Chapter 20 part 1

2,248 views

Published on

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
2,248
On SlideShare
0
From Embeds
0
Number of Embeds
106
Actions
Shares
0
Downloads
67
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Chapter 20 part 1

  1. 1. BiotechnologyAP Biology 2007-2008
  2. 2. A Brave New WorldAP Biology
  3. 3. TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAG human genomeACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGA 3.2 billion basesCATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACAP Biology
  4. 4. Biotechnology today  Genetic Engineering  manipulation of DNA  if you are going to engineer DNA & genes & organisms, then you need a set of tools to work with  this unit is a survey of those tools…AP Biology Our tool kit…
  5. 5. Bacteria  Bacteria review  one-celled prokaryotes  reproduce by mitosis  binary fission  rapid growth  generation every ~20 minutes  108 (100 million) colony overnight!  dominant form of life on Earth  incredibly diverseAP Biology
  6. 6. Bacterial genome  Single circular chromosome  haploid  naked DNA  no histone proteins  ~4 million base pairs  ~4300 genes  1/1000 DNA in eukaryote How have these little guys gotten to be so diverse??AP Biology
  7. 7. Transformation promiscuous!?  Bacteria are opportunists  pick up naked foreign DNA mix heat-killed wherever it may be hanging out pathogenic &  have surface transport proteins that are non-pathogenic bacteria specialized for the uptake of naked DNA  import bits of chromosomes from other bacteria  incorporate the DNA bits into their own chromosome  express new genes  transformation mice die  form of recombinationAP Biology
  8. 8. Plasmids  Small supplemental circles of DNA  5000 - 20,000 base pairs  self-replicating  carry extra genes  2-30 genes  genes for antibiotic resistance  can be exchanged between bacteria  bacterial sex!!  rapid evolution  can be imported from environmentAP Biology
  9. 9. How can plasmids help us?  A way to get genes into bacteria easily  insert new gene into plasmid  insert plasmid into bacteria = vector  bacteria now expresses new gene  bacteria make new protein transformed gene from bacteria recombinant other organism plasmid cut DNA + vector glue DNA plasmidAP Biology
  10. 10. Biotechnology  Plasmids used to insert new genes into bacteria cut DNAgene we want like what? …insulin cut plasmid DNA …HGH …lactase Cut DNA? DNA scissors? ligase insert “gene we want”recombinant into plasmid... AP Biology plasmid “glue” together
  11. 11. How do we cut DNA?  Restriction enzymes  restriction endonucleases  discovered in 1960s  evolved in bacteria to cut up foreign DNA  “restrict” the action of the attacking organism  protection against viruses & other bacteria  bacteria protect their own DNA by methylation & by not using the base sequences recognized by the enzymes in their own DNAAP Biology
  12. 12. What do you notice about these phrases? radar racecar palindromes Madam I’m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? go hang a salami I’m a lasagna hogAP Biology
  13. 13. Madam I’m Adam Restriction enzymes  Action of enzyme   cut DNA at specific sequences CTGAATTCCG GACTTAAGGC  restriction site   symmetrical “palindrome”  produces protruding ends CTG|AATTCCG  sticky ends GACTTAA|GGC  will bind to any complementary DNA  Many different enzymes  named after organism they are found in  EcoRI, HindIII, BamHI, SmaIAP Biology
  14. 14. Restriction enzymes  Cut DNA at specific sites  leave “sticky ends” restriction enzyme cut site GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site GTAACG AATTCACGCTT CATTGCTTAA GTGCGAAAP Biology
  15. 15. Sticky ends  Cut other DNA with same enzymes  leave “sticky ends” on both  can glue DNA together at “sticky ends” GTAACG AATTCACGCTT gene you want CATTGCTTAA GTGCGAA GGACCTG AATTCCGGATA chromosome want to add CCTGGACTTAA GGCCTAT gene to GGACCTG AATTCACGCTT combined DNA CCTGGACTTAA GTGCGAAAP Biology
  16. 16. Sticky ends help glue genes together cut sites gene you want cut sites TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA AATTCTACGAATGGTTACATCGCCG isolated gene sticky ends GATGCTTACCAATGTAGCGGCTTAA cut sites chromosome want to add gene to AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAADNA ligase joins the strands Recombinant DNA molecule sticky ends stick together chromosome with new gene added TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC AP Biology
  17. 17. How can bacteria read Why mix genes together? human DNA?  Gene produces protein in different organism or different individual human insulin gene in bacteria TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC “new” protein from organism ex: human insulin from bacteria aa aa aa aa aa aa aa aa aa aa bacteria human insulinAP Biology
  18. 18. The code is universal  Since all living organisms…  use the same DNA  use the same code book  read their genes the same wayAP Biology
  19. 19. Copy (& Read) DNA  Transformation  insert recombinant plasmid into bacteria  grow recombinant bacteria in agar cultures  bacteria make lots of copies of plasmid  “cloning” the plasmid  production of many copies of inserted gene  production of “new” protein  transformed phenotype DNA  RNA  protein  traitAP Biology
  20. 20. Grow bacteria…make more transformed gene from bacteria recombinant other organism plasmid + vector plasmid grow bacteria harvest (purify) proteinAP Biology
  21. 21. Uses of genetic engineering  Genetically modified organisms (GMO)  enabling plants to produce new proteins  Protect crops from insects: BT corn  corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)  Extend growing season: fishberries  strawberries with an anti-freezing gene from flounder  Improve quality of food: golden rice  rice producing vitamin A improves nutritional valueAP Biology
  22. 22. Green with envy?? Jelly fish “GFP”AP Biology Transformed vertebrates
  23. 23. Cut, Paste, Copy, Find…  Word processing metaphor…  cut  restriction enzymes  paste  ligase  copy  plasmids  bacterial transformation  is there an easier way??  find  ????AP Biology
  24. 24. I’m a very special pig! Got any Questions?AP Biology 2007-2008
  25. 25. More Basic Biotechnology Tools Sorting & Copying DNAAP Biology 2007-2008
  26. 26. Many uses of restriction enzymes…  Now that we can cut DNA with restriction enzymes…  we can cut up DNA from different people… or different organisms… and compare it  why?  forensics  medical diagnostics  paternity  evolutionary relationships  and more…AP Biology
  27. 27. Comparing cut up DNA  How do we compare DNA fragments?  separate fragments by size  How do we separate DNA fragments?  run it through a gelatin  agarose  made from algae  gel electrophoresis DNA jello?? Can’t we just add those little marshmallows?AP Biology
  28. 28. Gel electrophoresis  A method of separating DNA in a gelatin-like material using an electrical field  DNA is negatively charged  when it’s in an electrical field it moves toward the positive side DNA   –AP Biology “swimming through Jello” +
  29. 29. Gel electrophoresis  DNA moves in an electrical field…  so how does that help you compare DNA fragments?  size of DNA fragment affects how far it travels  small pieces travel farther  large pieces travel slower & lag behind DNA   – “swimming through Jello” +AP Biology
  30. 30. Gel Electrophoresis DNA & restriction enzyme - wells longer fragments power source gel shorter fragmentsAP Biology + completed gel
  31. 31. fragments of DNA Running a gel separate out based on size cut DNA with restriction enzymes 1 2 3 Stain DNA  ethidium bromide binds to DNA  fluoresces under UV lightAP Biology
  32. 32. Uses: Evolutionary relationships  Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel fruitfly – DNA 1 2 3 4 5 1 2 3 4 5  +AP Biology
  33. 33. Uses: Medical diagnostic  Comparing normal allele to disease allele chromosome chromosome with with normal allele 1 disease-causing allele 2 – DNA  Example: test for Huntington’s disease +AP Biology
  34. 34. Uses: Forensics  Comparing DNA sample from crime scene with suspects & victim suspects crime scene S1 S2 S3 V sample – DNA AP Biology +
  35. 35. DNA fingerprints  Comparing blood samples on defendant’s clothing to determine if it belongs to victim  DNA fingerprinting  comparing DNA banding pattern between different individuals  ~unique patternsAP Biology
  36. 36. Differences at the DNA level  Why is each person’s DNA pattern different?  sections of “junk” DNA  doesn’t code for proteins  made up of repeated patterns  CAT, GCC, and others  each person may have different number of repeats  many sites on our 23 chromosomes with different repeat patterns GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTT CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAAAP Biology
  37. 37. DNA patterns for DNA fingerprintsAllele 1 cut sites repeats cut sites GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAACut the DNA GCTTGTAACG GCCTCATCATCATCGCCG GCCTACGCTT CGAACATTGCCG GAGTAGTAGTAGCGGCCG GATGCGAA 1 2 3 – DNA  + allele 1AP Biology
  38. 38. Differences between peopleAllele 1 cut sites cut sites GCTTGTAACG GCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAAAllele 2: more repeats GCTTGTAACG GCCTCATCATCATCATCATCATCCG GCCTACGCTT CGAACATTGCCG GAGTAGTAGTAGTAGTAGTAGGCCG GATGCGAA 1 2 3DNA fingerprint – DNA  + allele 1 allele 2AP Biology
  39. 39. RFLPs  Restriction Fragment Length Polymorphism  differences in DNA between individuals Alec Jeffries 1984  change in DNA sequence affects restriction enzyme “cut” site  creates different fragment sizes &AP Biology different band pattern
  40. 40. Polymorphisms in populations  Differences between individuals at the DNA level  many differences accumulate in “junk” DNArestriction enzyme cutting sites 2 bands - + single base-pair change 1 band - + sequence duplication 2 different bands - + AP Biology
  41. 41. RFLP / electrophoresis use in forensics  1st case successfully using DNA evidence  1987 rape case convicting Tommie Lee Andrews “standard” semen sample from rapist blood sample from suspect How can you “standard” compare DNA fromblood & from semen? RBC? “standard” semen sample from rapist blood sample from suspectAP Biology “standard”
  42. 42. Electrophoresis use in forensics  Evidence from murder trial  Do you think suspect is guilty?blood sample 1 from crime sceneblood sample 2 from crime sceneblood sample 3 from crime scene “standard” blood sample from suspect OJ Simpson blood sample from victim 1 N Brown blood sample from victim 2 R Goldman AP Biology “standard”
  43. 43. Uses: Paternity  Who’s the father? – DNA Mom F1 F2 child AP Biology +
  44. 44. Making lots of copies of DNA But it would be so much easier if we didn’t have to use bacteria every time…AP Biology 2007-2008
  45. 45. Copy DNA without plasmids? PCR!  Polymerase Chain Reaction  method for making many, many copies of a specific segment of DNA  ~only need 1 cell of DNA to start No more bacteria, No more plasmids, No more E. coli smelly looks!AP Biology
  46. 46. PCR process  It’s copying DNA in a test tube!  What do you need?  template strand  DNA polymerase enzyme  nucleotides  ATP, GTP, CTP, TTP  primerAP Biology Thermocycler
  47. 47. PCR primers  The primers are critical!  need to know a bit of sequence to make proper primers  primers can bracket target sequence  start with long piece of DNA & copy a specified shorter segment  primers define section of DNA 20-30 cycles to be cloned 3 steps/cycle 30 sec/stepAP Biology
  48. 48. PCR process  What do you need to do?  in tube: DNA, DNA polymerase enzyme, primer, nucleotides  denature DNA: heat (90°C) DNA to separate strands  anneal DNA: cool to hybridize with primers & build DNA (extension) What does 90°C do to our DNA polymerase?AP Biology play DNAi movie
  49. 49. PCR The polymerase problem 20-30 cycles 3 steps/cycle  Heat DNA to denature (unwind) it 30 sec/step  90°C destroys DNA polymerase  have to add new enzyme every cycle  almost impractical!  Need enzyme that can withstand 90°C…  Taq polymerase  from hot springs bacteria  Thermus aquaticusAP Biology
  50. 50. I’m a-glow! Got any Questions?AP Biology 2007-2008

×