outline:   Overview  of  geneDcs       The  new  world  of  DNA  sequencing       Molecular  methods  for  idenDficaDon       Molecular  methods  for  quanDficaDon       PhylogeneDcs  overview       Aerosol  sampling  for  molecular  analysis       2  
  • Review  of  GeneDcs   3  
  • GeneDcs  DefiniDons:   Genome:  The  complete  set  of  geneDc  material  (DNA)  of  an   organism  or  a  virus.       Gene:  A  segment  of  DNA  specifying  a  parDcular    protein,  or   other  funcDonal  molecule  (tRNA  or  rRNA).       Transcriptome:  The  complement  of  mRNAs  produced  in  an   organism  under  a  specific  set  of  condiDons.       Metagenome:  The  total  geneDc  complement  of  all  the  cells   present  in  a  parDcular  environment.       Proteome:  The  total  set  of  proteins  encoded  by  a  genome         4  
  • Central  Dogma  of  Biology:   DNA   RNA   Protein   Genomic  DNA  is   blueprint  set  of   instruc8ons   Messenger  RNAs   (mRNAs)  are  the   specific,  short-­‐lived,   gene  transcripts   Proteins  perform   structural  and   cataly8c  func8ons   transcrip8on   a.k.a.  “gene   expression”   Transla8on  occurs  in  ribosomes:    (1)   mRNA  aNaches  to  ribosome,  (2)   polypep8des  are  produced,   polypep8des  are  folded  in  to  proteins   5  
  • GeneDc  Code:   Gene8c  Code:  Correspondence   between  nucleic  acids  and  amino   acids  (monomers  of  protein)   DNA  bases:    Adenine  (A)        Thymine  (T)        Cytosine  (C)        Guanine  (G)     RNA  bases:    Adenine  (A)        Uracil          (U)        Cytosine  (C)        Guanine  (G)     DNA:    GTTGCGGGATATTTATCTTAG   Amino  acid:  Val-­‐Ala-­‐Gly-­‐Tyr-­‐Leu-­‐Ser-­‐STOP   6  
  • Genome  Size  (base  pairs):   viruses   bacteria   Fungi/ molds   mammals   plants   103   104   105   106   107   108   109   1010   1011   7  
  • DNA  Sequencing   8  
  • Cost  of  DNA  Sequencing:   !"#$ #$ #!$ #!!$ #!!!$ #!!!!$ %!!#$ %!!&$ %!!'$ %!!($ %!!)$ %!##$ !"#$%$"%#&'(&)*&%+,--,")%./0%12#&#%345% Moore’s  law   TradiDonal  method  is   Sanger  sequencing:    -­‐advantage:  longer    (up  to  800  bp  long    sequences)    -­‐disadvantage:  slow    and  costly   Next  generaDon   sequencing:    -­‐advantage:  low    cost  and  rapid    -­‐disadvantage:    sequences  are    short  (75  to  400    bp)   9  
  • (A)  DNA  is  fragmented   into  pieces  ~500  bp   long  and  made   single  stranded;   (B)  Adaptors  are  added   to  single  strands  and   1  strand  is  aNached   to  1  microbead;   (C)  PCR  is  performed   and  mul8ple  copies   of  the  strand  are   produced;   Next  GeneraDon  Sequencing  Example  (454   Pyrosequencing):   A B C 10  
  • D (D) Beads  are  placed   into  wells  (1.5  x  106   wells  per  plate);   (E)  The  seconds  strand   is  synthesized  and   added  bases  are   recorded.   Next  GeneraDon  Sequencing  Example  (454   Pyrosequencing)  ConDnued:   E   11  
  • Some  DNA  Sequencing  OpDons  (as  of  2012):   Illumina  HiSeq  technology        -­‐one  lane  produces  ~50  million  reads      -­‐reads  are  ~100  nucleoDdes  long      -­‐cost  is  ~$2,000  per  lane   454  Pyrosequencing        -­‐one  gasket  produces  150,000  reads      -­‐reads  are  ~500  nucleoDdes  long      -­‐cost  is  ~$2,000  per  gasket   Lab  “personal”sequencers      -­‐Ion  Torrent:  60-­‐80  millions  reads,  200  nt  long      -­‐MiSeq:  15  million  reads,  up  to  250  nt  long   12  
  • PhylogeneDcs   13  
  • PhylogeneDcs:   Phylogeny:  The  evoluDonary  history  of  organisms       PhylogeneDcs:  A  framework  for  idenDficaDon  and   quanDficaDon  of  microbial  communiDes.       Habitat      Culturability  (%)   Seawater                0.001-­‐0.1   Freshwater      0.25   Mesotrophic  lake    0.1-­‐1   Estuarine  waters    0.1-­‐3   Ac8vated  sludge    1-­‐15   Sediments      0.25   Soil          0.3   Air          ~1   The  great  plate  count  anomaly  (see  Amann  et  al.  (1995),  Microbiol.  Rev.  v59,   p143.)       14  
  • 16S  rRNA    is  the   EvoluDonary  Chronometer    ~1500  nucleoDdes  long    a  structural  porDon  of  the    ribosome    present  in  all  organisms    evolved  slowly  and  includes  conserved,    variable  and    hypervariable     15  
  • Structure  for  Ribosomal  RNA:            Eukaryotes      Bacteria   Total      80S  size        70S  size   LSU        60S          50S   SSU        40S          30S   LSU  rRNA      5.8S,  28S        5S,  23S   SSU  rRNA    18S          16S                 5.8S                      28S            18S            ITS1            ITS2            transcribed  intragenic  spacer  regions  (important  for  fungi)   16  
  • variable   conserved   Hyper-­‐ variable   Some  Important  Regions   of  the  16S  rRNA:     17  
  • Variable  Regions  of  the  16S  rRNA:     potenDal  PCR  primer  sites     18  
  • For  IdenDficaDon:   1)  Sequences  derived  from  one  or  many  microorganism  in  an   aerosol  sample  can  be  produced     ACGTATAGGACGATACCATG……………   2)  Using  a  search  algorithm,  the  sequence  is  matched  against  a   databases  of  rDNA  gene  sequences  from  known  organisms.       3)  IdenDficaDon  at  the  highest  taxonomic  level  that  can  be  confidently   assigned  is  provided.  eg.  assignment  of  E.  coli  to  genus  level  would   yield:   Bacteria  Proteobacteria    gammaProteobacteria      Enterobacteriales  Enterobacteraceae    Escherichia   domain      phylum      class        order      family      genus       19  
  • SSU  rRNA  Alignment  Forms  the   Tree  of  Life  and  a  Basis  for   IdenDficaDon      rRNA-­‐based  Taxonomy:    Domain    Phylum    Class    Order    Family    Genus    Species     Pace,  1997,  Science  v276,  p734   20  
  • Molecular  Methods  for  QuanDficaDon   21  
  • Why  Not  QuanDfy  by  Culturability?   Habitat      Culturability  (%)   Seawater                0.001-­‐0.1   Freshwater      0.25   Mesotrophic  lake    0.1-­‐1   Estuarine  waters    0.1-­‐3   Ac8vated  sludge    1-­‐15   Sediments      0.25   Soil          0.3   Air          ~1   The  great  plate  count  anomaly:       22  
  • Viable Spore Dead Spore Spore that can not grow on media Unidentifiable Culturing  Cannot  Capture  Fungal  Diversity:   Other fungal fragments 23  
  • Methods  for  QuanDficaDon:   QuanDtaDve  polymerase  chain  reacDon       Direct  microscopy  and  staining   Immuno-­‐based  methods  and  proteomics         24  
  • First:  Polymerase  Chain   ReacDon  (PCR)       1)  Reagents:  forward  and   reverse  primers,  dNTP  mix   (A,T,C,G),  water  and  Mg2+,   template,  DNA  polymerase   2)  Thermal  cycler:  runs   temperature  program  for   Denatura8on  (~95oC),   primer  annealing  (40-­‐60oC),   extension  (72oC).  Typically   20  to  30  cycle  is  adequate,   don’t  go  above  45  cycles.     PCR  performs  two  funcDons:  (1)  it  selects  a  gene  or   segment  of  DNA  from  a  background  of  total   extracted  DNA,  and  (2)  it  makes  many  copies  of  the   selected  DNA  (amplicons)   25  
  • PCR  is  Confirmed  by  Gel  Electrophoresis:   1000  bp   500  bp   100  bp   Ladder   -­‐  control   sample   +  control   26  
  • PCR  for  Aerosol  Samples  is  Challenging!   27  
  • QuanDtaDve  (PCR),  a.k.a  Real-­‐Time  PCR       (a)  PCR  reagents  include  a  fluorescent   dye  that  increases  in  emissions  as   amplicon  number  increases  each   cycle   (b)  Thermal  cycler  blocks  are   equipped  with  fluorometers  to   detect  changes  in  emission,  thus   track  amplicon  number  as  cycles   progress     Rela8ve   fluorescence   Increase  in  sample   concentra8on   28  
  • How  is  Amplicon  Number  Converted  to  Fluorescent   Signal?   Method  1:  TaqMan®   Method  2:  SYBR  green   SYBR  is  a  DNA  intercala8ng   agent  that  fluoresces  only   when  bound  to  double   stranded  DNA.  As  more   amplicons  are  produced,   more  SYBR  green  binds  and   fluoresces.     29  
  • qPCR  QuanDficaDon  Methods  –CalibraDon   CT  (cycle   threshold   value  set  in   linear  region   Replicate  samples,   known  concentraDon   of  cells  or  amplicon   targets   101  105   104   103   102   30  
  • qPCR  QuanDficaDon  Methods  Cont…  CalibraDon     !"#"$%&'()*+","%%&'(-" ./"#"0&))(-" 0&00" 1&00" 20&00" 21&00" -0&00" -1&00" %0&00" %1&00" '0&00" $-" 0" -" '" *" (" !"#$%&'(# )*+,-(&&./# CT  Value   31  
  • Reproducibility and RepeatabilityReproducibility and Repeatability Reproducibility Near Detection Level limit ~103  cells   ~104  cells   Copyright  ©  American  Society  for  Microbiology,  [doi:  10.1128/AEM.01240-­‐10   Appl.  Environ.  Microbiol.  November  2010  vol.  76  no.  21  7004-­‐701]   32  
  • Reproducibility and Repeatability Coefficient of variation, n=7 Reproducibility ~103 , ~104 Coefficient of variation, n=7 Repeatability ~103 , ~104 True difference 95% confidence n=7 E. coli Quartz 78%, 60% 36%, 44% 3.2 times PCTE 79%, 70% 11%, 26% B. atrophaeus Quartz 64%, 47% 57%, 41% 2.4 times PCTE 60%, 57% 58%, 51% A. fumigatus Quartz 61%, 67% 17%, 61% 2.5 times PCTE 28%, 49% 15%, 21 % 33  
  • Molecular  Methods  for  IdenDficaDon   34  
  • Methods  for  IdenDficaDon   PhylogeneDc  libraries:  a  library  of  of  all  SSU  rDNA  sequences   that  exist  in  an  environmental  sample.   Microbial  diversity  methods  and  tools   35  
  • §  For  bacterial  libraries:  PCR  primers  typically  target  the   16S  rRNA  encoding  gene  variable  regions;   §  For  fungal  libraries:  PCR  primers  typically  target  genes   encoding  the  ITS  region  of  ribosomal  RNA;     PhylogeneDc  Libraries  for  Bacteria,  Fungi,  and  Viruses:   36  
  • §  GS-­‐FLX  454  sequencing   planorm;   §  Primers  targe8ng  16SrDNA   regions  crea8ng  ~500   basepair  long  amplicons;   §  Data  analysis  pipeline  called   QIIME  (quan8ta8ve  insights   into  molecular  biology).   Isolate DNA Produce amplicons DNA clean- up Ampure clean-up Pool DNA Scheme  for  CreaDng  PhylogeneDc  Libraries:   Send to sequencer 37  
  • Pyrosequencing  Detail  for  PhylogeneDc  Libraries   Primers  ConstrucDon:   !"# !"# $"# $"# %$%#&'&()*+# %$%#&'&()*+# ,&+-*'.# ,&+-*'.# /01230#4# /01230#0# +056#7.8.# 9%::#,(#&;(<=-*8#>=)?#-@++.8)# A.B@.8-=87#).-?8*<*7C# 38  
  • §  SorDng  sequences  in  to  sample  bins  and  trimming   primers  and  adaptors;   §  Producing  a  phylogeneDc  placement  or  idenDficaDon   for  each  sequence;   §  Determining  relaDve  abundances  of  taxa  for  each   sequence  (alpha  diversity);   §  Use  phylogeneDcs  to  compare  one  sample  populaDon   with  other  populaDons  (beta  diversity).   Sequence  Data  Analysis  Includes:   39  
  • SorDng/Trimming/Denoising:   1)  Raw  sequencer  files   are  input  into   sopware  that   recognizes  the   barcodes  and  sorts   sequences  into  their   original  sample  bin.     2)  Primers  are   recognized  and   primer,  and  adaptors   are  removed   3)  454  sequencing  is   suscep8ble  to   mistakes  due  to   homopolymers   (AAAAAA).  Denoising   “fixes”  these  errors   40  
  • PhylogeneDc  Placement  or  IdenDficaDon:   1)  Sequences  derived  from  one  or  many  microorganisms  in  an   aerosol  sample  are  first  produced     ACGTATAGGACGATACCATG……………   2)  Using  search  algorithms,  the  sequenced  is  matched  against  a   databases  of  rDNA  gene  sequences  from  known  organisms.       3)  IdenDficaDon  at  the  highest  taxonomic  level  that  can  be  confidently   assigned  is  provided.  eg.  Assignment  of  an  E.  coli    sequence  to  a   genus  level  would  yield  the  result:   Bacteria  Proteobacteria    gammaProteobacteria      Enterobacteriales  Enterobacteraceae    Escherichia   domain      phylum      class        order      family      genus       41  
  • PhylogeneDc  Placement  or  IdenDficaDon:   For  Bacteria:  Sequences  are  placed   into  a  MASTER  phylogene8c  tree   (Greengenes  tree).  The  are  then   iden8fied  based  on  their  placement.   97%  similarity  in  sequence  is  generally   accepted  as  the  same  species  (also   called  phylotype  or  opera8onal   taxonomic  unit  (OTU))   Pace,  1997,  Science  v276,  p734   42  
  • PhylogeneDc  Placement  or  IdenDficaDon:   For  Fungi:  Sequences  are  compared  against  a  database  of  known  ITS  fungal  sequences  (by   BLAST  (Basic  Local  Alignment  Search  Tool)),  and  “best  matches”  are  determined   TGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGC CCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCG AAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTT GTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCG ACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGGCGGA   BLAST  nucleo8de  search   43  
  • n  What  are  the   origins  of  this   material  that  is   associated  with   human  occupancy?   shedding resuspension resuspension Case  Study  #1:   occupied vs. vacant 44  
  • Hospodsky  D,  Qian  J,  Nazaroff  WW,  Yamamoto  N,  et  al.  (2012)  Human  Occupancy  as  a  Source  of  Indoor  Airborne  Bacteria.  PLoS  ONE  7(4):   e34867.  doi:10.1371/journal.pone.0034867   hNp://www.plosone.org/ar8cle/info:doi/10.1371/journal.pone.0034867   Case  Study  #1:  RarefacDon  Curves,  the  First  Step  in   alpha  Diversity  Analysis:   45  
  • Case  Study  #1:  RelaDve  Abundances  of  Bacterial   Taxa:   Hospodsky  D,  Qian  J,  Nazaroff  WW,  Yamamoto  N,  et  al.  (2012)  Human  Occupancy  as  a  Source  of  Indoor  Airborne  Bacteria.  PLoS  ONE  7(4):   e34867.  doi:10.1371/journal.pone.0034867   hNp://www.plosone.org/ar8cle/info:doi/10.1371/journal.pone.0034867   46  
  • Hospodsky  D,  Qian  J,  Nazaroff  WW,  Yamamoto  N,  et  al.  (2012)  Human  Occupancy  as  a  Source  of  Indoor  Airborne  Bacteria.  PLoS  ONE  7(4):   e34867.  doi:10.1371/journal.pone.0034867   hNp://www.plosone.org/ar8cle/info:doi/10.1371/journal.pone.0034867   Case  Study  #1:  Beta  Diversity,  Comparing  Aerosol   PopulaDons  with  PotenDal  Source  PopulaDons:   47  
  • Case  Study  #2:  Microbial  Ecology  of  Public   Restroom  Surfaces   48  
  • Flores  GE,  Bates  ST,  Knights  D,  Lauber  CL,  et  al.  (2011)  Microbial  Biogeography  of  Public  Restroom  Surfaces.  PLoS  ONE  6(11):  e28132.  doi: 10.1371/journal.pone.0028132   hNp://www.plosone.org/ar8cle/info:doi/10.1371/journal.pone.0028132   Case  Study  #2:  Taxonomic  ComposiDon  of  Public   Restroom  Surfaces:   49  
  • Flores  GE,  Bates  ST,  Knights  D,  Lauber  CL,  et  al.  (2011)  Microbial  Biogeography  of  Public  Restroom  Surfaces.  PLoS  ONE  6(11):  e28132.  doi:10.1371/ journal.pone.0028132   hNp://www.plosone.org/ar8cle/info:doi/10.1371/journal.pone.0028132   Case  Study  #2:  Beta  diversity-­‐  Comparison   Among  Different  Surface  Samples   50  
  • Flores  GE,  Bates  ST,  Knights  D,  Lauber  CL,  et  al.  (2011)  Microbial  Biogeography  of  Public  Restroom  Surfaces.  PLoS  ONE  6(11):  e28132.  doi: 10.1371/journal.pone.0028132   hNp://www.plosone.org/ar8cle/info:doi/10.1371/journal.pone.0028132   Case  Study  #2:  Beta  diversity-­‐Source  Tracker   Program  in  QIIME   51  
  • Aerosol  Sampling  for  Molecular  Biology   52  
  • Aerosol  Sampling  Concept:  ImpacDon   Impaction: The inertia of a particle causes drift across bending fluid streamlines. 53  
  • Aerosol  Sampling  Concept:  Impingement   Impingement: entrapment of particles in liquid. 54  
  • Aerosol  Sampling  Concept:  FiltraDon   Filtration: Straining, interception, impaction, diffusion. 55  
  • Sampler  CharacterisDcs:    Impactors   Sampling rate Size resolved sampling Viability Sample suitable for molecular methods Advantages/disadvantages Cascade impactors Mechanism: The sampling air stream makes a sharp bend and particles are stripped based on their aerodynamic diameter. Typical models: -Anderson Cascade Impactor; -MOUDI cascade impactor; -BGI 900 L/min high volume cascade impactor. Typically 10 to 28 L/min. Some samplers allow for > 500 L/min. Provides the best size distribution information. Different models offer between 1 and 12 stages for collecting aerosols with aerodynamic diameters from 10 nm to >18 µm. Only at 28 L/min collection rates and requires direct sampling onto agar plates. Stages can be covered with filters, membranes, or plates and samples can then be extracted from these materials. The panel did not recommend use of foam as a sampling medium due to the low efficiencies associate with cell and DNA extraction. Advantages: -Best ability to define particle size distributions; -Models available to perform culturing;. Disadvantages: -High cost per sampler, especially for high volume samplers; -Sampling inefficiencies due to particle bounce; -Not sensitive as total sampled mass is divided among multiple stages. ! Sampling Size resolved Viability Sample Suitable for Advantages/disadvantages dfddd rate sampling molecular methods 56  
  • Common  Impactors:   Andersen multistage impactor Micro-Orifice Uniform- Deposit Impactor BGI High Vol Impactor 57  
  • Available  Sampler  CharacterisDcs:  Impingement   Liquid impingement Mechanism: Sampled air is passed through a small opening and captured into a liquid medium. Typical Models: -SKC swirl impingers; -Omni 3000 high volume impinge. 14 L/min for glass impingers, new high volume models are capable of >100 liters per minute. Very limited information on the size ranges that are collected. Efficiency drops in low volume glass impingers below aerodynamic diameters of 1 µm. High volume samplers have not been characterized for sampling efficiencies as a function of particle sizes. Impingers are flexible since organisms are impinged into liquid media or buffer and can be used for culturing or molecular analysis. Samples are impinged into 10 to 20 ml of liquid, which may required concentration by filtration. Advantages: -Sample is collected into liquid and does not require extraction from a solid collection medium; -Low cost of low flow glass impingers. Disadvantages: -Limited information on efficiencies, and the particle sizes that are sampled; -High volume impingers are high cost; -Glass impingers suffer from low sampling rate and limited sampling times due to evaporation; -High volume impingers have complex systems for collecting the sample and rewetting surfaces, and there is large concern about effectively decontaminating the equipment. ! Sampling Size resolved Viability Sample Suitable for Advantages/disadvantages dfddd rate sampling molecular methods 58  
  • Common  Liquid  Impinger  Samplers:   SKC BioSampler Omni 3000 Hi Vol. Impinger 59  
  • Aerosol  Sampler  CharacterisDcs:  FiltraDon   Filtration Mechanism: Aerosols are captured on filters by impaction or diffusional forces. Typical Models: -Anderson High volume PM samplers; -SKC IMPACT samplers. Ranges from 4 L/min and up to 1,000 L/min. Filtration samplers typically have size selective inlets that allow for sampling 10 µm and below (PM10) and 2.5 µm and below (PM2.5) size fractons. Because of high diffusional forces, filters are efficient at sampling sizes down to the 20 nm range of viruses and microbial fragments Not recommended for viability due to high stresses from impaction and desiccation. Requires extraction from filter material, often Teflon or polycarbonate membranes, quartz fiber filters, or gelatin filters. Advantages: -High sampling rates available; -Most common and robust form of high volume sampling; -Very small particles can be sampled, most efficient way to sample viruses; -Can be used as personal samplers; -low cost compared to impingers and impactors; -Preferred method for sampling PM for regulatory compliance. Disadvantages: -No possibility for viable determination; -High volume samples are not suitable for sampling in most occupied environments; -Limited ability to produce particle size distributions. ! Sampling Size resolved Viability Sample Suitable for Advantages/disadvantages dfddd rate sampling molecular methods 60  
  • Common  Filter  Samplers:   SKC Personal Environmental Monitor Andersen Hi Vol PM10 sampler 61  
  • Important  Resources   62  
  • Tools  for  Sequence  Analysis:   Some  useful  basic  tools  for  gexng  started  with  bacterial  and  fungal   phylogene8c  analysis:                RDP  Pyrosequencing  pipeline:  Easy  to  use  pipeline  for  viewing  histograms  of  raw        sequences  and  sor8ng  data  based  on  barcodes.    hNp://pyro.cme.msu.edu/    UniFrac:  Beta  diversity  measurements  including  PCoA  plots  of  microbial  popula8ons.    hNp://bmf2.colorado.edu/fastunifrac/    FHiTINGS:  Automa8cally  selects  best  BLAST  hit  for  fungal  iden8fica8on,  assigns    taxonomy,  and  parses  data  into  tables.        hNp://sourceforge.net/projects/yi8ngs/   All  in  One  tool  boxes,  that  contain  a  variety  of  programs  for  complete   sequence  analysis:   QIIME:  Quan8ta8ve  Insights  Into  Microbial  Ecology:  hNp://qiime.sourceforge.net/   VAMPS:  Visualiza8on  and  Analysis  for  Microbial  Popula8on  Structure:   hNp://vamps.mbl.edu/index.php   MOTHUR:  hNp://www.mothur.org/   63  
  • To  learn  more:   Procedures  for  phylogeneDc  sequencing  using  Illumina-­‐based  DNA  sequencing:   Caporaso  et  al.  (2012)”  Ultra-­‐high-­‐throughput  microbial  community  analysis  on  the   Illumina  HiSeq  and  MiSeq  planorms.  ISME  J  6:  1621-­‐1624.”   Reviews  on  aerosol  science  and  molecular  biology:  Peccia  et  al.,  (2011)  "New   Direc8ons:  A  revolu8on  in  DNA  sequencing  …”,  Atm.  Environ.,  45:  1896-­‐1897.  AND     Peccia,  J.,  Hernandez,  M.  (2006)  "Incorpora8ng  Polymerase  chain  reac8on-­‐based   iden8fica8on  …",  Atm  Environ.,  40:  3941-­‐3961.   Good  fungal  aerosol  next  gen  sequencing  paper.  Adams  et  al.(2013)  Dispersal  in   microbes:  fungi  in  indoor  air  are  dominated  by  outdoor  air  and  show  dispersal   limita8on  at  short  distances.  ISME  J.  doi.org/10.1038/ismej.2013.28   Brocks  Biology  of  Microorganisms  (11th  ediDon  or  higher):  easy  to  understand   textbook  that  covers  microbial  gene8cs  and  phylogene8cs   64   Good  viral  aerosol/qPCR  paper.  Yang  et  al.,  (2011).  “Concentra8ons  and  size   distribu8ons  of  airborne  influenza  A  viruses  measured  indoors  at  a  health  centre…”   Journal  of  the  Royal  Society  Interface,  8,  1176-­‐1184.