Evolution (A Consolidated PPT)

2,793 views

Published on

I tried to integrate basic and important concepts of evolution from different ppt that can be downloaded here in slideshare to have a consolidated theme about evolution.

Published in: Education, Technology, Spiritual
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
2,793
On SlideShare
0
From Embeds
0
Number of Embeds
5
Actions
Shares
0
Downloads
121
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Evolution (A Consolidated PPT)

  1. 1. Prepared by: Ms. IRISH M. SEQUIHOD
  2. 2. Essential Questions• Be able to describe how the earth is “just right” for life• What are the evidences of evolution?• What is evolution? How has evolution lead to the current diversity of organisms?• What is an ecological niche? How does it relate to adaptation to changing environmental conditions?• How do extinction of species and formation of new species affect biodiversity?
  3. 3. A Theory or a Fact?
  4. 4. Evolution as Theory and Fact• Confusion sometimes arises as to• whether Evolution is a theory or a fact.• Actually it is both!• The theory of Evolution deals with how• Evolution happens. Our understanding• of this process is always changing.• Evolution is also a fact as there is a• huge amount of indisputable evidence• for its occurrence.
  5. 5. The Earth: The PERFECT PLANET• Temperature – Distance from Sun – Geothermal energy from core – Temperature fluctuated only 10-20oC over 3.7 billion years despite 30-40% increase in solar output• Water exists in 3 phases• Right size (=gravitational mass to keep atmosphere)• Resilient and adaptive• Each species here today represents a long chain of evolution and each plays a role in its respective ecosystem
  6. 6. Summary of Evolution of Life Chemical Evolution (1 billion years) Formation Small Large First of the organic organic protocells earth’s molecules molecules form in early form in (biopolymers) the seas crust and the seas form inatmosphere the seas Biological Evolution (3.7 billion years) Single-cell Single-cell Variety of prokaryotes eukaryotes multicellular form in form in organisms the seas the seas form, first in the seas and later on land
  7. 7. Biological Evolution Modern humans (Homo sapiens) appear about 2 seconds before midnight Age of Recorded human history begins Age of mammals 1/4 second before midnight reptiles Insects and Origin of life (3.6–3.8 billion years ago) amphibians invade the landPlantsinvadethe landFossilsbecomeabundant Fossils present Evolution and but rare expansion of life
  8. 8. Evidence (1): Biochemistry • The basic similarity of all living things suggests • that they evolved from a single common ancestor. • As we have already seen, all living things pass • on information from generation to generation • using the DNA molecule. • All living things also use a molecule • called ATP to carry DNA for • energy around the ATP forInformation Transfer • organism. Energy Transfer
  9. 9. Evidence (2): Similar GenesHUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGACHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGAGORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGAGenetic code of chimps and gorillas is almost identical to humans• If evolution is true then we might also expect that closely related organisms will be more similar to one another thanmore distantly related organisms.• Comparison of the human genetic code with that of other organisms show that chimpanzees are nearly geneticallyidentical (differ by less than 1.2%) whereas the mouse differs by ≈15%.
  10. 10. Evidence (3): Comparative Anatomy • Similar comparisons can be made based on anatomical evidence. • The skeleton of humans and gorillas are very similar suggesting they shared a recent common ancestor, but very different from the more distantly related woodlouse… yet all have a commonHuman and Gorilla shared characteristic: bilateral symmetry Woodlouse
  11. 11. Evidence (4): Homology The pentadactyl limb is ancestral to all vertebrates… but modified for different uses
  12. 12. Evidence (5): Vestigial Structures • As evolution progresses, some structures get side-lined as they are not longer of use. These are known as vestigial structures. • The coccyx is a much reduced version of an ancestral tail, which was formerly adapted to aid balance and climbing.The coccyx is a vestigial tail • Another vestigial structure in humans is the appendix.
  13. 13. Evidence (6): Fossil RecordThe fossil record shows a sequence from simple bacteria tomore complicated organisms through time and provides the most compelling evidence for evolution.
  14. 14. Fossil formationThere are many ways in which an organism can be fossilisedOne of these ways is shown in the next sequence of slidesIn principle, a fossil is formed when an organism dies, its body isenclosed in mud, or sand. The soft parts decay but some ofthe hard parts (skeleton, shells, seeds) are preservedThe mud or sand eventually becomes rock and the hard parts of theorganism are mineralised.When the rock is exposed as a result of earth movements or erosion,the fossil remains can be dug out and studied.
  15. 15. 4The sediment eventually becomes rockFish B becomes a fossil much later than fish AThe deeper the rock layer, the older the fossilLiving fish BDiesEnclosed in sedimentHard parts fossilisedLiving fish ADiesEnclosed in sedimentHard parts fossilised
  16. 16. 6 more recent sediment collectsolder sedimentbecomes rock fish skeleton fossilised
  17. 17. 7land raised abovewater level recent rock older rock
  18. 18. 8 fossilised skeleton exposedearth movementsfracture rock
  19. 19. Evidence (7): Transitional fossils • Many fossils show a clear transition from one species, or group, to another. • Archaeopteryx was found in Germany in 1861. It share many characteristics with both dinosaurs and birds.Archaeopteryx • It provides good evidence that birds arose from dinosaur ancestors
  20. 20. Evidence (8): Geography • Geographic spread of organisms also tells of their past evolution. • Marsupials occur in two populations today in the Americas and Australia. • This shows the group evolved before the continents drifted apart
  21. 21. Evidence (9): Antibiotic resistance Staphylococcus • We are all familiar with the way that certain bacteria can become resistant to antibiotics • This is an example of natural selection in action. The antibiotic acts as an environmental pressure. It weeds out those bacteria with low resistance and only those with high resistance survive to reproduce.
  22. 22. Charles Darwin • Evolution, or change over time, is the process by which modern organisms have descended from ancient organisms. • A scientific theory is a well- supported testable explanation of phenomena that have occurred in the natural world.
  23. 23. Voyage of the Beagle
  24. 24. Voyage of the Beagle• Dates: February 12th, 1831• Captain: Charles Darwin• Ship: H.M.S. Beagle• Destination: Voyage around the world.• Findings: evidence to propose a revolutionary hypothesis about how life changes over time
  25. 25. Voyage of the Beagle
  26. 26. Patterns of Diversity• Darwin visited Argentina and Australia which had similar grassland ecosystems. – those grasslands were inhabited by very different animals. – neither Argentina nor Australia was home to the sorts of animals that lived in European grasslands.
  27. 27. Patterns of Diversity• Darwin posed challenging questions. – Why were there no rabbits in Australia, despite the presence of habitats that seemed perfect for them? – Why were there no kangaroos in England?
  28. 28. Living Organisms and Fossils• Darwin collected the preserved remains of ancient organisms, called fossils.• Some of those fossils resembled organisms that were still alive today. Others looked completely unlike any creature he had ever seen.• As Darwin studied fossils, new questions arose. – Why had so many of these species disappeared? – How were they related to living species?
  29. 29. The Galapagos Island• The smallest, lowest islands were hot, dry, and nearly barren-Hood Island-sparse vegetation• The higher islands had greater rainfall and a different assortment of plants and animals-Isabela- Island had rich vegetation.• Darwin was fascinated in particular by the land tortoises and marine iguanas in the Galápagos.• Giant tortoises varied in predictable ways from one island to another.• The shape of a tortoises shell could be used to identify which island a particular tortoise inhabited.
  30. 30. The Galapagos Island
  31. 31. Animals found in the Galapagos• Land Tortoises• Darwin Finches• Blue-Footed Booby• Marine Iguanas
  32. 32. The Journey Home• Darwin Observed that characteristics of many plants and animals vary greatly among the islands• Hypothesis: Separate species may have arose from an original ancestor
  33. 33. Ideas that shaped Darwin’s Thinking• James Hutton:• 1795 Theory of Geological change – Forces change earth’s surface shape – Changes are slow – Earth much older than thousands of years
  34. 34. Ideas that shaped Darwin’s Thinking• Charles Lyell• Book: Principles of Geography• Geographical features can be built up or torn down• Darwin thought if earth changed over time, what about life?
  35. 35. Ideas that shaped Darwin’s Thinking Population Growth • Thomas Malthus-19th century English economist • If population grew (more Babies born than die) – Insufficient living space – Food runs out – Darwin applied this theory to animals
  36. 36. Discovery (1) Fixed speciesFrom Classical times until long after the Renaissance, species were considered to be special creations, fixed for all time.
  37. 37. Discovery (2): Transmutation • Around 1800, scientists began to wonder whether species could change or transmute. • Lamarck thought that if an animal acquired a characteristic during its lifetime, it could pass it onto its offspring. • Hence giraffes got their long necks through generations of straining toJean Baptiste de Lamarck reach high branches. commons.wikimedia.org/wiki/Image:Jean-baptiste_lamarck2.jpg en.wikipedia.org/wiki/Image:Giraffe_standing.jpg
  38. 38. Discovery (3): Fossils and Stratahttp://en.wikipedia.org/wiki/ http://en.wikipedia.org/wiki/Image: http://en.wikipedia.org/wiki/Image:Smith_fossils2.jpgImageWilliam_Smith.g.jpg Geological_map_of_Great_Britain.jpgWilliam Smith, his geology map & some of his fossil specimensAt about the same time, geologists like William Smith weremapping the rocks and fossils of Britain. He and others showedthat different species existed in the past compared with today.
  39. 39. Discovery (4): Darwin’s Voyage • From 1831-1836, a young naturalist called Charles Darwin toured the world in HMS Beagle. • He was dazzled by the amazing diversity of life and started to wonder how it mightVoyage of the Beagle have originated en.wikipedia.org/wiki/Image:Charles_Darwin_by_G._Richmond.jpg en.wikipedia.org/wiki/Image:HMS_Beagle_by_Conrad_Martens.jpg
  40. 40. Discovery (5): Survival of the Fittest• In his Origin of Species, Natural Selection explains adaption published in 1859, Darwin proposed how one species might give rise to another.• Where food was limited, competition meant that only the fittest would survive.• This would lead to the natural selection of the best adapted individuals and eventually the evolution of a new species. Darwin in 1860 en.wikipedia.org/wiki/Image:Darwin%27s_finches.jpeg
  41. 41. Discovery (6): Huxley v. Wilberforce • Darwin’s idea of Evolution by Natural Selection was met with huge controversy. • A famous debate in 1860 pitted Bishop Wilberforce against Darwin’s bulldog, Bishop Wilberforce v. T. H. Huxley Thomas Henry Huxley.• Evolutionists got the better of the debate, but few were convinced by Darwin’s idea of Natural Selection. www.bbc.co.uk/religion/galleries/spiritualhistory/images/9.jpg
  42. 42. Discovery (7): GeneticsMendel and his peas • From 1856-63, a monk called Gregor Mendel cultivated 29,000 pea plants to investigate how evolution worked i.e., how characteristics were passed down the generations. • He figured out the basic principles of genetics. He showed that offspring received characteristics from both parents, but only the dominant characteristic trait was expressed. Mendel’s work only came to light in 1900, long after his death en.wikipedia.org/wiki/Image:Mendel.png en.wikipedia.org/wiki/Image:Doperwt_rijserwt_peulen_Pisum_sativum.jpg
  43. 43. Discovery (8): Making Sense • In the early 20th century, scientist started to make sense of how evolution worked. • Building on Mendel’s genetics, studies showed how characteristics in a population could be selected by environmental pressures. Julian Huxley • This Modern Synthesis, as Julian Huxley and the called it, brought Darwin’s Natural SelectionModern Synthesis back to the centre of evolutionary theory. en.wikipedia.org/wiki/Image:Hux-Oxon-72.jpg
  44. 44. Discovery (9): Opposition • Despite the achieval of scientific consensus on evolution, some Christian groups continued to oppose the concept. • In 1925, the teaching of evolution was outlawed in Tennessee, USA, resulting in the infamousOutside the Scopes Trial Scopes Monkey Trial www.templeton-cambridge.org/fellows/vedantam/publications/2006.02.05/eden_and_evolution/
  45. 45. Discussion: Should Creationism and Evolution be given equal time in science lessons? science.kukuchew.com/wp-content/uploads/ 2008/01/stop_following_me_creationist.jpg
  46. 46. Mechanism (1): All in the Genes • The genetic make-up of an organism is known as its genotype. • An organism’s genotype and the environment in which it lives determines its total characteristic traits i.e. its phenotype.Genotype Phenotype commons.wikimedia.org/wiki/Image:DNA_double_helix_vertikal.PNG
  47. 47. Mechanism (2): DNA • The double-helix structure of DNA was discovered in 1953. • This showed how genetic information is transferred from one cell to another almost without error.Watson and Crick and their DNAmodel of DNA replication www.chem.ucsb.edu/~kalju/chem110L/public/tutorial/images/WatsonCrick.jpg en.wikipedia.org/wiki/DNA
  48. 48. Mechanism (3): MutationTypes of mutation • However, occasional mutations or copying errors can and do occur when DNA is replicated. • Mutations may be caused by radiation, viruses, or Mutant fruitfly carcinogens. • Mutations are rare and often have damaging effects. Consequently organisms have special enzymes whose job it is to repair faulty DNA. upload.wikimedia.org/wikipedia/commons/7/79/Types-of-mutation.png humansystemstherapeutics.com/bb.htm
  49. 49. Mechanism (4): Variation • Nevertheless, some mutations will persist and increase genetic variation within a population. • Variants of a particular gene are known as alleles. For example, the one of the genes for hair colour comprises brown/blonde alleles.majorityrights.com/index.php/weblog/comments/racial_variation_in_some_parts_of_the_skull_involved_in_chewing/
  50. 50. Mechanism (5): Natural Selection • Mutant alleles spread through a Selection of dark gene population by sexual reproduction. • If an allele exerts a harmful effect, it will reduce the ability of the individual to reproduce and the allele will probably be removed from the population. • In contrast, mutants with favorable effects are preferentially passed onen.wikipedia.org/wiki/Image:Mutation_and_selection_diagram.svg
  51. 51. Mechanism (6): Peppered MothHaldane and the peppered moth • The Peppered Moth is an example of Natural Selection  in action discovered by Haldane • During the Industrial Revolution the trees on which the moth rested became soot-covered.  • This selected against the allele for pale colour in the population (which were poorly camouflaged from predators) and selected for the dark colour allele.http://en.wikipedia.org/wiki/Image:Biston.betularia.7200.jpgen.wikipedia.org/wiki/Image:Biston.betularia.f.carbonaria.7209.jpgen.wikipedia.org/wiki/J._B._S._Haldane
  52. 52. Mechanism (7): Microevolution • The dog is another example of how selection can change the frequency of alleles in a population. • Dogs have been artificially selected for certain characteristics for many years, and different breeds have different alleles. • All breeds of dog belong to the same species, Canis lupus (the wolf) so this is an example of Microevolution as no new species has resulted.Dogs are wolves www.puppy-training-solutions.com/image-files/dog-breed-information.jpg
  53. 53. Mechanism (8): Macroevolution• However, if two populations of a species become isolated from one another for tens of thousands of years, genetic difference may become marked.• If the two populations can no-longer Galapagos finches interbreed, new species are born. This is called Macroevolution.• Darwin’s Galapagos finches are an example of this process in action. www.ingala.gov.ec/galapagosislands/images/stories/ingala_images/galapagos_take_a_tour/small_pics/galapagos_map_2.jpg
  54. 54. Mechanism (9): Speciation Today? • The mosquito was introduced to the London Underground during its construction around 1900. • It became infamous in the War for attacking people shelteringLondon Underground Mosquito from the Blitz. • Studies indicate several genetic differences from its above-ground ancestors. Interbreeding between populations is difficult suggesting en.wikipedia.org/wiki/Image:Gb-lu-Angel-southbound.jpg that speciation may be occurring. en.wikipedia.org/wiki/Culex
  55. 55. 4 major mechanisms that drive evolution:• Natural Selection• Mutation• Gene Flow• Genetic Drift
  56. 56. Unifying Principles of Evolution• Perpetual Change: All species are in a continuous state of change
  57. 57. Unifying Principles of Evolution• *Nature- The combined influences of physical and biological limiting factors* acting upon an organism.
  58. 58. Unifying Principles of Evolution• *Limiting Factor- Any factor (physical or biological) which regulates• the welfare of an organism –Disease, competition, predation, environmental change, etc.
  59. 59. Darwinian Natural Selection• Three conditions necessary for evolution by natural selection to occur: – Natural variability for a trait in a population – Trait must be heritable – Trait must lead to differential reproduction• A heritable trait that enables organisms to survive AND reproduce is called an adaptation
  60. 60. Steps of Evolution by Natural Selection• Genetic variation is added to genotype by mutation• Mutations lead to changes in the phenotype• Phenotype is acted upon by nat’l selection• Individuals more suited to environment produce more offspring (contribute more to total gene pool of population)• Population’s gene pool changes over time• Speciation may occur if geographic and reproductive isolating mechanisms exist…• Natural Selection in action ...• A demonstration...
  61. 61. Selection Against or in Favor of Extreme Phenotypes• Stabilizing Selection – Intermediate forms of a trait are favored – Alleles that specify extreme forms are eliminated from a population – EX: Birth Weight and Clutch Size
  62. 62. Stabilizing Selection Number of individualsNumber of individuals Light snails Dark snails Natural Snails with eliminated eliminated selection extreme coloration are eliminated Coloration of snails Coloration of snails Average remains the same Number of individuals with intermediate coloration increases Eliminates Fringe Individuals
  63. 63. Selection Against or in Favor of Extreme Phenotypes• Disruptive Selection – Both forms at extreme ends are favored – Intermediate forms are eliminated – Bill size in African finches
  64. 64. Directional Change in the Range of Variation• Directional Selection – Shift in allele frequency in a consistent direction• Phenotypic Variation in a population of butterflies
  65. 65. MUTATIONS, MY FRIENDS!• Changes in the structure of the DNA• Adds genetic diversity to the population• May or may not be adaptive – Depends on the environment!
  66. 66. Sooooo….What’s Evolution?• The change in a POPULATION’S genetic makeup (gene pool) over time (successive generations) – Those with selective advantages (i.e., adaptations), survive and reproduce – All species descended from earlier ancestor species• Microevolution• Small genetic changes in a population such as the spread of a mutation or the change in the frequency of a single allele due to selection (changes to gene pool) – Not possible without genetic variability in a pop…• Macroevolution – Long term, large scale evolutionary changes through which new species are formed and others are lost through extinction
  67. 67. Microevolution• Changes in a population’s gene pool over time. – Genetic variability within a population is the catalyst• Four Processes cause Microevolution – Mutation (random changes in DNA—ultimate source of new alleles) [stop little] • Exposure to mutagens or random mistakes in copying • Random/unpredictable relatively rare – Natural Selection (more fit = more offspring) – Gene flow (movement of genes between pop’s) – Genetic drift (change in gene pool due to random/chance events)
  68. 68. The Case of the Peppered Moths• Industrial revolution – Pollution darkened tree trunks• Camouflage of moths increases survival from predators• Directional selection caused a shift away from light- gray towards dark-gray moths
  69. 69. Fig. 18.5, p. 287
  70. 70. Gene Flow and Genetic Drift• Gene Flow – Flow of alleles • Emigration and immigration of individuals• Genetic Drift – Random change in allele frequencies over generations brought about by chance – In the absence of other forces, drift leads to loss of genetic diversity • Elephant seals, cheetahs
  71. 71. Speciation Adapted to cold through heavier Northern fur, short ears, population short legs, short nose. White fur Arctic Fox matches snow Spreads for camouflage. northward Different environmentalEarly fox and conditions lead to differentpopulation southward selective pressures and evolution and into two different species. separates Adapted to heat through lightweight Southern fur and long ears, population legs, and nose, which Gray Fox give off more heat.
  72. 72. Speciation• Two species arise from one – Requires Reproductive isolation • Geographic: Physically separated • Temporal: Mate at different times • Behavioral: Bird calls / mating rituals • Anatomical: Picture a mouse and an elephant hooking up • Genetic Inviability: Mules• Allopatric – Speciation that occurs when 2 or more populations of a species are geographically isolated from one another – The allele frequencies in these populations change – Members become so different that that can no no longer interbreed – See animation• Sympatric – Populations evolve with overlapping ranges – Behavioral barrier or hybridization or polyploidy
  73. 73. COEVOLUTION: Interaction Biodiversity• Species so tightly connected, that the evolutionary history of one affects the other and vice versa. – Ant Farmers of the Amazon
  74. 74. Coevolution• Interactions between species can cause microevolution – Changes in the gene pool of one species can cause changes in the gene pool of the other• Adaptation follows adaptation in something of a long term “arms race” between interacting populations of different populations – The Red Queen Effect• Can also be symbiotic coevolution – Angiosperms and insects (pollinators) – Corals and zooxanthellae – Rhizobium bacteria and legume root nodules
  75. 75. And NUH is the letter I use to spell Nutches,Who live in small caves, known as Niches, for hutches.These Nutches have troubles, the biggest of which isThe fact there are many more Nutches than Niches.Each Nutch in a Nich knows that some other NutchWould like to move into his Nich very much.So each Nutch in a Nich has to watch that small NichOr Nutches who havent got Niches will snitch. -On Beyond Zebra (1955) Dr. Seuss
  76. 76. Niches• A species functional role in an ecosystem• Involves everything that affects its survival and reproduction – Includes range of tolerance of all abiotic factors – Trophic characteristics – How it interacts with biotic and abiotic factors – Role it plays in energy flow and matter cycling• Fundamental Niche – Full potential range of physical chemical and biological conditions and resources it could theoretically use if there was no direct competition from other species• Realized Niche – Part of its niche actually occupied• Generalist vs. Specialist – Lives many different places, eat many foods, tolerate a wide range of conditions vs few, few, intolerant… – Which strategy is better in a stable environment vs unstable?
  77. 77. Competition and Community Diversity•Species evolve tominimizecompetition andniche overlap•Results in adiverse matrix ofdiffering specieswithin acommunity
  78. 78. Local, ecological and true extinctionThe ultimate fate of all species just as death is for allindividual organisms99.9% of all the species that have ever existed are nowextinct To a very close approximation, all species are extinctBackground vs. Mass Extinction Low rate vs. 25-90% of total Five great mass extinctions in which numerous new species (including mammals) evolved to fill new or vacated niches in changed environments 10 million years or more for adaptive radiations to rebuild biological diversity following a mass extinctionExtinctions open up new opportunities for speciation andadaptive radiation..BUT you can have too much of a goodthing!
  79. 79. Factors Affecting Extinction Rates• Natural Extinctions – Climate change – Cataclysmic event (volcano, earthquake)• Human Activities – Habitat Loss/Fragmentation – Introduction of exotic/invasive species – Pollution – Commercial harvesting – Accidental killing (tuna nets) – Harassing – Pet Trade – Urbanization – Damming/Flooding – Agricultural conversion
  80. 80. Extinction in the Context of Evolution• If – the environment changes rapidly and – The species living in these environments do not already possess genes which enable survival in the face of such change and – Random mutations do not accumulate quickly enough then,• All members of the unlucky species may die
  81. 81. Biodiversity• Speciation – Extinction=Biodiversity• Humans major force in the premature extinction of species. Extinction rate increased by 100-1000 times the natural background rate.• As we grow in population over next 50 years, we are expected to take over more of the earth’s surface and productivity. This may cause the premature extinction of up to a QUARTER of the earth’s current species and constitute a SIXTH mass extinction – Genetic engineering won’t solve this problem – Only takes existing genes and moves them around• Know why this is so important and what we are losing as it disappears….
  82. 82. USING EVOLUTION AND GENETICS TO INFORM CONSERVATION• EcoRegions Approach – Identifying biodiversity “hotspots” and focusing conservation efforts on maintaining those ecosystems – Ex. Tropics, Appalachian Mountains, etc.• “Umbrella Species” Conservation – Conserve one “sexy”, species and you conserve several others because if the interactions they have with one another – Keystone species concept• Species Survival Plan (SSP) – Zoo captive breeding programs – Population genetics in wild populations • Ex. Cheetahs, Primates, Bears, etc.

×