Programming for biologists
Upcoming SlideShare
Loading in...5
×

Like this? Share it with your network

Share
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
309
On Slideshare
309
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
3
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Programming for Biologists
  • 2.
    • What is program??
    • Set of instructions
    • Also referred as “source code”
  • 3.
    • Why ???
      • Availability of huge amount of biological data..
      • Handle this data.
      • Utilization of data.
      • Reduce duplication of data further.
  • 4.
    • Possible ways:-
    • Use existing bioinformatics tools
    • Simple biological programming
          • For extraction of data
          • Data manipulation
          • Storing result for future use.
  • 5.
    • Tools
      • BLAST
      • MATLAB
      • FASTA
      • PHYLODRAW
      • PHYLIP
      • CLUSTAL-W
      • T-COFFEE
      • ETC..
    • Databases
      • SWISS-PROT
      • NCBI-PUBMED
      • GENBANK
      • MMDB
      • EMBL
      • PIR
      • RCSB
      • PDB
      • ETC..
    • Bioinformatics tools and databases
  • 6.
    • Programming languages
    • PERL
    • C Programming
    • C++
    • R Programming
  • 7.
    • Most widely used language for resolving biological problems is
    • “ PERL”
    • (BIOPERL)
  • 8.
    • Programming language
    • To link data with tools or make our own.
    • Defined set of rules to write a program.
    • Similar to natural , spoken languages but more strictly defined.
  • 9.
    • Steps of programming
  • 10.
    • How can u do this…
    • To Store a raw sequence obtained from a wet lab experiment write this simple code
        • #Stores sequence in variable DNA
        • $DNA = 'ACGTGGTCCATGGTATTA';
        • #Displays the value of variable DNA
        • print $DNA;
        • exit;
  • 11.  
  • 12.
    • To transcribe from DNA to RNA
    • # Transcribing DNA into RNA
    • # The DNA
    • $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';
    • # Print the DNA onto the screen
    • print "Here is the starting DNA:nn";
    • print "$DNAnn";
    • # Transcribe the DNA to RNA by substituting all T's with U's.
    • $RNA = $DNA;
    • $RNA =~ s/T/U/g;
    • # Print the RNA onto the screen
    • print "Here is the result of transcribing the DNA to
    • RNA:nn";
    • print "$RNAn";
    • # Exit the program.
    • exit;
  • 13.  
  • 14.
    • Basic use of PERL
    • Get the sequential data
    • Transcribe DNA to RNA
    • Concatenate sequences
    • Make the reverse complement of sequences
    • Search the motifs
    • Read sequence data from files
  • 15. Advanced use of PERL….
    • Parsing the BLAST outputs of alignment of sequences
    • Simulate DNA mutations
    • Translating DNA to proteins
    • Read DNA from files in FASTA format
    • Parsing data from different online databases..
  • 16. PERL(BIOPERL)’s benefits
    • Ease of programming
    • Rapid prototyping
    • Portability ,Speed and Program Maintenance
    • Available as open source
    • Comes along with different modules for complex manipulations on the data
  • 17.
    • List of modules provided along with BIOPERL for bioinformatics tasks are shown in the link below.
      • BIOPERL MODULES
  • 18.
    • Any Questions???
    • Hope you found it informative!!!!!