Presentación1 de evolucion diccionario

452 views

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
452
On SlideShare
0
From Embeds
0
Number of Embeds
3
Actions
Shares
0
Downloads
2
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Presentación1 de evolucion diccionario

  1. 1. 1
  2. 2. Tabla de Contenido 2
  3. 3. Objetivos. • Objetivo General • Investigar vocabulario evolutivo que permita un panorama amplio en el estudio de esta rama biológica. • • Objetivos Específicos • 1- Recopilar un vocabulario amplio sobre los temas vistos en el curso Evolución Biológica. • 2- Estimular el espíritu de la investigación y la lectura. • 3- Definir vocablos, términos y expresiones sobre el tema de evolución para lograr un mayor enfoque en su estudio. • • • • • • • 3
  4. 4. Introducción. • El diccionario biológico sobre términos relacionados con la evolución, pretende lograr un mayor entendimiento en el enfoque del tema de Evolución Biológica de la vida en la Tierra. Debido a la utilización de gran cantidad de términos, es importante que los estudiantes contemos con una guía para potencializar el aprendizaje adquirido en curso. • El hecho de ordenarlos alfabéticamente nos convierte la labor de encontrar definiciones, más fácil y sencilla con el uso de este diccionario. Y así fomentar cada uno de nosotros en nuestros salones de clase esta técnica investigativa con nuestros y nuestras estudiantes. • 4
  5. 5. • 8) Ácido: sustancia que en disolución aumenta la concentración de iones de hidrogeno. Y se combina con las bases para • 1) Adaptabilidad. Capacidad de acomodarse o ajustarse una cosa a otra. formas las sales. • 9) Ácido desoxirribonucleico. DNA, molécula que contiene la • 2) Adaptación. Acomodación o ajuste de una cosa a otra. información • 3) Adaptación biológica. Proceso por el que un animal o un 10) Ácido graso. Ácido orgánico con una cadena más o menos vegetal se acomodan al medio ambiente y a sus cambios. • 4) Adaptación etológica. Cambio que implican una modificación en el comportamiento de los organismos larga genética. de átomos de carbono. 11)) Ácido nucleico. Macromolécula biológica constituida por un polímero de nucleótidos, incluye dos tiempos DNA y RNA. por diferentes causas como asegurar la reproducción , buscar alimento, defenderse de sus depredadores • 12) Ácido ribonucleico. Tipo de ácidos nucleicos que incluyen el ,cambiarse periódicamente de un ambiente a otro ,cuando m-RNA, las condiciones 13) Alelo. Cada una de las formas que puede presentar un gen. ambientales son desfavorables para asegurar su sobre vivencia. • 5) Adaptación fisiológica. t-RNA y r-RNA. Los genes distintos que llevan informaciones alternativas sobre Cambio en los que los un mismo rasgo o carácter. organismos alteran la fisiología de sus cuerpos, órganos o tejidos, es decir representan un cambio en funcionamiento del organismo para resolver algún problema que se • 14) Aerobio. Organismo que solo puede vivir en un medio con oxígeno, utilizando el mecanismo de respiración aerobio. les presenta en el ambiente. • 6) Adaptación general. Cuando una especie que desarrolla una habilidad radicalmente nueva puede alcanzar nuevas partes de su ambiente. • 7) Adaptación morfológica. Cambio que presentan los organismos en su estructura externa y que le permiten a un organismo confundirse con el medio ambiente. • 15) Aislamiento. Reclusión, acción y efecto de separar a una persona o cosa. • 16) Aislamiento reproductivo. Conjunto de características, comportamientos y procesos fisiológicos que impiden que los miembros de dos especies diferentes puedan cruzarse o aparearse entre sí. 5
  6. 6. • 17) Biogeografía. Ciencia que estudia la • 20) Base nitrogenada. Son compuestos distribución de los seres vivos sobre orgánicos cíclicos, que incluyen dos o la Tierra, así como los procesos que la más átomos de nitrógeno. Son parte han originado, que la modifican y que la fundamental pueden hacer desaparecer. los nucleósidos, nucleótidos, nucleótidos • 18) Barreras precigóticas. Mecanismos cíclicos de (mensajeros de aislamiento que tienen lugar antes o dinucleótidos durante la fecundación, a la que limitan, intracelulares), (poderes reductores) y ácidos nucleicos actúan antes del intercambio gamético • 21) Bioquímica. La rama de la biología 19) Barreras postcigoticas. Todas las que que estudia los procesos químicos de los atañen a la viabilidad de los individuos seres producidos, a espontáneos, través esterilidad vivos. de abortos 22) Biosíntesis. del híbrido, compuestos Formación orgánicos a partir de de muerte prematura, híbridos débiles y compuestos más sencillos en los seres enfermizos, etc. vivos. 6
  7. 7. • 23) Cambio ambiental. Tipo de radiación adaptativa en el que • una especie que puede, a diferencia de otras, sobrevivir en un ambiente radicalmente cambiado probablemente se ramificará • en nuevas especies para cubrir los nichos ecológicos creados por el cambio ecológico. 29) Coloración críptica. Camuflaje por medio de la alteración del color de la piel. 30) Comportamiento. Manera de proceder que tienen las personas u organismos, en relación con su entorno o mundo de estímulos. • 31) Código genético. Conjunto de normas por las que la información 24) Caracteres. Condición, índole, naturaleza de algo o alguien que lo distingue de los demás. • codificada en el material genético (secuencias de ADN o ARN) se traduce en proteínas (secuencias de aminoácidos) en las células vivas. 25) Características fenotípicas. Son aquellas particularidades • 32) Codón. La información genética, en el ARNm, se escribe a partir de visibles en los organismos, es decir, la sumatoria de todas las cuatro letras, que corresponden a las bases características observables de un individuo y que son el nitrogenadas (A, C, G y U), las cuales van agrupadas de tres en tres. resultado de la interacción entre genotipo y el ambiente. Cada grupo de tres se llama codón y está encargado de codificar un aminoácido o un símbolo de puntuación (Comienzo, parada). • 26) Características genotípicas. Diferencias heredables de un individuo que están contenidas en el genotipo y que permanecen inalteradas actualmente proviene de un acto de creación por uno o varios seres 27) Charles Darwin. Naturalista inglés que postuló que todas divinos, cuyo acto de creación fue llevado a cabo de acuerdo con un las especies de seres vivos han evolucionado con el tiempo a propósito divino. de un toda antepasado la común vida del 33) Creacionismo. Conjunto de creencias, inspiradas en doctrinas religiosas, según las cuales la Tierra y cada ser vivo que existe organismo. partir durante • mediante un proceso • 34) Cromosomas. Cada uno de los pequeños cuerpos en forma de denominado selección natural. • bastoncillos en que se organiza la cromatina del núcleo celular durante 28) Cladogénesis. Suceso de bifurcación evolutiva en el que las divisiones celulares (mitosis y meiosis). cada rama y sus ramas más pequeñas son un "clado"; un mecanismo evolutivo y un proceso de evolución adaptativa que conduce hacia el desarrollo de una mayor variedad • 35) Cromosoma sexual. Cromosoma involucrado en la determinación del sexo. Se les denomina X e Y. de organismos. 7
  8. 8. • 41) Dimorfismo sexual. Variaciones en la fisonomía externa, como forma, coloración o tamaño, entre machos y hembras de • una misma especie. 36) Darwinismo. Término con el que se describen las ideas de Charles Darwin, especialmente en relación a la evolución biológica por selección natural. • • 37) Desarrollo. El desarrollo, es un proceso por el que normal un organismo evoluciona desde su origen, hasta alcanzar la está compuesta por dos juegos idénticos de X cromosomas cada uno, siendo cada uno de estos X cromosomas condición de adulto. • 42) Diploides. Especie o individuo cuya dotación autosómica diferentes entre sí y no agrupables en grupos inferiores que a su 38) Desarrollo embrionario. Período desde la fecundación hasta el nacimiento del nuevo ser, aunque no exista fecundación, vez constituyeran juegos cromosómicos de especies parentales. como sucede en los casos de partenogénesis. • 39) Descendientes. Resultado de la reproducción, es decir, • 43) Diversidad. Amplia variedad de seres vivos sobre la Tierra y el individuo o individuos producidos mediante la intervención de uno o más parentales. • los patrones naturales que la conforman, resultado de miles de 40) Deriva genética. Fuerza evolutiva que actúa junto con millones de años de evolución según procesos naturales y la selección natural cambiando las frecuencias alélicas de también de la influencia creciente de las actividades del ser las especies en el tiempo. Es un efecto estocástico que es humano. consecuencia del muestreo aleatorio en la reproducción y de la pérdida de unos alelos por azar y no por selección natural. Se trata de un cambio aleatorio en la frecuencia de alelos de una • 44) Divergencia ecológica. proceso de formación de generación a otra. Normalmente se da una pérdida de los alelos menos frecuentes y una fijación (frecuencia próxima al 100%) de nuevas especies por el cual surgen barreras al flujo los más frecuentes, resultando una disminución en la diversidad génico entre poblaciones como resultado de la selección genética de la población. divergente con base ecológica. • 45) Duplicación. Reproducción de algo en una copia 8
  9. 9. • 53) Especiación alopátrica. Especiación gradual que se produce cuando una especie ocupa una gran área geográfica que no permite que los individuos que estén muy alejados puedan cruzarse entre sí. • • 46) Efecto fundador. Consecuencias derivadas de la formación una especie diverge rápidamente en más de una especie que se halla de una nueva población de individuos a partir de un número muy reducido de éstos. • 47) Embriología. 54) Especiación cuántica. El proceso por el cual una población pequeña de reproductivamente aislada de la población original. • 55) Especiación parapátrica. La nueva especie surge en hábitats Rama de la biología que se encarga de marginales, habitualmente en los límites de distribución de una población estudiar la morfogénesis, el desarrollo embrionario y nervioso central de mayor tamaño. El flujo intermedio entre estas poblaciones puede desde la gametogénesis hasta el momento del nacimiento de los reducirse y finalmente ser inexistente, gracias a lo cual estas poblaciones seres periféricas pueden convertirse en especies diferentes. vivos. 48) Embrión. Etapa inicial del desarrollo de un ser vivo mientras • completa de las poblaciones. De hecho, la especie hija puede compartir se encuentra en el huevo o en el útero de la madre. • 56) Especiación peripátrica. Se produce sin una separación geográfica parte del rango de distribución con la especie madre e hibridar en las zonas 49) Endocitosis. Proceso por el cual la célula introduce de contacto. moléculas grandes o partículas, y lo hace englobándolas en una invaginación de la membrana citoplasmática, formando una • 57) Especiación simpátrica. Implica la divergencia de algunos demes (poblaciones locales) hasta conseguir independencia evolutiva dentro de un vesícula que termina por desprenderse de la membrana para mismo espacio geográfico. incorporarse al citoplasma. • 58) Especie. Grupo de organismos capaces de entrecruzarse y de producir • 50) Entorno. Ambiente, lo que rodea a alguien o algo. descendencia fértil. Es un grupo de poblaciones naturales cuyos miembros • 51) Esencialismo. Término que engloba las doctrinas que se pueden cruzarse entre sí. ocupan del estudio de la esencia —lo que hace que un ser sea lo • 59) Espermatozoide. Célula haploide que constituye el gameto masculino. que es— por oposición a las contingencias —lo que es • 60) Evolución. Conjunto de transformaciones o cambios a través del tiempo accidental, cuya ausencia no cuestiona la naturaleza de este ser. • que ha originado la diversidad de formas de vida que existen sobre 52) Especiación. Proceso mediante el cual una población de una la Tierra a partir de un antepasado común. determinada especie da lugar a otra u otras poblaciones, aisladas reproductivamente entre sí y con respecto a la población original. • 61) Etología. Rama de la biología y de la psicología que estudia el comportamiento de los animales en el medio en el que se encuentran. 9
  10. 10. • 62) Familias multigénicas. Grupo de loci cromosómicos cuya secuencia de nucleótidos es similar y que derivan de una secuencia común ancestral. • 63) Fecundación. Proceso por el cual dos gametos(masculino y femenino) se fusionan para crear un nuevo individuo con un genoma derivado de ambos progenitores. • 64) Fenotipo. Expresión del genotipo en función de un determinado ambiente. • 65) Fisiología. Ciencia biológica que estudia las funciones de los seres vivos • 66) Flujo genético. Transferencia de alelos de genes de una población a otra. • 67) Frecuencia alélica. Proporción que se observa de un alelo específico respecto al conjunto de los que pueden ocupar un locus determinado en la población 10
  11. 11. • 68) las Son Gametos. células sexuales haploides de • 73) Germen. Esbozo a partir del que se forma un ser vivo. los El término se emplea principalmente en botánica, como organismos pluricelulares originadas por meiosis. • 69) Gen: Es una secuencia ordenada de nucleótidos en la molécula de ADN (o ARN, en el caso de algunos virus) que contiene sinónimo de embrión (un caso particular es el germen de cereal). También se denomina así el primer tallo que brota de la semilla. • 74) Glúcido: termino general empleado para designar a los la azucares (carbohidratos o hidratos de carbono), incluyendo información necesaria para la síntesis de una los azucares simples (monosacáridos) y los azucares macromolécula con función celular específica genes duplicados. • 70) Generación. Total de seres, que forman parte complejos (polisacáridos). 75) Glucosa: monosacáridos de seis átomos de carbono, presente en numerosos vegetales y animales, es un azúcar de color blanco. de la línea de sucesión anterior o posterior de un • 76) Gónada. Órgano productor de gametos. ser de referencia y se encuentran a la misma • 77) Gregor Mendel. Monje Agustino católico y naturalista diferencia. • 71) Genética. Campo de la biología que busca comprender la herencia biológica que se transmite que describió, por medio de los trabajos que llevó a cabo con diferentes variedades del guisante o arveja (Pisum sativum), las hoy llamadas leyes de Mendel que rigen la herencia genética. de generación en generación. • 72) Genoma. Conjunto de genes de una especie. 11
  12. 12. • 83) • 78) Habilidad. Aptitud innata o desarrollada. • 79) Haploide. Número de cromosomas que se incluyen en un gameto normal de una especie. • 84) organismos dos Híbridos. Organismo de razas, especies o subespecies distintas, o de alguna o más cualidades diferentes. • 85) Hidrofobia: repulsión por el agua. Puesto que el síntoma se consideraba característico de la rabia. Se llamó también a esta enfermedad hidrofobia. • 86) Homocigótico. Organismo que para un carácter dado tiene los dos alelos del par idénticos, es decir, el fisiológicas, morfológicas y bioquímicas de los par de genes que corresponden a ese carácter son seres vivos. • 82) Heterogéneo. Compuesto de componentes entre vivo animal o vegetal procedente del cruce de dos seres humanos. generación en generación, las características reproductivo viables, que pueden ser o no fértiles. individuos femeninos de una especie (su • 81) Herencia. Manera en que se transmiten, de Cruce especies distintas que pueden producir individuos • 80) Hembra. Es el sustantivo que designa a los opuesto es macho). Puede ser utilizado en Hibridación. iguales. • 87) Huso. Estructura formada por microtúbulos que se extienden entre los dos polos de una célula cuando se o partes de distinta naturaleza. encuentra en división mitótica o meiótica. • 12
  13. 13. • 88) Individuo. Cada uno de los seres organizados de una especie, con respecto a la especie a la que pertenece. • 89)Interfase. Mempo que transcurre entre dos divisiones celulares, caracterizado por una gran actividad metabólica. • 90) Introgresión. Penetración de genes de una especie en otra por medio de la hibridación. 91) Intrones. Regiones no codificantes de los genes. • 92) Inversión. Cromosoma que tiene una parte invertida en relación a lo normal, resultado de una rotura, giro de 180° del fragmento roto y posterior reinserción. 93) Iones: átomos o moléculas dotados de carga eléctrica como consecuencia de la pérdida o adquisición de uno o más electrones. 13
  14. 14. • 94) Jerarquía orgánica: corresponde a las diferentes formas de los organismos vivientes, de los más simples a los más complejos. • 95) Jurásico: una división de la escala temporal geológica, es el sistema y período geológico central de la Era Mesozoica, que comenzó hace 199,6 ± 0,6 millones de años y acabó hace 145,5 ± 4,0 millones de años 14
  15. 15. • 96) Lamarkismo: es el término utilizado para referirse a la teoría de la evolución formulada por Lamarck. En 1809 en su libro • 101) Lípidos: Cualquiera de ciertos Filosofía zoológica propuso que las formas de vida no habían sido compuestos orgánicos, en especial esteres creadas ni permanecían inmutables, como se aceptaba en su de ácidos grasosos de cadena larga, tiempo, sino que habían evolucionado desde formas de vida más simples. Describió las condiciones que habrían propiciado la evolución de la vida y propuso el mecanismo por el que habría evolucionado. La teoría de Lamarck es la primera teoría de la evolución biológica, adelantándose en cincuenta años a la formulación de Darwin de la selección natural en su libro El origen solubles en disolventes orgánicos e insolubles en agua. • 102) Loci cromosómicos: es el conjunto de de las especies. • las posiciones de los genes los físicos son 97) Laurasia: es el nombre dado a una antigua masa de tierra del ríos, lagos o montañas, los políticos son hemisferio norte surgida hacia el final del Jurásico de la desintegración del supercontinente Pangea, separándose de Gondwana por la apertura del mar de Tetis hace entre 200 y 180 millones de años. Laurasia se dividió posteriormente en Eurasia y América del Norte. • 98) Ley de Hardy-Weinberg: establece que la composición genética de una población permanece en equilibrio mientras no actué la selección natural ni ningún otro factor y no se produzca una mutación. • imaginarios y están definidos en los mapas para delimitar los límites de cada nación. • 103) Locus: es una posición fija en un cromosoma, como la posición de un gen o de un marcador (marcador genético). 99) Ligamiento al sexo: cuando el gen A está ligado al sexo heterogamético, los machos en mamíferos por ejemplo, solo tiene una copia del gen y se llama hemicigotos, mientras que el sexo homogamético, las hembras humanas por ejemplo, tienen dos copias. • 100) Límites geográficos: Los límites geográficos se dividen en físicos y políticos. 15
  16. 16. • 110) Meiosis. Proceso de división nuclear en el que el número de • 104) Macho: corresponde al sexo masculino en aquellas especies donde cromosomas se reduce a la mitad. Compensando así el efecto duplicador hay reproducción sexual. • de la fecundación. 105) Macroevolución: se ocupa del estudio del proceso evolutivo a gran • 111) Metabolismo: es el conjunto de reacciones bioquímicas y procesos físico-químicos que ocurren en una célula y en el organismo. escala es decir, el análisis de los patrones generales del cambio evolutivo a través del tiempo geológico, y se centra en el estudio de los • de una única población. Lo que quiere decir que debemos restringir procesos evolutivos que ocurren por encima del nivel de especie. • 106) Mapa genético: es una disciplina de la genética que, mediante nuestro centro de atención a una rama del árbol de la vida. • varias técnicas, busca asignar a los distintos genes de un genoma su lugar físico en aquél. Existen dos variantes fundamentales de mapas: los genéticos, definidos mediante unidades de frecuencia de recombinación, 112) Microevolución: es la evolución a pequeña escala; es decir, dentro 113) Migración genética: es la transferencia de alelos de genes de una población a otra. • 114) Migración: término que aplica cuando un individuo o una población se desplaza desde su hábitat de origen a otro lugar. y los físicos, en los que las distancias entre loci se expresan en unidades de distancia en nucleótidos • 115) Mimetismo: es una habilidad que ciertos seres vivos poseen para asemejarse a otros organismos (con los que no guarda relación) y a su • propio entorno para obtener alguna ventaja funcional. 107) Material genético: se emplea para guardar la información genética de una forma de vida orgánica y está almacenado en el núcleo de la • 116) Mioceno: una división de la escala temporal geológica, es la cuarta célula. Para todos los organismos conocidos actualmente, el material época geológica de la era Cenozoica y a la primera época del periodo genético es casi exclusivamente ácido desoxirribonucleico (ADN o DNA). Neógeno. Comenzó hace 23,03 millones de años y terminó hace 5,332 Algunos virus usan ácido ribonucleico (ARN o RNA) como su código millones de años.2 3. genético. • • 117) Mitocondria: organela citoplasmática que se encarga de generar energía en forma de 139) ATP, además contiene ADN materno en 108) Mecanismo autoevidente: es el papel que juega la selección natural especies de reproducción sexual. como un proceso por el cual las mutaciones genéticas que mejoran la capacidad reproductiva se vuelven, y permanecen, cada vez más • ellas con el mismo número de cromosomas que la célula madre. frecuentes en las sucesivas generaciones de una población. • • 109) Mecanismos de aislamiento reproductivo: son el conjunto de Mitosis. División celular que dará origen a dos células hijas, cada una de 118) Medicina molecular: rama de la medicina que desarrolla métodos de diagnóstico y tratamiento de una enfermedad mediante la comprensión características, comportamientos y procesos fisiológicos que impiden que del funcionamiento de los genes, las proteínas y otras moléculas los miembros de dos especies diferentes puedan cruzarse o aparearse celulares. entre sí, producir descendencia o que la misma sea viable o fértil. Estas barreras constituyen una fase indispensable en la formación de nuevas especies (especiación). 16
  17. 17. • 119) Natalidad: es el cociente entre el número de individuos que nacen en una unidad de tiempo dentro de la población y su • 125) Nucleótidos: son moléculas orgánicas formadas por la tamaño. unión covalente de un monosacárido de cinco carbonos • 120) Naturaleza: es equivalente al mundo natural, universo físico, mundo material o universo material. El "naturaleza" hace referencia a los fenómenos del mundo físico, y también a la vida en general. • (pentosa), una base nitrogenada y un grupo fosfato. término 121) Neandertal: El hombre de Neandertal es una especie • 126) Número haploide: número de cromosomas que se incluyen en un gameto normal de una especie. • 127) Número extinta del género Homo que habitó Europa y partes de Asia diferentes occidental desde hace 230 000 hasta 28 000 años atrás, durante monoploide: número de cromosomas completo. el Pleistoceno medio y superior y culturalmente integrada en el Paleolítico medio. que constituyen un juego cromosómico • 128) Nutrición autótrofa: corresponde a la forma de nutrición en aquellas especies que pueden generar su • 122) Neodarwinismo: significa en general la integración de la propio alimento a partir de componentes inorgánicos. teoría de la evolución de las especies por selección natural de Charles Darwin, teoría genética de Gregor Mendel como base de la herencia biológica, la mutación genética aleatoria como fuente de aquellos organismos que consumen a otros organismos de variación y la genética de poblaciones matemática. • • 129) Nutrición heterótrofa: corresponde al tipo de nutrición para su supervivencia. 123) Neolamarkismo: trata de explicar la evolución mediante la herencia de los caracteres adquiridos durante la vida de los • 130) Nutriente: Se dice de la substancia que sirve para la nutrición del cuerpo semipermeable organismos. Lamarck, basaba su teoría evolutiva en el supuesto erróneo de que “la función crea el órgano”. • 124) Núcleo celular: parte de las células eucariotas que encierra los cromosomas. 17
  18. 18. • 131) Oligoceno: una división de la escala temporal • 137) Origen de las células eucariotas: es un complejo geológica, es la tercera época geológica del Período proceso que tiene un origen procariota. Si bien hay varias Paleógeno en la Era Cenozoica. Comenzó hace 33,9 ± teorías que explican este proceso, según la mayoría de estudios 0,1 millones de años (ma) y finalizó hace 23,03 ma. se produjo por endosimbiosis entre varios organismos procariotas, en donde el ancestro principal • 132) Ontogenia: organismo, desde describe el óvulo el desarrollo fertilizado de un protoeucariota es de tipo arqueano y las mitocondrias y hasta su cloroplastos son de origen bacteriano. senescencia, pasando por la forma adulta. • • 133) Órganos análogos: órganos con diferente origen embrionario y evolutivo pero que cumplen la misma cómo se originaron las diversas especies de seres vivos. • función. unilineal debido a alguna "fuerza directriz", ya sea interna o externa. origen embrionario y evolutivo pero con diferentes • 140) Osmosis: conjunto de fenómenos que se producen cuando dos soluciones de diversa concentración se hallan • 135) Órganos vestigiales: órganos reducidos y sin separado por una membrana semipermeable, o capaz de función aparente. permitir el paso de moléculas de solvente pero no del soluto. • 136) Origen de la vida: explica como la vida se originó a partir de materia inorgánica. 139) Ortogénesis: es una hipótesis biológica según la cual la vida tiene una tendencia innata a evolucionar de un modo • 134) Órganos homólogos: órganos con el mismo funciones. 138) Origen de las especies: teorías que intentan explicar • 141) Óvulo: célula reproductora femenina. 18
  19. 19. • 151) Procariota: Células sin núcleo definido. • 152) Profase. Fase de la división mitótica o meiótica. • 142) Paleontología: Rama de la Biología que estudia los restos fósiles de • 153) Progenie: descendencia. vidas pasadas. • 154) Progesterona. Hormona sexual femenina producida • 143) Panspermia: Teoría que intenta explicar cómo la vida en la Tierra se en los ovarios. originó gracias a esporas del espacio exterior. • 155) • 144) Papeles sexuales cambiados: Consiste en que es el macho quien escoge 145) Plasma: Fluido incoloro de la sangre en el que se hallan suspendidos los neutralizar el pH ácido del aparato reproductor femenino. 146) Permeabilidad: es un campo magnético, cociente de dividir la inducción el poder • 157) Proteína: Componente orgánico que tiene función imanador. estructural, 148) Placa metafásica. La que forman los centrómeros de los cromosomas al • enzimática, formado por teorías que intentan explicar los cambios graduales de las especies. • 159) Poliploide. Que posee más de dos series completas de cromosomas por célula. 150) Población. Grupo de organismos de la misma especie que se cruzan entre sí y están localizados en el espacio y en el tiempo. o • 158) Pruebas de la evolución: corresponde a diferentes 149) Poro: Orificio invisible a simple vista por su pequeñez, ubicado en la superficie de los animales y vegetales. hormonal aminoácidos. insertarse en el ecuador del huso. • las masculino que segega un líquido alcalino que sirve para 147) Pene. Órgano copulatorio de los machos. • estimula • 156) Próstata. Glándula aneja del aparato reproductor plaquetas. por que facilitar la llegada del espermatozoide al óvulo. elementos figurados de la sangre: leucocitos, glóbulos rojos o eritrocitos y • Sustancia contracciones del aparato reproductor femenino para a la hembra como pareja sexual. • Prostaglandinas. • 19
  20. 20. • 160) Quilo: linfa de aspecto lechoso por la gran cantidad de grasa que acarrea, y que circula por los vasos quilíferos durante la digestión. • 161) Quimiosíntesis: Teoría sobre el origen de la vida que explica cómo se originó la vida en la Tierra a partir de materia inorgánica. • 20
  21. 21. • 162) Radiación adaptativa: especiación en corto tiempo para llenar nichos ecológicos • 168) Recombinación del ADN: unión de fragmentos de ADN de diferentes moléculas • 163) Ramificación: derivación a partir de un mismo punto • 164) Raza: conjunto de organismos en que se dividen • 169) Reducción de especies: proceso dado debido a presiones ambientales • 170) Registro fósil. El conjunto de fósiles que se pueden algunas especies biológicas. • 165) Reacción en cadena de la polimerasa: es una técnica encontrar en la sucesión de estratos geológicos. de biología molecular desarrollada en 1983 por Kary • 171) Regulación de genes. Se refiere a los mecanismos Mullis,1 cuyo objetivo es obtener un gran número de bioquímicos que llevan a que los genes se expresen en copias de un fragmento de ADN particular, partiendo de un una célula o en un conjunto de ellas en determinado mínimo; en teoría basta partir de una única copia de ese momento del desarrollo de un individuo. fragmento original, o molde. • 172) Reloj molecular: Medida del tiempo de la separación • 166) Recambio de especies. Proceso de extinción masiva de especies seguido de la aparición de especies nuevas. • 167) Recesivo: alelo que homocigota para manifestarse debe requiere condición entre distintos linajes evolutivos utilizando la acumulación de diferencias genéticas o mutaciones. • 173) Reorganización del árbol de la vida: estructura taxonómica de las especies a nivel de desarrollo biológico evolutivo • 174) Replicación: proceso de duplicación del ADN 21
  22. 22. • 175) Saltacionismo: conjunto de teorías evolutivas que explican la evolución • 176) Secuenciación del ADN. Consiste en establecer el orden de las bases de un fragmento de ADN de cualquier longitud. La CTAAAGAGAGAGAGAGAGACGGAGT, secuencia por ejemplo, corresponde a las primeras veinticinco bases de una de las cadenas de ADN del cromosoma 17 del ser humano. • 177) Selección balanceada: se refiere a la selección de características extremas de una población • 178) Selección de fecundidad: los organismos más fértiles son los que sobreviven • 179) Selección de grupo: la selección puede operar a niveles superiores del individuo • 180) Selección de parentesco: cambios en el ADN que son debidos a combinación genética entre familias. • 181) Selección de viabilidad: se da cuando la competencia es en organismos adultos 22
  23. 23. • 182) Tafonomía. El estudio de los cambios que sufre un organismo desde su muerte hasta su fosilización. • 183) Tafonomía: Estudio de los procesos que afectan a los fósiles tras su enterramiento. • 184) Taiga: Bosque boreal caracterizado por la abundancia de coníferas. • 185) Taoísmo: Filosofía China • 186) Tautomería: Es un tipo especial de isomería en la que existe transposición de un átomo entre las dos estructuras • 187) Taxón: Unidad de clasificación de los organismos (por ejemplo: especie, género, familia, orden). • 188) Taxonomía biológica: Sistema de clasificación de los organismos vivos. • 189) Taxonomía. Sistema de clasificación. • 190) Tectónica de placas: teoría de movimiento de placas y separación de continentes. Importante en la evolución. • 191) Tectonismo: construcción interna de la corteza terrestre. 23
  24. 24. • 192) Ungulado. Nombre que designa a varios órdenes de los mamíferos con pezuñas. Aquellos cuyas pezuñas terminan en un número impar de dedos se llaman perisodáctilos e incluyen el caballo, el asno, la cebra, el rinoceronte y el tapir. Los que tienen pezuñas terminadas en número par de dedos se llaman artiodáctilos y comprenden al cerdo y a rumiantes como el hipopótamo, el camello, la jirafa, el antílope, el ciervo, el ganado vacuno, la oveja y la cabra. La mayoría de los ungulados son herbívoros. Habitan todos los continentes, excepto Australia. • 193) Unidad de selección: es una entidad biológica dentro de la jerarquía de la organización biológica (genes, células, organismos, grupos, especies) que está sujeta a selección natural • 194) Unidad genética: se refiere a los genes • 195) Unidades evolutivas: se refieren a las poblaciones de organismos. • 196) Uracilo: base nitrogenada presente en el ARN 24
  25. 25. • 197) Variabilidad: diferenciación entre diversos elementos • 198) Variabilidad genética: diferencias entre organismos vivos. • 199) Variación heredable: cualquier cambio genético que se de en un organismo vivo que se pueda reproducir • 200) Vestigios: órganos o estructuras que ha perdido su función o ya no se requieren. • 201) Vida. Cualidades particulares de organización propias de los seres animados. • 202) Villafranquiense: Periodo sin valor cronoestratigráfico definido por su asociación de fauna. Se correlaciona con el Pleistoceno inferior y el principio del Cuaternario. • 203) Vínculo genético familiar: relación entre individuos de una misma especie y población con lazos genéticos muy cercanos • 204) Vulcanismo: actividad geológica que libera energía del interior de la tierra. 25
  26. 26. • 205) Xenartros. Nombre común de un orden (Xenarthra) de mamíferos sudamericanos que abarca tres familias: los osos hormigueros, los armadillos y los perezosos. Antes se los incluía, junto con los africanos pangolines y oricteropos o aardvarks, entre los edentados (orden Edentata), por tratarse de animales con dientes muy poco desarrollados o sin ellos, pero los especialistas llegaron a la conclusión de que no había parentesco entre las familias sudamericanas y las africanas, y modificaron la clasificación. • 206) Xerofítico. Vegetal adaptado para resistir períodos de sequía o vivir en medios áridos. 207) Xeromorfismo. Conjunto de caracteres morfológicos y fisiológicos que brindan a las plantas protección contra la sequía. • 26
  27. 27. • 208) Zigoto. Cigoto. Célula diploide resultante de la unión de dos gametos haploides 209) Zigotos inviables: zigotos sin posibilidad de sobrevivir • 27
  28. 28. Conclusiones • 1- La recopilación de las palabras para el diccionario fue de gran provecho para enriquecer nuestros conocimientos. • 2- Al estimular la capacidad investigativa ya sea en el uso de la web o de la antología también se vio fomentada la lectura. • 3- Enriquecimiento del vocabulario al definir términos necesarios para nuestra labor docente. • 28
  29. 29. Recomendaciones. • 1- Hacer un diccionario pictórico para volver el diccionario más llamativo. Tal vez no a todos los términos pero si a algunos. • 2- Delimitar lo que se busca con el enfoque del diccionario. . • 3- Permitir entregarlo de manera individual, o sea uno por subgrupo y no uno en general. • 29
  30. 30. Bibliografía • 1- Villegas. D (2013). Antología del curso evolución biológica. San José Costa Rica. • 2- Starr & Taggar (2004). Biología. Unidad y Diversidad de la Vida. Mc Graw Hill. • •Webgrafía • 1- www.wordreference.com • 2- www.wikipedia.com 30

×