Programming for Biologists
<ul><li>What  is program?? </li></ul><ul><li>Set of instructions </li></ul><ul><li>Also referred as “source code” </li></ul>
<ul><li>Why ??? </li></ul><ul><ul><li>Availability of huge amount of  biological data.. </li></ul></ul><ul><ul><li>Handle ...
<ul><li>Possible ways:- </li></ul><ul><li>Use existing bioinformatics tools </li></ul><ul><li>Simple biological programmin...
<ul><li>Tools </li></ul><ul><ul><li>BLAST </li></ul></ul><ul><ul><li>MATLAB </li></ul></ul><ul><ul><li>FASTA </li></ul></u...
<ul><li>Programming languages  </li></ul><ul><li>PERL </li></ul><ul><li>C Programming  </li></ul><ul><li>C++  </li></ul><u...
<ul><li>Most widely used language for resolving biological problems is </li></ul><ul><li>“ PERL” </li></ul><ul><li>(BIOPER...
<ul><li>Programming language </li></ul><ul><li>To link data with tools or make our own. </li></ul><ul><li>Defined set of r...
<ul><li>Steps of programming </li></ul>
<ul><li>How can u do this… </li></ul><ul><li>To Store a raw sequence obtained from a wet lab experiment write this simple ...
 
<ul><li>To transcribe from DNA to RNA </li></ul><ul><li># Transcribing DNA into RNA </li></ul><ul><li># The DNA </li></ul>...
 
<ul><li>Basic use of PERL </li></ul><ul><li>Get the sequential data  </li></ul><ul><li>Transcribe DNA to RNA </li></ul><ul...
Advanced use of PERL…. <ul><li>Parsing the BLAST outputs of alignment of sequences </li></ul><ul><li>Simulate DNA mutation...
PERL(BIOPERL)’s benefits <ul><li>Ease of programming </li></ul><ul><li>Rapid prototyping </li></ul><ul><li>Portability ,Sp...
<ul><li>List of modules provided along with BIOPERL for bioinformatics tasks are shown in the link below. </li></ul><ul><u...
<ul><li>Any Questions??? </li></ul><ul><li>Hope you found it informative!!!!! </li></ul>
Upcoming SlideShare
Loading in …5
×

Programming for biologists

352 views
322 views

Published on

Published in: Education, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
352
On SlideShare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
6
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Programming for biologists

  1. 1. Programming for Biologists
  2. 2. <ul><li>What is program?? </li></ul><ul><li>Set of instructions </li></ul><ul><li>Also referred as “source code” </li></ul>
  3. 3. <ul><li>Why ??? </li></ul><ul><ul><li>Availability of huge amount of biological data.. </li></ul></ul><ul><ul><li>Handle this data. </li></ul></ul><ul><ul><li>Utilization of data. </li></ul></ul><ul><ul><li>Reduce duplication of data further. </li></ul></ul>
  4. 4. <ul><li>Possible ways:- </li></ul><ul><li>Use existing bioinformatics tools </li></ul><ul><li>Simple biological programming </li></ul><ul><ul><ul><ul><li>For extraction of data </li></ul></ul></ul></ul><ul><ul><ul><ul><li>Data manipulation </li></ul></ul></ul></ul><ul><ul><ul><ul><li>Storing result for future use. </li></ul></ul></ul></ul>
  5. 5. <ul><li>Tools </li></ul><ul><ul><li>BLAST </li></ul></ul><ul><ul><li>MATLAB </li></ul></ul><ul><ul><li>FASTA </li></ul></ul><ul><ul><li>PHYLODRAW </li></ul></ul><ul><ul><li>PHYLIP </li></ul></ul><ul><ul><li>CLUSTAL-W </li></ul></ul><ul><ul><li>T-COFFEE </li></ul></ul><ul><ul><li>ETC.. </li></ul></ul><ul><li>Databases </li></ul><ul><ul><li>SWISS-PROT </li></ul></ul><ul><ul><li>NCBI-PUBMED </li></ul></ul><ul><ul><li>GENBANK </li></ul></ul><ul><ul><li>MMDB </li></ul></ul><ul><ul><li>EMBL </li></ul></ul><ul><ul><li>PIR </li></ul></ul><ul><ul><li>RCSB </li></ul></ul><ul><ul><li>PDB </li></ul></ul><ul><ul><li>ETC.. </li></ul></ul><ul><li>Bioinformatics tools and databases </li></ul>
  6. 6. <ul><li>Programming languages </li></ul><ul><li>PERL </li></ul><ul><li>C Programming </li></ul><ul><li>C++ </li></ul><ul><li>R Programming </li></ul>
  7. 7. <ul><li>Most widely used language for resolving biological problems is </li></ul><ul><li>“ PERL” </li></ul><ul><li>(BIOPERL) </li></ul>
  8. 8. <ul><li>Programming language </li></ul><ul><li>To link data with tools or make our own. </li></ul><ul><li>Defined set of rules to write a program. </li></ul><ul><li>Similar to natural , spoken languages but more strictly defined. </li></ul>
  9. 9. <ul><li>Steps of programming </li></ul>
  10. 10. <ul><li>How can u do this… </li></ul><ul><li>To Store a raw sequence obtained from a wet lab experiment write this simple code </li></ul><ul><ul><ul><li>#Stores sequence in variable DNA </li></ul></ul></ul><ul><ul><ul><li>$DNA = 'ACGTGGTCCATGGTATTA'; </li></ul></ul></ul><ul><ul><ul><li>#Displays the value of variable DNA </li></ul></ul></ul><ul><ul><ul><li>print $DNA; </li></ul></ul></ul><ul><ul><ul><li>exit; </li></ul></ul></ul>
  11. 12. <ul><li>To transcribe from DNA to RNA </li></ul><ul><li># Transcribing DNA into RNA </li></ul><ul><li># The DNA </li></ul><ul><li>$DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; </li></ul><ul><li># Print the DNA onto the screen </li></ul><ul><li>print &quot;Here is the starting DNA:nn&quot;; </li></ul><ul><li>print &quot;$DNAnn&quot;; </li></ul><ul><li># Transcribe the DNA to RNA by substituting all T's with U's. </li></ul><ul><li>$RNA = $DNA; </li></ul><ul><li>$RNA =~ s/T/U/g; </li></ul><ul><li># Print the RNA onto the screen </li></ul><ul><li>print &quot;Here is the result of transcribing the DNA to </li></ul><ul><li>RNA:nn&quot;; </li></ul><ul><li>print &quot;$RNAn&quot;; </li></ul><ul><li># Exit the program. </li></ul><ul><li>exit; </li></ul>
  12. 14. <ul><li>Basic use of PERL </li></ul><ul><li>Get the sequential data </li></ul><ul><li>Transcribe DNA to RNA </li></ul><ul><li>Concatenate sequences </li></ul><ul><li>Make the reverse complement of sequences </li></ul><ul><li>Search the motifs </li></ul><ul><li>Read sequence data from files </li></ul>
  13. 15. Advanced use of PERL…. <ul><li>Parsing the BLAST outputs of alignment of sequences </li></ul><ul><li>Simulate DNA mutations </li></ul><ul><li>Translating DNA to proteins </li></ul><ul><li>Read DNA from files in FASTA format </li></ul><ul><li>Parsing data from different online databases.. </li></ul>
  14. 16. PERL(BIOPERL)’s benefits <ul><li>Ease of programming </li></ul><ul><li>Rapid prototyping </li></ul><ul><li>Portability ,Speed and Program Maintenance </li></ul><ul><li>Available as open source </li></ul><ul><li>Comes along with different modules for complex manipulations on the data </li></ul>
  15. 17. <ul><li>List of modules provided along with BIOPERL for bioinformatics tasks are shown in the link below. </li></ul><ul><ul><li>BIOPERL MODULES </li></ul></ul>
  16. 18. <ul><li>Any Questions??? </li></ul><ul><li>Hope you found it informative!!!!! </li></ul>

×